CRISPR-Cas9-baserade genomet Engineering att generera Jurkat Reporter modeller för HIV-1 infektion med valda Proviral Integration platser

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi presenterar ett genomet engineering arbetsflöde för generering av nya in vitro-modeller för HIV-1-infektion som recapitulate proviral integration på valda genomisk platser. Inriktning av HIV-derived reportrar underlättas av CRISPR-Cas9-medierad, platsspecifika genom manipulation. Detaljerade protokoll för encelliga klon generation, screening och rätt inriktning verifiering tillhandahålls.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Humant immunbristvirus (HIV) integrerar sitt proviral DNA icke-slumpmässigt i det mottagande cell genomet på återkommande platser och genomisk hotspots. Här presenterar vi ett detaljerat protokoll för generering av romanen in vitro-modeller för HIV-infektion med valda genomisk integration webbplatser som använder CRISPR-Cas9-baserade genomet verkstadsteknik. Med den här metoden kan en reporter sekvens av val integreras i en målinriktad, valt genomisk locus, reflekterande kliniskt relevanta integration platser.

I protokollet beskrivs utformningen av en HIV-derived reporter och välja ett mål platsen och gärna sekvens. En inriktning vektor med homologi armar är konstruerade och transfekterade i Jurkat T-celler. Sekvensen reporter är riktad till den valda genomiska webbplatsen av homolog rekombination underlättas av en Cas9-medierad dubbel-strand paus på målwebbplatsen. Encelliga kloner skapas och screenas för inriktning händelser av flödescytometri och PCR. Utvalda kloner sedan utvidgas, och rätt inriktning är verifierade genom PCR, sekvensering och södra blotting. Potentiella off-target händelser av CRISPR-Cas9-medierad genomet engineering analyseras.

Med hjälp av detta protokoll, romanen cellsystem kultur kan att modell hivinfektion vid kliniskt relevanta integration platser genereras. Även om generering av encelliga kloner och verifiering av rätt reporter sekvens integration är tidskrävande, är resulterande klonal raderna kraftfulla verktyg för att analysera funktionellt proviral integration webbplats val.

Introduction

Integrering av proviral DNA i värd genomet vid infektion är ett kritiskt steg i livscykeln för humant immunbristvirus (HIV). Efter integration kvarstår HIV genom att införa latens långlivade CD4 + T cell grupper såsom minne CD4 + T-celler. HIV integration verkar vara icke-slumpmässigt1,2. Ett antal genomisk hotspots med återkommande integrerade proviral DNA har påvisats i flera studier genom sekvensering av integration platser i akut och kroniskt infekterade individer2,3,4 ,5,6,7,8. Intressant, på några av dessa integration platser upptäcktes det samma locus i en stor del av infekterade celler, vilket leder till tanken att integration på återkommande platser positivt kan påverka klonal expansion1.

För att främja förståelsen för betydelsen av återkommande integration platser, måste proviral integration webbplats val utforskas. Dock flera tekniska aspekter hämma studerar HIV integration webbplats val och konsekvenser. I stort sett används cellmodeller kultur för HIV latens som JLat cellinjer inte återspeglar kliniskt relevanta återkommande integration platser9. Studier på primära patientderiverade celler, dels, aktivera Beskrivning av integration webbplats landskap genom sekvensering men möjliggör inte funktionella analyser. Till vår kunskap är ingen tillräcklig experimentell modell tillgänglig för funktionellt analysera valda kliniskt relevanta integration webbplatser.

Här presenterar vi en detaljerad arbetsflöde för att skapa nya modeller för HIV-infektion med CRISPR-Cas9-baserade genomet verkstadsteknik. Arbetsflödet som beskrivs häri kan användas för att generera T cell-derived reporter cellinjer som modell HIV-infektion, transporterar genomiskt integrerade proviral reporter på en valt integration webbplats. De tjänar alltså som nya verktyg för att utforska hur webbplatsen proviral integration kan påverka HIV biologi och hur provirus svarar på olika behandlingsstrategier (t.ex., inducibility av latens vända agenter). Vår metod använder fördelarna med CRISPR-Cas9-baserade genomet engineering, i som integration av reporter sekvens av homolog rekombination underlättas av en Cas9 nuclease alkoholinducerade dubbel-strand paus på målwebbplatsen. Mål platser för integration väljs enligt närhet till de beskrivna återkommande integration webbplatserna från studier på HIV-infekterade individer och förekomsten av lämpliga PAM motiv för Cas9-medierad genomet engineering.

I vår exemplariska resultat, har vi fokuserat på den BACH2 genen locus, som kodifierar för BTB och CNC homologi transkriptionell regulatorn 2. I chronically HIV-infekterade individer på antiretroviral behandling är BACH2 en av de lokus visar anrikning av integrerade HIV-1 sekvenser3,6,7,8,10. Vi har valt en minimal HIV-derived reporter bestående av HIV-1-härledda lång terminal upprepa (LTR), tdTomato kodande sekvens och nötkreatur tillväxthormon (BGH) polyadenylation signal (PA), som vi har riktat till två specifika platser i BACH2 intron 5. Presenterade protokollet är optimerad för Jurkat celler, en mänsklig CD4 + T-cell-derived suspension cellinje, men andra cell linjer får användas och protokollet anpassas därmed. Vi presenterar en detaljerad arbetsflöde för urval av målplatsen, byggandet av målet vektor med homologi armar, CRISPR-Cas9-medierad inriktning av reporter i valda genomisk platsen, generation och urval av klonala linjer och omfattande verifiering nyligen genererade, riktade reporter cellinjer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. inriktning strategi för genomet Engineering och inriktning Design vektor (tv)

Obs: Det första steget av genomet engineering innebär urval och generering av nödvändiga verktyg för CRISPR-Cas9-medierad inriktning. Urval av en genomisk integration webbplats locus, val av celltyp för inriktning och utformning av en HIV-derived reporter för integration bör föregå detta steg. Det här protokollet beskriver målinriktning av en HIV-LTR_tdTomato_BGH-PA minimal reporter i Jurkat målceller. Ett flödesschema i arbetsflödet för CRISPR-Cas9-baserade inriktning, generation, screening och verifikation av klonala linjer avbildas i figur 1. Strategin beskrivs inriktning använder den S. pyogenes Cas9 (SpCas9) för att generera gärna-regisserad dsDNA pauser på en valda integration webbplats. Reportern är då riktad till den valda genomisk locus genom homolog rekombination genom att tillhandahålla en icke-linearized inriktning vektor (tv) som innehåller sekvensen reporter flankerad av så kallade 5' 3' homologi armar (HA)11.

