CRISPR-Cas9 מבוססי הגנום הנדסה ליצירת מודלים Jurkat כתב להידבקות ב- HIV-1 עם אתרים שנבחרו אינטגרציה Proviral

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

אנו מציגים הגנום הנדסה זרימת עבודה עבור הדור של הדגמים החדשים במבחנה להידבקות ב- HIV-1 זה מסכם את הדברים proviral אינטגרציה באתרים גנומית שנבחרו. פילוח של עיתונאים HIV-derived בהנחייתם של מניפולציה הגנום CRISPR Cas9-בתיווך, הספציפיות-לאתר. פרוטוקולים מפורט דור שיבוט תא בודד, הקרנה של אימות המטרה הנכונה הינם מסופקים.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

וירוס הכשל החיסוני האנושי (HIV) משלב ה-DNA שלו proviral שאינה אקראית לתוך הגנום התא המארח-חוזרים ונשנים אתרים ונקודות גנומית. כאן אנו מציגים פרוטוקול מפורט עבור הדור של הרומן מודלים במבחנה הידבקות ב- HIV עם אתרי אינטגרציה הגנומי שבחרת באמצעות טכנולוגיית ההנדסה הגנום המבוססות על CRISPR-Cas9. בשיטה זו, כתב רצף של הבחירה שניתן לשלב לוקוס גנומית יישוב, שבחרת, המשקף הרלוונטית קלינית שילוב אתרים.

בפרוטוקול, מתוארים העיצוב של הכתב HIV-derived ובחירה של רצף באתר, gRNA היעד. וקטור מיקוד בזרועות הומולוגיה נבנה, transfected לתוך תאי Jurkat T. הרצף כתב לאוכלוסייה אתר גנומית שנבחר על ידי רקומבינציה הומולוגית בהנחייתם של הפסקה כפולה-strand בתיווך Cas9 באתר היעד. תא בודד שיבוטים שנוצר, הוקרן הכוונת האירועים על ידי cytometry זרימה ו- PCR. שיבוטים שנבחרו ואז מורחבות, פילוח נכון מאומתת על ידי ה-PCR, רצף סופג הדרומי. ניתוח אירועים פוטנציאליים את המטרה של הגנום CRISPR Cas9-בתיווך הנדסה.

באמצעות פרוטוקול, מערכות התרבות התא הרומן הזה ניתן להפיק את הידבקות ב- HIV דגם באתרים אינטגרציה הרלוונטית קלינית. למרות הדור של תא בודד שיבוטים ואימות של שילוב רצף כתב הנכונה היא גוזלת זמן, הקווים המשובטים וכתוצאה מכך הם כלים רבי-עוצמה לנתח באופן פונקציונלי אינטגרציה proviral אתר הבחירה.

Introduction

שילוב של proviral ה-DNA הגנום המארח בעת זיהום הוא שלב קריטי במחזור החיים של וירוס הכשל החיסוני האנושי (HIV). בעקבות שילוב, HIV נמשכת על-ידי יצירת השהיה של קבוצות משנה תאי CD4 + T חיים ארוכים כגון זיכרון CD4 + T תאים. HIV שילוב שנראה שאינן אקראיות1,2. מספר נקודות חמות גנומית עם ה-DNA proviral משולב שהדו-שיח זוהתה במספר מחקרים באמצעות הרצף של שילוב אתרים אנשים נגועים בחריפות, באופן כרוני2,3,4 ,5,-6,-7,-8. מעניין, על שילוב אתרים מסויימים, מיקומה באותו זוהה שבר גדול של תאים נגועים, שמוביל הרעיון כי אינטגרציה באתרים חוזרים ונשנים עלול להשפיע באופן חיובי משובט הרחבה1.