  1. Val av riktade locus, gärna och inriktning vektor design
    1. Välja thegenomic locus riktas baserat på enskilda vetenskapliga frågan. Användning publicerade listor över områden som återkommande integration av HIV återfinns hos patienter i olika studier2,3,4,5,6,7,8 som en riktlinje. I silico extrahera den genomiska sekvensen av den önskade genomisk locus vara riktade (sekvens av komplett genen) eller minst 5 kb av genomiska sekvensen med UCSC genomet webbläsare (http:// genome.edu.ucsc.edu).
    2. Välj guide RNAs (gRNAs) 20 nt för inriktning av den valda genomisk locus använder den E-skarp webtool (http://www.e-crisp.org).
      1. Välj ”Homo sapiens GRCh38” som organismen. Ingång 2 000 bp av genomiska sekvensen som täcker den önskade genomisk locus extraherade i steg 1.1.1.
      2. Starta en gärna sökning med medellång Programinställningar (någon PAM, alla 5' bas, off-mål tolerera missmatchningar och introner/CPG öarna är undantagna). Visas en lista med möjliga gärna mönster, rangordning från högsta till lägre noter för specificitet och effektivitet.
      3. Välj en gärna som helst visar ett högt betyg för specificitet och effektivitet och är så nära som möjligt till den önskade genomisk locus riktas.
        Obs: En kompromiss mellan närhet till den önskade genomisk locus och utformningen av specifika och effektiva gärna måste hittas.
    3. Spränga sekvensen valda gärna mot referens genomet i webbläsaren NCBI blast (https://blast.ncbi.nlm.nih.gov) för att kontrollera för unika med gärna bindningsstället.
      1. Välj ”människa” som genomet. Ange gärna sekvensen som fråga sekvens. Välj ”mycket liknande sekvenser” (megablast) som programmet. Säkerställa att sekvensen gärna är unik. Om inte, valde en annan gärna från steg 1.1.2.3 och blast igen.
    4. När gärna sekvens är valt, Välj i silico 1000 bp uppströms och nedströms gärna sekvens från genomiska sekvensen extraherade i steg 1.1.1 samt 5' 3' HA med detta.
      Obs: GRNAs bör vara homologa med valda genomisk integration webbplats locus och intill en protospacer intill motiv (PAM; t.ex., NGG för SpCas9) (figur 2a). TV: n innehåller reporter som är 5' och 3' flankerad av har. Har täcka 1000 bp uppströms och nedströms av gärna sekvens11. Sekvensen full gärna bör inte ingå i HA. En överlappning av upp till 5 nt är acceptabel (figur 2a).
  2. Generation av gärna och inriktning vektorer
    Obs: För vector system, se figur 2b.
    1. Generera en vektor uttryck för SpCas9 och gärna, använda den pX330-U6-Chimeric_BB-cBh-hSpCas9 som ryggraden som både SpCas9 och enda guide RNA (sgRNA) samtidigt kan uttryckas. För att klona den gärna sekvensen till ryggraden, Använd den BbsI begränsning platser12.
    2. För att generera tv, väljer du en hög-kopia plasmid som ryggraden (t.ex., pMK eller cDNA3.1).
      1. Först montera reportern (i detta protokoll: LTR_tdTomato_BGH-PA) till konstruera stamnätet av Gibson församlingen clong13 använda en kommersiell församling kloning kit, och införa 5' och 3' flankerande begränsning platser (t.ex., 5' PacI och 3' Bruno) för efterföljande begränsning matsmältningen kloning av har.
      2. Förstärka 1000 bp HA fragment valts i steg 1.1.4 från genomiskt DNA (gDNA) av celltyp riktas (i detta protokoll: Jurkat celler) med hjälp av ett DNA-polymeras med korrekturläsning aktivitet (se tabellerna 1 och 2 för PCR-ingredienser och (cykling villkor). Sedan, införa reporter flankerande begränsning platser på 5' och 3' ändarna av varje HA (PacI på 5' HA i båda ändarna, Bruno på 3' HA i båda ändarna).
      3. Sekventiellt har klon i konstruera ryggrad redan innehåller reportern (som genereras i steg 1.2.2.1) av restriktionsenzym kloning14,15. Först, klona i 5' HA använder PacI begränsning platser, sedan klona i 3' HA använda SmaI begränsning webbplatser.
        Obs: Om tv ryggraden innehåller en ytterligare fluorescerande reporter, oönskade ryggraden integration kan bedömas av flödescytometri (se steg 3.2.2 och 3.2.3). Om tv ryggraden innehåller ingen fluorescerande reporter, ryggraden integration måste bedömas med PCR (se steg 3.2.8).

Figure 1
Figur 1: arbetsflöde för CRISPR-Cas9-medierad inriktning, generation och urval av klonala reporter linjer med definierade integration hemsida. (A) generera mål vektorn och transduce Jurkat T-celler med målet vektor och Cas9/gärna uttryck plasmid. (B) Enrich de transfekterade cellerna 72 h post transfection av FACS. (C) Låt cellerna växa för 10 till 14 dagar och bekräfta förekomsten av inriktning händelser med PCR och flödescytometri. (D) generera encelliga kloner genom att begränsa utspädning och låt kloner växa i 3 veckor. (E) skärmen klonerna för rätt inriktning med PCR och flödescytometri i 96 brunnar format. Expandera valda kloner. (F) Kontrollera rätt inriktning i utvalda kloner av Southern blot, PCR och sekvensering och analys av off-target händelser Cas9 Amiiiiin verksamhet. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: inriktning strategi och vektor design. (en) gärna och val av homologi armar. 20 nt gärna är homolog till valt genomisk målwebbplatsen och beläget i anslutning till en PAM. homologi armar är komplement till 1000 bp upp- och nedströms gärna och bör inte omfatta gärna sekvensen. (b) scheman över inriktning vektor och gärna/Cas9 vektor. Inriktning vektorn består av sekvensen valda reporter som är 5' och 3' flankerad av homologi armarna. Gärna/Cas9 vektorn är baserad på pX330-U6-Chimeric_BB-cBh-hSpCas9 ryggrad. (c) Schematisk bild av inriktning av homolog rekombination. Målet vektor och guideRNA/Cas9 vektor är transfekterade i Jurkat celler. Cas9 förmedlar en dubbel strand paus på genomisk målplatsen (anges med *) och underlättar homolog rekombination och integration av reporter sekvens till det genomiska mål locus. Klicka här för att se en större version av denna siffra.