כדי לקדם את ההבנה שלנו של המשמעות של שילוב חוזר ונשנה אתרים, שילוב proviral אתר הבחירה חייב להיחקר. עם זאת, מספר היבטים טכניים ה"בלתי אינטגרציה HIV לימוד באתר הבחירה ואת ההשלכות. בשימוש רחב תא תרבות מודלים של השהיה HIV, כמו שורות תאים JLat אינן משקפות את שילוב חוזר ונשנה הרלוונטית קלינית אתרי9. מחקרים על תאים נגזר החולה הראשי, מצד אחד, מאפשרים תיאור של שילוב האתר נוף על ידי רצף אך אינם מאפשרים ניתוחים פונקציונליים. ידיעתנו אין דגם ניסיוני נאותה זמין לנתח אתרים נבחרים הרלוונטית קלינית אינטגרציה פונקציונלית.

כאן אנו מציגים נתונים היסטוריים זרימת עבודה כדי ליצור מודלים חדשניים הידבקות ב- HIV באמצעות טכנולוגיית ההנדסה הגנום המבוססות על CRISPR-Cas9. זרימת העבודה המתוארת במסמך זה יכול לשמש כדי ליצור קווים תא תא T-derived כתב דגם הידבקות ב- HIV, נושא כתב proviral genomically משולב באתר שבחרת שילוב. הם משרתים וכך גם כלים חדשים לחקור איך האתר אינטגרציה proviral יכולים להשפיע ביולוגיה HIV ואת איך provirus מגיבה אסטרטגיות טיפול שונה (למשל, inducibility על ידי סוכנים היפוך השהיה). השיטה שלנו משתמשת את היתרונות של הגנום CRISPR-Cas9 מבוססי הנדסה, בשילוב אשר כתב רצף מאת רקומבינציה הומולוגית בהנחייתם של Cas9 הנוצרות על-ידי נוקלאז כפול-strand הפסקה באתר היעד. אתרי היעד עבור שילוב נבחרו על פי קרבה לאתרים שילוב חוזר ונשנה שתואר ממחקרים על אנשים נגועים ב- HIV ואת נוכחותם של מוטיבים מתאימים פאם הגנום בתיווך Cas9 הנדסה.

התוצאות המופת שלנו, אנחנו התמקדו מיקומה ג'ין BACH2, אשר הקודים המתקן תעתיק BTB ו CNC הומולוגיה 2. אצל אנשים באופן כרוני נגוע ב- HIV על טיפול תרופתי, BACH2 הוא אחד לוקוסים מציג העשרה משולב HIV-1 רצפים של3,6,7,8,10. בחרנו עיתונאי HIV-derived מינימלי של HIV-1-derived זמן מסוף חוזר (משמאל לימין), רצף קידוד tdTomato, הורמון גדילה (BGH) הסימן פוליאדנילציה (PA), אשר בוחר לשני אתרים ספציפיים באינטרון BACH2 5. פרוטוקול הציג ממוטב Jurkat תאים, אנושי CD4 + תא T-derived ההשעיה תא קו, אבל תא שני קווים עשוי לשמש, פרוטוקול הותאם בהתאם. אנו מציגים זרימת עבודה מפורט באתר היעד, בניית היעד וקטור בזרועות הומולוגיה, CRISPR Cas9-בתיווך פילוח של הכתב לתוך האתר גנומית שבחרת, הדור ואת הבחירה של קווי המשובטים, ומקיף מבחר אימות של שורות תאים הכתב החדש שנוצר, ממוקד.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. אסטרטגיה מכוונת הגנום הנדסה והיעדים עיצוב וקטור (טלוויזיה)

הערה: הצעד הראשון של הגנום הנדסה כרוך בחירה ויצירת הכלים הדרושים עבור CRISPR Cas9-בתיווך מיקוד. מבחר של לוקוס באתר אינטגרציה הגנומי, בחירה של סוג התא הכוונת, ועיצוב כתב HIV-derived לשילוב צריך להקדים שלב זה. פרוטוקול זה מתאר פילוח של הכתב מינימלי HIV-LTR_tdTomato_BGH-הרשות הפלסטינית לתוך תאי היעד Jurkat. תרשים זרימה של זרימת העבודה עבור המבוססות על CRISPR-Cas9 מיקוד, דור, סינון ואימות של קווים המשובטים מתואר באיור1. אסטרטגיית מיקוד שתואר משתמשת את Cas9 הפישחה ינפל תומימת ס (SpCas9) ליצירת מעברי dsDNA ביים gRNA באתר אינטגרציה שנבחרו. הכתב ממוקד מכן לתוך מיקומה גנומית שבחרת לעבור רקומבינציה הומולוגית על-ידי מתן שאינם לליניארית מיקוד וקטור (טלוויזיה) המכיל את רצף כתב ולצדו כביכול 5' ו 3' הומולוגיה זרועות (HA)11.