2. CRISPR-Cas9-baserade inriktning av Jurkat celler

  1. Transfection av Jurkat celler
    1. 24 h före transfection, plattan 1,25 x 106 Jurkat T celler i 2,5 mL RPMI 1640 kompletteras med 10% (v/v) fetalt kalvserum (FCS) och 4 mM L-glutamin [hänvisat till som ”RPMI w.o. antibiotika (AB)”] per brunn 6-väl cell kultur platta. För en enda inriktning experiment, förbereda en komplett 6-well platta (dvs., 6 brunnar med 2,5 mL cellsuspension).
    2. Följande dag, Co transfect cellerna med cirkulär tv och pX330-U6-Chimeric_BB-cBh-hSpCas9/gärna med ett transfection reagens för Jurkat celler.
      1. Lägg till 2 µg av cirkulär tv och 2 µg pX330-U6-Chimeric_BB-cBh-hSpCas9/gärna per brunn till 250 µL av kommersiella RPMI medium med minskad serumkoncentration optimerad för transfection (RPMI med 50% minskning av serum) i en reaktionsröret och blanda väl.
      2. Tillsätt 12 µL transfection reagens långsamt till DNA/medium utan att vidröra väggen i röret och snurra. Låt blandningen Inkubera i 15 min och tillsätt droppvis till en brunn av celler. Inkubera cellerna vid 37 ° C och 5% CO2.
        Obs: Utarbetandet av transfection reaktion kan skalas upp. Ingen medium förändring krävs efter transfection.
  2. Anrikning av transfekterade celler av fluorescens-aktiverad cell sortering (FACS)
    1. 72 h efter transfection, pool transfekterade cellerna, räkna dem och förbereda för anrikning av FACS. Samla in cellerna i en 50 mL konisk tub, Centrifugera vid 300 x g och rumstemperatur (RT) i 4 min, tvätta cellerna en gång i PBS, Centrifugera igen, centrifugerade i en lämplig mängd FACS buffert (PBS kompletteras med 1% FCS + 1 mM EDTA) 1 x 10 7 celler/mL, och slutligen överför till en FACS tube.
    2. FACS som omfattas av cellerna och sortera dem som uttrycker den fluorescerande reportern på TV (t.ex., tdTomato i detta protokoll). Samla in cellerna i RPMI 1640 kompletteras med 10% FCS, 4 mM L-glutamin, och 50 U/mL penicillin och streptomycin (kallad ”RPMI w / AB”).
    3. Efter FACS sortering, tvätta cellerna en gång genom att lägga till 20 mL RPMI w / AB till sorterade celler och centrifugera vid 300 x g i 4 min på RT. Omsuspendera cellpelleten i en lämplig mängd RPMI w / AB och platta celler i en brunn i en cell kultur platta med den lämplig volym enligt cell nummer post-FACS.
      Obs: Kultur sortera cellerna i en liten volym (t.ex., 24-Ja), som betydande nivåer av celldöd har observerats under den första veckan efter inriktning (upp till 80 – 90%).
    4. Expandera blandad riktade cell befolkningen upp till en densitet på 1 x 106 celler/mL i en 75 cm² cell kultur kolv. Detta tar omkring 10 – 14 dagar post-FACS sortering.
  3. Bekräftelse av inriktning händelser av flödescytometri i blandad riktade cell befolkningen
    1. Efter 10 – 14 dagar av expansion (när celler har nått en densitet på 1 x 106 celler/mL i en 75 cm2 cell kultur kolv), riktade plattan två brunnar med 1 x 106 celler av blandad cell befolkningen i 1 mL av RPMI w / AB i en 12-väl cellkultur plattan.
    2. Framkalla de HIV LTR av reporter (generation av tv beskrivs i steg 1.2.2.1.) i en av brunnarna genom att lägga till 50 ng/mL phorbol 12-isopropylmyristat 13-acetat (PMA) och 1 µM Ionomycin (kallad PMA-Iono). Använda celler i den andra brunnen som icke-inducerad kontroll. Kultur både den inducerade och icke-inducerad cellerna för 24 h.
    3. Ta 0,5 mL cellsuspension av icke-inducerad och inducerad celler (vardera), tvätta dem en gång i PBS och upphäva varje i 200 µL FACS buffert.
    4. Analysera 100 000 celler genom flödescytometri. Utfärda utegångsförbud för de livskraftiga singel-celler baserat på storlek på framåt och sidled scatter och analysera fluorescerande reporter genuttryck.
      Obs: i detta steg (10 – 14 dagar post-FACS sortering), övergående uttryck av fluorescerande reporter av transfection inte längre bör upptäckas. Fluorescerande uttryck vid denna tidpunkt visar genomisk integration av reporter sekvens.
  4. Identifiering av inriktning händelser genom PCR på genomisk DNA av blandad riktade cell befolkningen
    Obs: Att upptäcka inriktning händelser via PCR, design två primer par specifika för 5' integration (int.) korsningen och 3' int. junction. För 5' int. korsningen PCR, forward primer bör binda uppströms den 5' HA och reverse primer i LTR av reporter (primers P1 och P2 i figur 3a). Paret primer för 3' int. korsningen PCR bör spänner från PA av reporter till 100 – 200 bp nedströms av 3na ' HA (primers P3 och P4 i figur 3a). Primers P1 och P4 kommer också att fungera för förstärkning av den icke-riktade allelen i blandade målpopulationen. För en schematisk, se figur 3a.
    1. Förbereda gDNA från 2 mL cellsuspension av blandad riktade cell befolkningen från steg 2.2.4. Använd en gDNA utvinning kit enligt tillverkarens protokollet. Sedan förbereda gDNA icke öronmärkt celler som en kontroll.
    2. Utföra int. junction primärvården (primers P1/P2 och P3/P4 för 5' och 3' int. junction, respektive) och icke öronmärkt allel PCR (primers P1/P4) använder en HiFi-DNA-polymeras (se tabellerna 3 och 4 för PCR-ingredienser och cykling villkor) . Analysera 5 µL av PCR-produkter på en 1,5% agaros/TAE gel.
      Obs: Om blandade målpopulationen innehåller celler som har genomgått genomet engineering, en specifik PCR-produkt bör observeras som inte är spåras i gDNA icke öronmärkt celler (negativ kontroll). För den icke-riktade allelen PCR, bör man observera en produkt av samma storlek för både riktade och icke öronmärkt cellerna (positiv kontroll för genomisk P1 och P4 primers). Om inga band observeras, överväga att ändra PCR cykling villkor genom att öka antalet cykler eller förändra PCR bufferten (exempelvis genom tillägg av DMSO eller ökade mängder Mg2 +), eller genom att ändra polymerasen.

3. generation av klonala linjer och Screening för rätt inriktning

Obs: Efter bekräftelse av inriktning händelserna i blandad riktade cell befolkningen av flödescytometri och PCR (avsnitt 2.2 – 2.4), generera encelliga kloner (varaktighet: 28 till 35 dagar) och skärmen för korrekt integrering av sekvensen reporter.

  1. Generation av encelliga kloner genom utspädning plätering
    1. Förbereda Jurkat-villkorade medium i förväg: ta bort RPMI w / AB medium från friska, obehandlad Jurkat T-celler odlas till 1 x 106 celler/mL, Centrifugera under 5 minuter vid 300 x g, och filtrera supernatanten med en 0,22 µm spruta filterenhet.
      Obs: Hålla luftkonditionerade medium vid 4 ° C för kortsiktig lagring eller vid-20 ° C för förvaring längre än 1 vecka. Förbereda 20 till 30 mL luftkonditionerade medium före utspädning plätering.
    2. Räkna de riktade cellerna från steg 2.2.4 efter 10 – 14 dagar av expansion och späd dem i RPMI w / AB till en koncentration av 1 x 105 celler/mL. Ta 100 µL av 1 x 105 celler/mL lösning och späd med 9,9 mL medium att uppnå en koncentration av 1 000 celler/mL. Ta 1 mL 1 000 celler/mL lösning och späd med 9 mL av medium för att uppnå en koncentration på 100 celler/mL.
    3. Plate 96 brunnar plattor som innehåller 1 cell per brunn och 2 celler per brunn. För 1 cell per brunn, ta 1 mL 100 celler/mL lösning och blanda försiktigt med 5 mL av konditionerat medium och 4 mL färsk medium i en steril reagens reservoir.
    4. För 2 celler per brunn, ta 2 mL 100 celler/mL lösning och blanda försiktigt med 5 mL av konditionerat medium och 3 mL färsk medium. Plate 96 brunnar runda-bottenplåtar med respektive cell utspädning per väl använda en flerkanalig Pipettera 100 µL.
      Obs: 5 – 10 96 brunnar plattor per inriktning konstruktion är tillräckligt för att få kloner för screening.
    5. Stapla de 96 brunnar, täcka varje stack med en 6-well platta innehållande 3 mL PBS i varje brunn och inkubera plattorna vid 37 ° C i en befuktade cell kultur inkubator med 5% CO2 i 3 veckor.
      Obs: Ändrar inte cellodlingsmedium under denna tid. Öppna inte inkubatorn mer än en eller två gånger i veckan. Bästa resultat observeras i inkubatorer med öppet vattenreservoar.
    6. Efter 3 veckors ruvning, visuellt bekräfta förekomsten av odlade kolonier med ljusmikroskop (4 X förstoring) och markera brunnarna med odlade kolonier så att de visas som punkter på botten av brunnarna.
    7. Förbereda en 96-väl runda-bottenplatta med RPMI w / AB 100 µL per brunn. Försiktigt Omsuspendera cellerna i en märkt väl av pipettering. Överför 100 µL cellsuspension i en brunn på den nya plattan med 96 brunnar som redan innehåller 100 µL av RPMI w / AB, och blanda sedan försiktigt genom pipettering. Över 100 µL av denna cellsuspension i en andra tomma 96 brunnar runda-bottenplattan till duplicera plattan.
    8. Fortsätt med alla markerade brunnar med odlade kolonier. Fyll alla tomma brunnarna med 200 µL RPMI w / AB medium. Inkubera plattorna vid 37° C och 5% CO2.
      Obs: En av dessa plattor kommer att fungera för expansion av encelliga kloner (”lager platta”) och den andra som en ”dubbla platta” för screening.
  2. Screening av encelliga kloner av flödescytometri och PCR
    Obs: Medan de encelliga klonerna ökar, Använd dubbla plattan från steg 3.1.8 skärmen encelliga kloner för förekomsten av reporter sekvens av PCR (steg 3.2.4–3.2.12) och uttryck av fluorescerande reporter av flödescytometri (steg 3.2.2–3.2.3) (Figur 3 c).
    1. Låt den dubbla plattan Inkubera under 24 till 48 h och duplicera plattan igen. För att göra detta, tillsätt 100 µL RPMI w / AB i varje brunn, blanda försiktigt genom pipettering och överföra 100 µL till en ny 96 brunnar runda-bottenplatta använder en flerkanalig Pipettera. Använd en platta för flöde flödescytometri screening och den andra för PCR-baserad screening.
    2. För flöde flödescytometri screening, stimulera cellerna med PMA-Iono. Förbereda en mastermix av 0.1 µL av Ionomocin (1 mM lager), 0.1 µL av PMA (50 µg/µL lager), och 4,8 µL av RPMI w / AB per antal brunnar, sedan Tillsätt 5 µL av mastermix per brunn.
      Obs: Induktion är nödvändigt för att framgångsrikt identifiera kloner, där LTR skulle vara transcriptionally tyst och därför fluorescerande reportern inte uttrycks.
    3. Låt celler Inkubera under 24 h och förbereda celler för flödescytometri som beskrivs i steg 2.3.3. Utfärda utegångsförbud för livskraftiga singel-celler baserat på storlek på framåt och sidled scatter och analysera fluorescerande reporter genuttryck av flödescytometri (till exempel resultat, se figur 3 c). Om tv ryggraden innehåller andra fluorescerande reporter med arrangören (t.ex., god Jordbrukarsed), skärm några kloner för ryggraden reporter uttryck också (se steg 1.2.2 och följande anmärkning för förklaring).
      Obs: Ryggraden reporter uttrycket anger oönskade integration av ryggraden sekvenser.
    4. När klonerna i andra dubbla plattan har vuxit tillräckligt (vanligtvis 24-48 h efter dubblering av plattan med 96 brunnar), förbereda cell lysates innehållande gDNA för PCR-screening. Centrifugera plattan under 10 minuter vid 300 x g på RT. noggrant ta bort supernatanten utan att störa cellpelleten.
      Obs: Alla steg för att förbereda lysates och PCR-reaktioner kan utföras med multikanal.
    5. Tvätta cellerna med 100 µL av PBS av mild pipettering och centrifugering plattan för 5 min vid 300 x g vid RT. Ta av PBS och tillsätt 200 µL lyseringsbuffert [200 mM NaCl, 100 mM Tris-HCl pH 8-8,5, 5 mM EDTA, 0,1% SDS, Lägg sedan till 250 – 1 000 µg/mL proteinas K (frystorkade pulver, väger in nymalen)] per brunn. Blanda försiktigt genom pipettering och överför till en ny PCR-plattan.
    6. Försegla plattan med paraffin filma och inkubera i 1 h vid 55 ° C i en termocykler. Centrifugera vid maximal hastighet i 10 min (3000 x g) att snurra ner cellfragment och överför supernatanten till en ny PCR-plattan.
      Obs: Cell lysates i plattorna kan lagras i detta skede vid 4 ° C tills vidare användning.
    7. Förbereda en PCR-plattan med 96 brunnar med 110 µL av dH2O och tillsätt 10 µL av cell lysate (1:12 utspädning). Cell lysates kan vara trögflytande och svårt att Pipettera. Använda minst 20-µL Pipettera tips.
    8. Inaktivera proteinas K genom inkubation för 10 min vid 99 ° C i en termocykler. Därefter använda den inaktiverade och utspädda cell lysates för PCR-screening.
    9. Design primers för screening PCR (P5 och P6) baserat på den valda reporter sekvensen för att förstärka 500 – 800 bp av reporter sekvensen. För positiv kontroll PCR, använda primers P7 och P8 som förstärker 630 bp av en vildtyp, icke öronmärkt genomisk locus (NUP188 gen) (figur 3 c och tabell 5). Designa ett tredje primer-par som förstärker 500 – 600 bp av tv ryggraden som en kontroll för ospecifikt integration av tv ryggraden sekvenser (ryggrad PCR).
    10. För screening, kontroll och ryggraden PCR, använda en kommersiell PCR mastermix (se tabellerna 6 och 7 för PCR-ingredienser och cykling villkor). Använd 2 µL utspädda och inaktiverade lysate bereddes i steg 3.2.8 som mall och kör PCR för 38-40 cykler av PCR-amplifiering i 96 brunnar format.
    11. Analysera 5 µL av PCR-produkter på en 1,5% agaros/TAE gel.
      Obs: För kontroll PCR, ett specifikt band av 630 bp bör observeras för varje prov, bekräftar att kvaliteten på cell lysates är lämpliga för PCR. Ett specifikt band i screening PCR (500 – 800 bp beroende på primer design) indikerar integration av sekvensen reporter. Ett specifikt band för ryggraden PCR (500 – 600 bp, beroende på primer design) indikerar oönskade integration av tv ryggraden sekvenser (till exempel resultat, se figur 3 c).
    12. Kombinera resultaten för flödescytometri (steg 3.2.3) och PCR-baserad screening (steg 3.2.12). Välj kloner som visar rätt storlekar av PCR-produkter i screening PCR och positiv kontroll PCR och uttryck av fluorescerande reporter efter induktion med PMA-Iono i flödescytometri. Utesluta kloner som visar ett PCR-produkten i ryggraden PCR eller ett uttryck av tv ryggraden-kodade fluorescerande protein, som anger ospecifikt integration av tv ryggraden sekvens.
    13. Gradvis expandera valda kloner från 96 brunnar lager plattan till större väl format (48/24/12/6-brunn) fram till att uppnå en T75 cellformatet kultur kolven genom att lägga till färska medium varje 2 till 3 dagar. Upprätthålla en cell densiteten mellan 1 x 105 och 1 x 106 celler/mL.
    14. Se till att förbereda cell lager av kloner under expansion: räkna cellerna, Centrifugera 300 x g för 5 min på RT, avlägsna supernatanten och avbryta cellerna försiktigt i FCS + 10% DMSO på 5 x 106 celler/mL. Delprov i kryogena injektionsflaskor och användning en cryo-frysning behållare att frysa cellerna till 80 ° C 1 ° C/min. För långtidsförvaring, överföra dem till vätska N2.
      Obs: Är det lämpligt att behålla en T75 cell kultur kolv (dvs., runt 1 x 107 celler) under expansionen i beredning av gDNA för verifiering av inriktning av södra blotting (se avsnitt 3.4).
  3. Verifiering av integration platser av PCR/sekvensering i utvalda kloner
    Obs: 5' och 3' int. korsningar av de utvalda klonerna är PCR förstärks och skickat till Sanger sekvensering att verifiera korrekt inriktning på nivån för DNA-sekvens.
    1. Förbereda gDNA av utvalda kloner och Jurkat vildtyps-celler med en kommersiell gDNA utvinning kit.
    2. Använd primer par bindande 5' slutet av reportern och uppströms 5' HA för 5' int. korsningen (primers P1 och P2) och 3' slutet av reportern och nedströms 3' HA för 3' int. korsningen (primers P3 och P4) som beskrivs i steg 2,4. Använda primers P1 och P4 för att förstärka webbplatsen riktade integration på allelen utan reporter integrant (figur 4a).
    3. Förbered PCR reaktioner med 100 – 200 ng av gDNA som mall och utför PCR med ett polymeras med korrekturläsning aktivitet (se tabellerna 1 och 2 för PCR-ingredienser och cykling villkor).
      Obs: Om inga band observeras, överväga att ändra PCR cykling villkoren genom att öka antalet cykler eller förändra PCR bufferten (till exempel genom att lägga till DMSO eller ökade mängder Mg2 +), eller genom att ändra polymerasen.
    4. Analysera 5 µL av PCR-produkter på en 1,5% agaros/TAE gel. Om rätt band storlekar observeras, rena återstående PCR-produkten med hjälp av ett kommersiellt kit och underkasta den Sanger sekvensering. Verifiera sekvenser av int. junction 5', 3' int. junction och riktad webbplats av allel utan reporter integrant genom att justera dem med förväntade sekvenser.
      Obs: Den homologa allelen där reportern inte har integrerat kommer sannolikt att Visa Cas9-medierad förändringar på målwebbplatsen, till exempel nukleotid infogningar och borttagningar (figur 4a).
    5. För kloner som visar rätt int. junction sekvenser efter justering, utföra en PCR förstärka hela riktade reportern och underkasta den Sanger sekvensering att kontrollera rätt sekvens i den integrant.
  4. Southern blot analys för verifiering av inriktning i utvalda kloner
    Obs: Southern blot analys av utvalda kloner som krävs för att kontrollera rätt inriktning och utesluta Cas9-medierad rekombination händelser som kan ha uppstått på webbplatsen riktade integration.
    1. Utveckla en strategi för lämpliga gDNA matsmältningen och sond design före start experimentet.
      1. Välj ett restriktionsenzym gDNA inskränkning som genererar lämpliga fragment av 2 till 10 kb längd på riktade webbplats. Vissa restriktionsenzym, exempelvis Asp718, BamHI, BglI, BglII, EcoRV, HindIII, NcoI, PstI, PvuII, ScaI, Stu, och SST Jag har framgångsrikt använts för att smälta hög molekylvikt gDNA.
      2. Utforma två olika södra sonder: en reporter-specifika sonden och genomisk sond. Reporter-specifika sonden hybridizes en sekvens inom reportern (dvs., tdTomato-specifika probe). Genomisk sonden hybridizes till en genomisk region nära (men inte överlappande) en HA.
      3. Välj genomisk sonden så att fragmentet genereras av gDNA matsmältningen som kommer att upptäckas av genomisk sonden bindande skiljer sig i längd (mer än 2 kb) från de riktade och icke öronmärkt allelerna (figur 4b). En sondlängd 400 till 1000 bp rekommenderas.
      4. Design PCR primers att förstärka de två krävda sonderna. Förstärka reporter-specifika sonden från tv mall använder en HiFi-DNA-polymeras (se tabellerna 3 och 4 för PCR-ingredienser och cykling villkor).
      5. Förstärka genomisk sonden från vildtyp Jurkat gDNA beredd med en kommersiell gDNA extraction kit med en DNA-polymerase med korrekturläsning aktivitet (se tabellerna 1 och 2 för PCR-ingredienser och cykling villkor). Rena PCR-produkter på en agaros/TAE-gel och extrahera fragment med en kommersiell gel utvinning kit enligt tillverkarens anvisningar.
    2. Extrahera hög molekylvikt gDNA från 1 x 107 celler av vildtyp Jurkat celler och utvalda kloner från steg 3.2.14.
      1. Pellet cellerna genom centrifugering vid 300 x g i 5 min på RT, tvätta den en gång med PBS och centrifugerade 4 ml lyseringsbuffert [200 mM NaCL, 100 mM Tris-HCl pH 8, 5 mM EDTA, 0,1% SDS, Lägg sedan till 250 – 1 000 µg/mL proteinas K (frystorkat pulver väga in nymalen)]. Inkubera o/n vid 55 ° C, skaka på 350 rpm i en bordsskiva thermomixer.
      2. Tillsätt 4 mL isopropanol och blanda genom inversion 10 till 20 gånger. GDNA bör bli synlig som vit fällning. Buffra den utfällda gDNA på den fina spetsen av glas pipett, tvätta av framväxande i 750 µL 70% EtOH, och låt torka på RT (5-10 min).
      3. Skjul fällningen i en 1,5 mL reaktionsröret innehållande 500 µL av 1 x TE buffert (10 mM Tris-HCl pH 8,0, 1 mM EDTA) och lämna för att upplösa o/n vid 4 ° C, skaka på 350 rpm. Varje pipettering av gDNA från detta skede bör göras med wide-bore-tips för att undvika klippning.
        Obs: Utarbetandet av hög molekylvikt gDNA är väsentliga för Southern blot analys och kommersiellt tillgängliga gDNA förberedelser kit är inte lämpliga.
    3. Digest (två gånger) 15 µg gDNA av utvalda kloner och vildtyps-Jurkat celler med valda restriktionsenzym (se steg 3.4.1.1) i en 60 µL reaktion med 6 µL av enzym (20 enheter/µL): först, lägga till DNA, matsmältningen buffert och ddH2O, inkubera o/n vid 37 ° C , sedan Lägg enzym och inkubera o/n vid enzym-specifika matsmältningen temperatur. 15 ug av smält gDNA krävs per södra sonden.
    4. Använd 7 µL av 60 µL begränsning digest för analytisk gelelektrofores på en 1% agaros/TAE gel. Ett utstryk anger komplett matsmältning och bra DNA kvalitet för Southern blot analys.
    5. Fällningen återstående begränsning digest genom att lägga till 1:10 3 M natriumacetat och 2 volymer 100% EtOH, sedan Inkubera i 1 h vid-80 ° C och Centrifugera i 30 min på 15,600 x g vid 4 ° C.
    6. Avlägsna supernatanten och tvätta pelleten med 70% EtOH. Centrifugera i 15 min på 15,600 x g vid 4 ° C, Kassera supernatanten, Låt pelleten torka kort på RT och lös i 20 µL av ddH2O.
    7. Kör 1% agaros/TAE blotting gel, lastning 20 uL av smält gDNA per körfält. Kör gelen för 2 h vid 60 V, 400 mA.
      Obs: Procentandelen av agaros gel och rinnande tid/spänning kan justeras enligt beräknade fragment storlek för Southern blot upptäcka beräknades i steg 3.4.1.1. De följande stegen i Southern blot analys beskrivs i detalj i ett tilläggsprotokoll (steg 1 – 18). Dessa steg omfattar: tvätt av blotting gel, blotting på en nylon membran, radioaktiva sonden generation, sond hybridisering och utvecklingen av autoradiograph film. Jämför erhållna banding mönstret efter autoradiograph utveckling i steg 18 (tilläggsprotokollet) med det förväntade mönstret enligt södra strategi (till exempel resultat, se figur 4b).
  5. Analys av off-target händelser
    Obs: Eftersom CRISPR-Cas9-medierad genomet engineering kan generera off-target effekter, PCR-Förstärk tio högst rankade i silico-förutspådde off-target platser i utvalda kloner och utsätta dem för Sanger sekvensering.
    1. Använda CCTop16 (http://crispr.cos.uni-heidelberg.de) för att generera en lista med de tio högst rankade i silico förutspådde off-target sekvenser.
      1. Ange gärna sekvensen inklusive PAM som används för inriktning som fråga sekvens. Välj ”NGG” som PAM och ”mänskliga genomet” som referens för off-target förutsägelse.
      2. Ange maximal total missmatchningar ”4” och target site längd till längden på gärna utan PAM. Utdatafilen kommer att ge en rangordnad lista av genomisk off-target platser för respektive gärna.
    2. I silico extrahera genomiska sekvensen 500 bp uppströms och nedströms av varje av de tio högsta rankade off-target träffar med UCSC genomet webbläsare (http://genome.edu.ucsc.edu) och placera av den off-target hit från CCTop resultatlistan.
    3. För varje off target webbplatser analyseras, design en PCR-primer par som förstärker ett fragment av 600-700 bp i längd inklusive den förutsedda off-target webbplatsen.
    4. Extrahera gDNA från utvalda kloner och Jurkat vildtyps-celler med en kommersiell gDNA utvinning kit. För varje off-target webbplats, utföra en PCR med en DNA-polymerase med korrekturläsning aktivitet (se tabellerna 1 och 2 för PCR-ingredienser och cykling villkor) på vildtyp och de respektive klon-derived gDNA.
    5. Analysera 5 µL av PCR-produkter på en 1,5% agaros/TAE gel. Om rätt band storlekar observeras, rena återstående PCR-produkten med hjälp av en kommersiell PCR rening kit och underkasta den Sanger sekvensering. Jämföra sekvenser av off-target platserna i Jurkat celler och riktade klonerna.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I detta representativa experiment har vi valt att inrikta sig på en minimal HIV-1-härledda reporter som består av en LTR, tdTomato-kodande sekvens och polyA-Signalera ordnar till två loci i intron 5 av BACH2 gen17. Loci för inriktning valdes enligt närhet till publicerade återkommande integration webbplatser finns i olika studier på primära T-celler från HIV-infekterade patienter2,4,5,6, 7,8 och förekomsten av PAM motiv NGG nödvändiga för Cas9-medierad induktion av dubbel-strand raster. Målet vektorer var konstruerade och transfekterade enligt protokollet beskrivs. Arbetsflödet för transfection, kontroll av inriktning händelser, generation av encelliga kloner, och screening och urval av kloner är schematiskt visas i figur 1.