  1. הבחירה של לוקוס יישוב, gRNA, מיקוד וקטור עיצוב
    1. לבחור לוקוס thegenomic כדי להיות ממוקד בהתבסס על השאלה המדעית בודדים. שימוש שפורסמו ברשימות של אתרים שילוב חוזר ונשנה של HIV שנמצאו חולים שונים מחקרים2,3,4,5,6,7,8 בתור קו מנחה. אין סיליקו לחלץ את רצף גנומית של מיקומה גנומית הרצוי להיות יישוב (רצף הגן המלא) או לפחות 5 kb של רצף גנומית באמצעות דפדפן הגנום UCSC (http:// genome.edu.ucsc.edu).
    2. לבחור מורה RNAs (gRNAs) של 20 nt עבור פילוח של מיקומה גנומית שבחרת באמצעות את webtool E-פריך (http://www.e-crisp.org).
      1. בחר "הומו ספיינס GRCh38" האורגניזם. Bp קלט 2000 של רצף גנומית כיסוי מיקומה גנומית הרצוי שחולצו בשלב 1.1.1.
      2. התחל חיפוש gRNA באמצעות הגדרות יישום בינוני (כל פאם, כל 5' הבסיסי, את המטרות לסבול אי-התאמות ולאחר אינטרונים/CPG האיים אינם נכללים). רשימה עם עיצובים אפשריים gRNA יופיע, הדירוג הגבוהה לנמוכה כדי להוריד את הציונים של ירידה לפרטים ויעילות.
      3. בחר gRNA רצוי מראה ניקוד גבוה עבור ירידה לפרטים ויעילות, הוא הכי קרוב ככל האפשר אל מיקומה גנומית הרצוי כדי להיות ממוקד.
        הערה: פשרה בין קרבה מיקומה גנומית הרצוי עיצוב ספציפי ויעיל gRNA חייב להימצא.
    3. הפיצוץ הרצף gRNA שבחרת נגד הגנום הפניה באמצעות דפדפן הפיצוץ NCBI (https://blast.ncbi.nlm.nih.gov) כדי לבדוק על ייחודו של אתר איגוד gRNA.
      1. בחר "אנושי" כמו הגנום. קלט את רצף gRNA כמו הרצף שאילתה. בחר "רצפים דומים מאוד" (megablast) כתוכנית. ודא כי הרצף gRNA הוא ייחודי. אם לא, בחרה gRNA שונים של שלב 1.1.2.3 ו הפיצוץ שוב.
    4. ברגע gRNA רצף נבחר, בחר סיליקו 1,000 bp ויוצאת רצף gRNA רצף גנומית שחולצו בשלב 1.1.1 5' ו 3' HA בהתאם.
      הערה: GRNAs צריך להיות הומולוגי כדי אינטגרציה הגנומי שבחרת באתר מיקומה, ממוקם מוטיב סמוך protospacer (פאם; למשל, הגולה עבור SpCas9) (איור 2 א). הטלוויזיה מכיל את הרצף כתב כי הוא 5' 3' ולצדו משמשת. יש כיסוי 1000 bp ויוצאת רצף gRNA11. הרצף המלא gRNA לא להיכלל HA. חפיפה בין עד 5 nt זו קביל (איור 2 א).
  2. דור של gRNA ומיקוד וקטורים
    הערה: לקבלת ערכות וקטור, ראה איור 2b.
    1. כדי להפיק וקטור להבעה של SpCas9, gRNA, השתמש את pX330-U6-Chimeric_BB-cBh-hSpCas9 כעמוד השדרה שממנו הן SpCas9 והן את המדריך יחיד RNA (sgRNA) יכול בו זמנית להתבטא. לשבט את רצף gRNA לתוך עמוד השדרה, השתמש את אתרי הגבלת BbsI12.
    2. כדי להפיק את הטלוויזיה, בחרו ' פלסמיד גבוהה-העתק של עמוד השדרה (למשל pMK, או cDNA3.1).
      1. ראשית, להרכיב הכתב (ב פרוטוקול זה: LTR_tdTomato_BGH-PA) לתוך עמוד השדרה לבנות על ידי הרכבה גיבסון clong13 באמצעות אסיפה מסחרי שיבוט קיט, ו להציג 5' ו 3' איגוף באתרים מגבלת (למשל, 5' פאצי, 3' מרק פורטנוי) עבור הגבלת עוקבות עיכול שיבוט של משמשת.
      2. להגביר את לחץ הדם 1000 של השברים HA שבחרת בשלב 1.1.4 מ- DNA גנומי (gDNA) סוג התא כדי להיות ממוקד (ב פרוטוקול זה: תאים Jurkat) באמצעות של ה-DNA פולימראז עם הגהה פעילות (ראה טבלאות 1 ו- 2 המרכיבים PCR ו רכיבה על אופניים תנאים). לאחר מכן, מציגים את הכתב איגוף אתרי ההגבלה על הקצוות 5' ו 3' של כל HA (פאצי על 5' HA בשני הקצוות, מרק פורטנוי ב- 3' HA משני הכיוונים).
      3. ברצף שיבוט יש לתוך לבנות את עמוד השדרה כבר המכילה הכתב (נוצר בשלב 1.2.2.1) על-ידי אנזים הגבלה שכפול14,15. לשבט. תחילה, בעוד 5 דקות HA משתמש באתרים מגבלת פאצי, ואז לשכפל ב 3' HA בשימוש באתרים מגבלת מרק פורטנוי.
        הערה: אם הטלוויזיה עמוד השדרה מכיל כתב פלורסנט נוספים של, עמוד השדרה לא רצוי שילוב יכול להיות מוערך על ידי cytometry זרימה (ראה שלבים 3.2.2 ו 3.2.3). אם הטלוויזיה עמוד השדרה מכיל שום כתבת פלורסנט, אינטגרציה המרכזי (backbone) חייב להיות מוערך באמצעות PCR (ראה שלב 3.2.8).