Två veckor efter FACS-anrikning av transfekterade celler, kunde vi upptäcka reporter genuttryck efter PMA-Iono induktion av flödescytometri i 4 till 12% av celler, beroende på integration webbplats (inga data anges) och PCR-produkter på genomisk DNA som spänner över hela 5' och integration junction 3' från uppströms 5' HA till reporter sekvens och nedströms av 3' HA in reporter sekvens, respektive (figur 3a och 3b). Efter att ha bekräftat att inriktning händelser inträffade, gick vi på att generera encelliga kloner genom att begränsa utspädning plätering. I våra händer var plätering 5 till 10 96 brunnar plattor per inriktning konstruktion tillräcklig för att erhålla tillräckligt kloner för en framgångsrik skärm. I protokollet (avsnitt 3.2) beskrivs det hur du utför en genomgång av encelliga kloner i duplicerade 96-brunnar. I detta avseende måste endast positiva kloner utvidgas, vilket sparar både tid och ansträngning. I figur 3 cvisas exempeldata av FACS-screening efter PMA-Iono induktion och PCR-screening. Vi observerat ett antal kloner med hög, låg och ingen fluorescerande reporter genuttryck (figur 3 c). För PCR-screening är det viktigt att inkludera en kontroll PCR som förstärker en genomisk locus val att avgöra om kvaliteten på cell lysates är lämpliga för PCR. I vårt fall har vi valt en 630 bp sekvens i den NUP188 genen locus för kontroll PCR (för primer sekvenser, se tabell 5). Primers för screening PCR sedan avsedda att förstärka en kortare sekvens ligger i reportern. Dessutom utfördes PCR för en sekvens på target vektor ryggrad för att utesluta eventuella kloner som hade ospecifikt integrerade mål vektor ryggraden sekvenser (ryggrad PCR, data som inte visas).