Figure 1
איור 1: זרימת עבודה עבור CRISPR Cas9-בתיווך מיקוד הדור, מבחר של הכתב המשובטים קווים עם שילוב מוגדר אתר. (א) יצירת וקטור היעד, מגלי Jurkat T תאים עם היעד וקטור, Cas9/gRNA ביטוי פלסמיד. Enrich (B) התאים transfected 72 h פוסט תרביות תאים על-ידי FACS. התאים גדלים 10 עד 14 ימים לאשר את המופע של פילוח אירועים לפי ה-PCR ו flow cytometry. תן (C). (ד) ליצור שיבוטים תא בודד על-ידי הגבלת שיבוטים דילול ולתת לגדול במשך שלושה שבועות. (E) מסך השיבוטים עבור מטרות נכונה לפי ה-PCR, לזרום cytometry בתבנית 96-ובכן. הרחב שיבוטים שנבחרו. אימות (F) הנכון פילוח שיבוטים שנבחרו על ידי תספיג דנ א, PCR, רצף, וניתוח אירועים המטרה של Cas9 endonuclease פעילות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: פילוח אסטרטגיה ותכנון וקטור. gRNA (), בחירה של הזרועות הומולוגיה. 20 nt gRNA הומולוגי לאתר היעד שבחרת גנומית, ממוקם בסמוך הומולוגיה PAM. הזרועות הינם משלים למעלה bp 1,000 - במורד הזרם של gRNA ואין לכלול את רצף gRNA. (b) השרטוטים של מיקוד וקטוריים וגם וקטור gRNA/Cas9. הווקטור מיקוד מורכבת רצף כתב שבחרת הוא 5' ו 3' ולצדו הזרועות הומולוגיה. וקטור gRNA/Cas9 מבוסס על עמוד השדרה pX330-U6-Chimeric_BB-cBh-hSpCas9. (ג) תיאור סכמטי של פילוח על-ידי רקומבינציה הומולוגית. וקטור היעד ו- guideRNA/Cas9 וקטור transfected לתאים Jurkat. Cas9 שמתווכת הפסקה גדיל כפול באתר היעד גנומית (שצוין על-ידי *) ומקל רקומבינציה הומולוגית ושילוב של הכתב רצף לתוך מיקומה היעד גנומית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