Förväg utvalda kloner sedan utökades och ytterligare analyseras för korrekt inriktning av Southern blot och PCR och sekvensering. Southern blot utfördes med hjälp av en reporter-specifika sond och en sond som är specifika för genomisk locus bindning utanför reportern men inte inom homologi armarna av vektorn som inriktning. Intressant, alla kloner som testades av Southern blot var positiva i screening PCR i förväg, men endast en del visade rätt band storlekar i Southern blot analys och heterozygously hade integrerat reportern (figur 4b). Det är därför nödvändigt att inte bara förlita sig på screening PCR-resultat men också verifierar korrekt inriktning av södra blotting. Kontrollera rätt inriktning på DNA-sekvensen nivå genom integration korsningar var förökas med PCR och produkter utsattes för Sanger sekvensering (figur 4a). Särskilt, avslöjade sekvensering av target webbplats homologa allelen, där reportern inte hade integrerat, Cas9-medierad förändringar. I figur 4a, exempel för en Cas9-medierad borttagning visas. För att testa för Cas9-medierad off-target effekter, genererades en lista av de högsta rankade off-target webbplatserna som beskrivs i avsnitt 3.5. Tio högst rankade off-target platser var PCR-förstärkta genomisk DNA från klonerna, och produkterna utsätts för Sanger sekvensering. I riktade encelliga klonerna vi genererat, observerades inga variationer från Jurkat vildtyps-sekvenser på de tio högsta rankade off-target webbplatserna.