2. CRISPR-Cas9-פילוח המבוסס על תאים Jurkat

  1. תרביות תאים של תאי Jurkat
    1. 24 שעןת לפני תרביות תאים, צלחת 1.25 x 106 Jurkat T תאים ב- 2.5 מ של RPMI 1640 שיושלם עם 10% (v/v) עגל עוברית סרום (FCS) ו- 4 מ מגלוטמין [המכונה "אנטיביוטיקה w.o. RPMI (אלב)"] לכל טוב של צלחת התרבות תאים 6-. טוב. עבור ניסוי מיקוד יחיד, להכין לוח 6-ובכן מלאה אחד (דהיינו, 6 בארות כל אחד עם 2.5 מ של התא השעיה).
    2. למחרת, שיתוף transfect התאים עם מעגלי טלוויזיה, pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA שימוש ספציפי ריאגנט של תרביות תאים עבור תאים Jurkat.
      1. להוסיף µg 2 של הטלוויזיה מעגלית, 2 µg של pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA לכל טוב 250 µL בינוני RPMI מסחרי עם ריכוז מופחת סרום אופטימיזציה עבור תרביות תאים (RPMI עם 50% ירידה בסרום) התגובה שפופרת, לערבב היטב.
      2. להוסיף µL 12 של תרביות תאים מגיב באיטיות למדיום/DNA בלי לגעת בקיר של הצינור, מערבולת. תן את התערובת תקופת דגירה של 15 דקות ולהוסיף dropwise באר אחת של תאים. דגירה התאים-CO 37 ° C ו-5%2.
        הערה: ניתן לשנות את הכנת תקנים התגובה. אין שינוי בינוני נדרש לאחר תרביות תאים.
  2. העשרה של transfected תאים על-ידי תא לפעיל על-ידי קרינה פלואורסצנטית מיון (FACS)
    1. 72 h שלאחר תרביות תאים, בריכה תאי transfected, לספור אותם, ולהתכונן העשרה על ידי FACS. איסוף התאים צינור חרוטי 50 מ ל, צנטריפוגה 300 x g ובטמפרטורת החדר (RT) במשך 4 דקות, לשטוף את התאים פעם ב- PBS, צנטריפוגה שוב, להשעות את צניפה בסכום המתאים FACS מאגר (PBS בתוספת FCS 1% + 1 מ"מ EDTA)-עונה 1 פרק 10 7 תאים למ"ל, ולהעביר סוף סוף לתוך צינור FACS.
    2. נושא את התאים FACS ומיין אלה אקספרס הכתבת פלורסנט של הטלוויזיה (למשל, tdTomato ב פרוטוקול זה). איסוף התאים RPMI 1640 בתוספת 10% FCS, 4 מ מגלוטמין, ו 50 פניצילין U/mL, סטרפטומיצין (המכונה "RPMI w / AB").
    3. לאחר FACS מיון, לשטוף את התאים פעם אחת על-ידי הוספת 20 מ של RPMI w / AB תאים ממוינים, centrifuge ב 300 x גרם במשך 4 דקות ב- RT. Resuspend בגדר תא בסכום המתאים של RPMI w / AB, צלחת התאים אחד טוב של צלחת התרבות תאים עם נפח המתאים על פי תא מספר פוסט-FACS.
      הערה: תרבות למיין את התאים באמצעי אחסון קטן (למשל, 24-טוב), כאשר רמות ניכר של מוות של תאים נצפו בשבוע הראשון שלאחר מיקוד (עד 80-90%).
    4. הרחב את האוכלוסייה לתא יישוב מעורב עד צפיפות של עונה 1 פרק 106 תאים/מ ל בקבוקון תרבות תא 75 cm ². זה ייקח סביב 10-14 ימים פוסט-FACS מיון.
  3. אישור על מטרות אירועים לפי cytometry זרימה באוכלוסייה לתא יישוב מעורב
    1. אחרי 10-14 ימים של התרחבות (כאשר תאים מיצית צפיפות של עונה 1 פרק 106 תאים/מ ל בקבוקון 75 ס מ2 תא תרבות), צלחת שתי בארות עם עונה 1 פרק 106 תאים של מעורבות לפלח אוכלוסייה תא ב 1 מ"ל של RPMI w / AB בתרבות 12-ובכן תא צלחת.
    2. זירוז את LTR HIV של הכתב (דור של טלוויזיה מתואר בשלב 1.2.2.1.) באחת הבארות על-ידי הוספת 50 ננוגרם למ"ל phorbol פעילים-12 13-אצטט (PMA) ו 1 מיקרומטר Ionomycin (המכונה PMA-Iono). השתמש תאים בתוך הבאר השנייה של הפקד-induced. תרבות של המושרה והן את התאים הלא-induced עבור 24 שעות.
    3. לקחת 0.5 mL התליית תא הלא-induced המושרה תאים (כל אחד), לרחוץ אותם פעם אחת ב- PBS, וכן להשעות כל µL 200 FACS המאגר.
    4. לנתח 100,000 תאים על-ידי cytometry זרימה. שער של יחיד-התאים קיימא בהתבסס על גודל פיזור קדימה, sideward, ולנתח על ביטוי גנים כתב פלורסנט.
      הערה: בשלב זה 10-14 ימים (מיון פוסט-FACS), ביטוי ארעית של פלורסנט כתב על ידי תרביות תאים צריך לא להיות יותר לזיהוי. הביטוי פלורסנט בנקודת זמן זו מצביעה על אינטגרציה הגנומי של הכתב רצף.
  4. איתור מיקוד אירועים לפי ה-PCR על הדנ א של האוכלוסייה לתא יישוב מעורב
    הערה: לאתר מיקוד אירועים באמצעות PCR, עיצוב שני זוגות פריימר ספציפי עבור אינטגרציה (int.) צומת 5' ו- int. צומת 3'. עבור 5' int. לצומת ה-PCR צריך לאגד פריימר לפנים נגד הזרם של 5' HA, ומהצמיגים הפוכה ב LTR של הכתב (תחל P1 ו- P2 ב איור 3a). הזוג פריימר עבור int. צומת 3' ה-PCR ישתרע מהרשות הפלשתינית של הכתב ל bp 100-200 במורד הזרם של 3' HA (primers P3 ו- P4 ב איור 3a). תחל P1 ו- P4 ישמש גם עבור הגברה של אלל שאינו ממוקד באוכלוסייה יישוב מעורב. לקבלת מפרטים טכניים, ראה איור 3 א.
    1. להכין gDNA מ- 2 מ של התא השעיה של האוכלוסייה לתא יישוב מעורב משלב 2.2.4. להשתמש ערכת חילוץ gDNA לפי הפרוטוקול של היצרן. אז הכינו את gDNA של תאים שאינם במיקוד כפקד.
    2. לבצע int. צומת מותני (primers P1/P2, P3/P4 עבור 5' ו- 3' int. בצומת, בהתאמה) ושימוש אלל שאינן ממוקדות PCR (primers P1/P4) אמינות גבוהה DNA פולימראז (ראה טבלאות 3 ו- 4 עבור מרכיבים PCR ותנאי הרכיבה) . ניתוח µL 5 מוצרי ה-PCR על ג'ל agarose/טה 1.5%.
      הערה: אם האוכלוסייה יישוב מעורב מכיל תאים שעברו הנדסה הגנום, PCR למוצר להתייחס זה לא לזיהוי ב gDNA של תאים שאינם ממוקדות (בקרה שלילית). עבור שאינן ממוקדות אלל PCR, אחד צריך להתבונן מוצר בגודל זהה עבור שניהם יישוב שאינן ממוקדות התאים ו (חיובי פקד עבור תחל P1 ו- P4 גנומית). אם הם נצפו להקות, לשקול את שינוי תנאי הרכיבה PCR על ידי הגדלת מספר מחזורים או לשנות את מאגר ה-PCR (למשל באמצעות תוספת של דימתיל סולפוקסיד או כמויות גדולות יותר של Mg2 +), או על-ידי שינוי של פולימראז.