Figure 3
Figur 3: Screening av encelliga kloner för inriktning händelser. (en) Schematisk bild av primer design för detektion av inriktning händelser med PCR i blandad riktade cell befolkningen. Primer par för detektion av 5' integration junction (P1, P2) och 3' integration junction (P3, P4) indikeras som pilar. Primer P1 och P4 också tjäna till att förstärka riktade locus av allel utan reporter integrant (b) genomisk DNA av blandad riktade cell befolkningen var beredd 10 dagar efter FACS anrikning av transfekterade celler och analyseras för 5' integration junction (P1, P2 ), 3' integration junction (P3, P4, data som inte visas) och vildtyps-allelen av den riktade locus (P1, P4). Vildtyp Jurkat celler (wt) fungerade som kontroll. (c) första skärmen av encelliga kloner i 96 brunnar. 96 brunnar med encelliga kloner screenades för korrekt inriktning av flödescytometri efter PMA-Iono induktion och PCR-analys. Resultaten till exempel kloner visas. PCR utfördes på cell lysates med reporter-specifika primers (screening PCR. P5, P6) och primers förstärka en genomisk locus (styra PCR, här: NUP188 locus; P7, P8). Cell lysates av vildtyp Jurkat celler (wt) och genomiskt DNA från HIVisB2 klon (B2)18 beredd med kommersiellt tillgängliga kit tjänstgjorde som en negativ kontroll för screening PCR och positiv kontroll för kontroll PCR, respektive. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: analys av valda encelliga kloner för rätt reporter integration. (en) sekvensanalys av integration korsningar och riktade locus på allelen utan reporter integrant. Primer par för detektion av 5' integration junction (P1, P2), 3' integration junction (P3, P4) och riktade locus av allel utan reporter integrant (P1, P4) användes. PCR-produkter var förstärks genomisk DNA från encelliga kloner och underkastas Sanger sekvensering. Sekvensering resultat anpassades till förväntade sekvenser. Visas exempeldata av en klon. Sekvens kromatogram från genomet/HA junction och HA/reporter junction visas för både 5' och 3' integration junction. Matcherna är indicerat som prickar. Bindningsstället för gärna markeras med en låda. Cas9-inducerade mutationer är markerade i rött. Schematisk bild av primer design visas nedan. Pilarna anger primer positioner används för förstärkning. (b) Southern blot analys av valda riktade encelliga kloner och Jurkat vildtyp celler. Southern blot analys utfördes på genomisk DNA med en reporter-specifika sond och en sond som erkänner en genomiska sekvensen i både riktade och vildtyps-allelen (genomisk probe). Visas data av 7 exempel kloner. Kloner med rätt band-storlek är markerade med lådor. Utspädda mål vektor plasmid tjänstgjorde som positiv kontroll (+). Nedan visas schematiskt för Southern blot analys. Klicka här för att se en större version av denna siffra.

Reagens Lägg till per reaktion
Vidarebefordra Primer (20 µM) 1 ΜL
Reverse Primer (20 µM) 1 ΜL
10 x Taq buffert 5 ΜL
1 µL dNTP (2,5 mM varje) 1 ΜL
MgCl (50 mM) 1 ΜL
DMSO 1,5 ΜL
gDNA (50-100 ng/µL) 2 ΜL
Nuclease-gratis vatten Fyll upp till 49,5 µL
Taq-DNA-polymeras (5 U/mL) 0,5 ΜL
reaktionsvolym 50 ΜL

Tabell 1: recept för PCR med ett polymeras med korrekturläsning aktivitet. Beloppet av varje reagens tillsättas per PCR-reaktion indikeras. PCR är avsedd för förstärkning med genomiskt DNA som mall. Receptet används i steg 1.2.2.2 (förstärkning av homologi vapen), steg 3.3.3 (verifiering av integration platser), steg 3.4.1.5 (generation av genomisk sond för Southern blot) och steg 3.5.4 (analys av off-target händelser).

Steg Temperatur Tid Cykler
Inledande denaturering 95 ° C 2 min 1
Denaturering 95 ° C 40 s 30 -35
Glödgning 58 ° C 45 s
Förlängning 72 ° C 1 min/kb
Slutliga förlängning 72 ° C 10 min 1

Tabell 2: Cykling villkor för PCR med ett polymeras med korrekturläsning aktivitet. Cykling villkor motsvarar PCR recept listade i tabell 1.

Reagens Lägg till per reaktion
Vidarebefordra Primer (20 µM) 1 ΜL
Reverse Primer (20 µM) 1 ΜL
5 x HiFi-buffert 5 ΜL
1 µL dNTP (2,5 mM varje) 1 ΜL
gDNA (50 – 100 ng/µL) eller plasmid DNA (50 ng/µL) 2 µL gDNA eller
1 µL plasmid DNA
Nuclease-gratis vatten Fyll upp till 49,5 µL
HiFi-DNA polymeras 0,5 ΜL
reaktionsvolym 50 ΜL

Tabell 3: recept för PCR med en HiFi-polymeras. Beloppet av varje reagens tillsättas per PCR-reaktion indikeras. PCR är avsedd för robust amplifiering av DNA mallar. Receptet används i steg 2.4.2 (identifiering av inriktning händelser) och 3.4.1.4 (generation av reporter-specifika sond för Southern blot).

Steg Temperatur Tid Cykler
Inledande denaturering 98 ° C 30 s 1
Denaturering 98 ° C 10 s 30 - 35
Glödgning 58 ° C 30 s
Förlängning 72 ° C 30 s/kb
Slutliga förlängning 72 ° C 10 min 1

Tabell 4: Cykling villkor för PCR med en HiFi-polymeras. Cykling villkor motsvarar PCR recept som anges i tabell 3.

Primer Sekvens (5'-3')
P7 kontroll PCR F CTTTGTTGGGTAAGCATGGAGGTC
P8 kontroll PCR R CAGTTACTCACCTTTGCACATAGG

Tabell 5: oligonukleotiden sekvenser för kontroll PCR. Framåt och bakåt primers för förstärkning av ett 630 bp fragment av NUP188 locus indikeras.