3. הדור של קווים המשובטים הקרנה עבור פילוח נכון

הערה: לאחר אישור של האירועים מיקוד באוכלוסייה לתא יישוב מעורב על ידי cytometry זרימה ו- PCR (סעיפים 2.2-2.4), ליצור שיבוטים תא בודד (משך: 28 עד 35 ימים) ומסך לשילוב הנכון של הרצף הכתב.

  1. הדור של תא בודד שיבוטים באמצעות דילול יופיצ
    1. להכין בינוני ממוזגים Jurkat מראש: תוריד RPMI w / AB בינוני של תאי Jurkat T בריא, שאינו מטופל גדל עונה 1 פרק 106 תאים למ"ל, צנטריפוגה למשך 5 דקות ב x 300 גרם, ולסנן את תגובת שיקוע באמצעות יחידת מסנן מזרק 0.22 מיקרומטר.
      הערה: לשמור על המדיום ממוזגים ב 4 ° C לאחסון לטווח קצר או ב-20 ° C לאחסון ארוך יותר משבוע. להכין 20-30 מ של מדיום ממוזגים לפני ציפוי דילול.
    2. לספור את התאים יישוב מהשלב 2.2.4 אחרי 10-14 ימים של התרחבות, לדלל אותם ב- RPMI w / AB כדי ריכוז עונה 1 פרק 105 תאים/מ ל.... קח 100 µL של עונה 1 פרק 105 תאים למ"ל פתרון, לדלל עם 9.9 מ של המדיום כדי להשיג ריכוז של תאים למ"ל 1,000. קח 1 מ"ל של 1,000 תאים למ"ל פתרון, לדלל עם 9 מ של המדיום כדי להשיג ריכוז של תאים למ"ל 100.
    3. צלחת 96-ובכן פלטות המכילות 1 התא לכל טוב ותאים 2 לכל טוב. עבור תא 1 לכל טוב, לקחת 1 מ"ל של 100 תאים למ"ל פתרון ומערבבים בעדינות עם 5 מ של מדיום ממוזגים, 4 מיליליטר בינוני טריים מאגר ריאגנט סטרילי.
    4. עבור תאים 2 לכל טוב, לקחת 2 מ ל 100 תאים למ"ל פתרון ומערבבים בעדינות עם 5 מ של מדיום ממוזגים, 3 מ"ל של מדיום טריים. צלחת 96-ובכן עגול-לוחות עם 100 µL של דילול תאים המתאימים לכל שימוש טוב של pipet רב-ערוצי.
      הערה: 5 כדי 10 צלחות 96-ובכן לפי פילוח לבנות מספיקים להשיג שיבוטים להקרנה.
    5. מחסנית הלוחות 96-ובכן, לכסות על כל ערימה עם צלחת 6-ובכן המכיל 3 מ"ל של PBS היטב כל ולאחר תקופת דגירה הצלחות ב- 37 מעלות צלזיוס חממה התרבות תאים humidified עם 5% CO2 של 3 שבועות.
      הערה: אינם משתנים המדיום התרבות התא במהלך תקופה זו. אל תפתח החממה יותר מאשר פעם אחת או פעמיים בשבוע. התוצאות הטובות ביותר הם נצפו חממות עם מאגר מים פתוחים.
    6. לאחר 3 