Reagens Lägg till per reaktion
Ready-to-use PCR Master Mix 8 ΜL
Vidarebefordra Primer (20 µM) 1 ΜL
Reverse Primer (20 µM) 1 ΜL
Nuclease-gratis vatten 8 µl
cell lysate (1:12 utspädning) 2 ΜL
totala reaktionsvolym 20 ΜL

Tabell 6: recept för screening-PCR. Beloppet av varje reagens tillsättas per PCR-reaktion indikeras. PCR-recept är avsett för screening PCR i steg 3.2.11.

Steg Temperatur Tid Cykler
Pre-PCR Denaturering 94 ° C 2 min 1
Glödgning 58 ° C 1 min
Förlängning 72 ° C 1 min
Denaturering 94 ° C 30 s 38
Glödgning 58 ° C 30 s
Förlängning 72 ° C 1 min
Slutliga förlängning 72 ° C 10 min 1

Tabell 7: Cykling villkor för screening-PCR. Cykling villkor motsvarar PCR recept som anges i tabell 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Här beskriver vi ett protokoll för att generera HIV-1-härledda Jurkat reporter modeller med valda proviral integration platser tillämpa CRISPR-Cas9-baserade genomet engineering.

Flera punkter i protokollet kräver noggrann uppmärksamhet under planeringsskedet. Först, locus riktas bör väljas med omsorg, eftersom vissa loci kan vara lättare att målet än andra (t.ex., beroende på regionen och målet kromatin status sekvens själv). Repetitiva sekvenser är svåra att klona in inriktning vektorn och ofta inte är unika inom genomet. Regioner av repressiva kromatin är svårare att rikta med CRISPR-Cas9-system19,20.

Det andra är valet av gärna avgörande för CRISPR-Cas9-medierad inriktning. Syftet att generera modeller för HIV-infektion med representativa integration platser, skulle man vilja gärna att binda så nära som möjligt till en integration hotspot. Dock kanske denna webbplats inte idealisk för Cas9 rekrytering. en kompromiss måste därför göras mellan närheten av sekvensen gärna till webbplatsen integration av val och gärna kvalitet. Vi har hittat den E-skarp webtool tillförlitligt förutsäga funktionella gRNAs. Det är också möjligt att genomföra en gärna pre-test av övergående uttrycker flera gRNAs tillsammans med Cas9 i celltyp vara riktade, följt av en screening för mutationer. En lämplig gärna kommer direkt Cas9 effektivt till målwebbplatsen och gärna kompletterande webbplatsen visar mutationer. Längden på har (1000 bp uppströms och nedströms av webbplatsen integration) valdes enligt tidigare publicerade studier11. Generellt kommer att att minska längden på homologi armar resultera i minskad inriktning frekvens. En längd på 1000 bp homologi arm presenterar en bra kompromiss mellan tillräcklig inriktning frekvens och användarvänlighet mål vektorn konstruktion.

För det tredje måste tillräckligt med tid spenderas på en bra design för den reporter construct. Minimal reportern används i detta protokoll, som innehåller en HIV-1 NL4-3 härrör LTR och en tdTomato kodande sekvens, utformades utifrån följande princip: enskild l har beskrivits som enbart återstående proviral fragment i flera fall av klonala expansion i chronically HIV-1-infekterade individer21. Det förväntas att LTR är starkt influenser kromatin status på integration platser och organiserar rekrytering av cellulär komplex. Vi har valt en minimal HIV reporter med fokus på den HIV LTR som viktigaste reglerande genetiska element, då infördes tdTomato som fluorescerande LTR aktivitet markör i stället för ytterligare HIV-1 gener, som genomet engineering frekvens rapporterades vara högre med mindre inriktning infogar11. Med tanke på tidskrävande steg i tv kloning, klonurvalet, screening och verifikation av klonerna, det är klokt att noggrant överväga utformningen av HIV reportern i samband med funktionella studier som så småningom kommer att utföras på riktade cellinjer. En, till exempel överväga införandet av gag ledare sekvens, 3' HIV LTR eller andra virus gensekvenser i reportern. Protokollet kan lätt anpassas till sådana olika reporter konstruktioner.

Generellt, är det viktigt att tänka på valet av celltyp som riktas som encelliga klon generation kan vara svårt med vissa cellinjer. Vi hittade att Jurkat celler inte är mycket effektiv i enda klon släkte; men beslutade vi att välja denna celltyp för dess tidigare kända användning i latent HIV infektion modeller9. Vi fått bästa resultat i Jurkat klonal utspädning plätering med 50% luftkonditionerade medium, när tallrikar lämnades ostörd i en inkubator som öppnades inte mer än 3 gånger i veckan. Om du vill använda en annan cell linje, rekommenderas det att i förväg testa möjligheten att generera encelliga kloner genom att utföra en plattspridning från experiment. En annan punkt att komma ihåg är variationen av transfection priser av olika cellinjer. Om transfection inte är genomförbart för den valda cellen fodrar, electroporating cellerna för inriktning kan vara nödvändigt. Observera att valet av cellinje som används för att rikta inte kan bestämmas av tekniska aspekter, såsom effektivitet för transfection eller enda klon generation. Funktionella aspekter kan också övervägas, såsom transkriptionell aktivitet eller inducibility av den riktade gene locus. Detta kan kräva screening av olika cellinjer före inriktning arbetsflödet.

Det bör betonas att protokollet beskrivs är tidskrävande. Bör det förväntas att ta 3 till 6 månader från det första steget till slutliga klonal cellinjer. Den södra blot analys, som används för att kontrollera för platsspecifika enda integration händelser, kan tyckas omständligt, men vår erfarenhet är det mycket viktigt - som endast en delmängd av encelliga kloner som visade den förväntade integrationen korsningar per PCR visade en korrigera mönster i Southern blot. Idealiskt, praktiker ska generera ett antal kloner med samma vändskär riktade till samma plats för integration att kontroll för klonal effekter i någon efterföljande experiment som gör användning av klonerna. Det är möjligt att göra heterozygot samt homozygot inriktning. I heterozygot reporter cellinjer sannolikt allelen utan en integrant Visa ändringar på Cas9 inriktning webbplats, som kan kontrolleras med PCR (figur 4a). Homozygot inriktning föreslår vi att båda alleler riktas i följd.

Detta arbetsflöde med hänsyn till dessa överväganden, och tillhandahåller ett sätt att generera kraftfulla cellular-modeller som kan användas för att öka förståelsen för kronisk HIV-infektion. Proviral aktivitet som svar på latens-backning agenter kan till exempel testas i samband med återkommande integration platser. Detta kan vara av särskilt intresse för forskare i fältet, eftersom position effekter har varit postulerade för att påverka HIV latens och återföring22.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi tackar Britta Weseloh och Bettina Abel för tekniskt bistånd. Vi tackar också Arne Düsedau och Jana Hennesen (flöde flödescytometri teknikplattform, Heinrich Pette Institut) för teknisk support.

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics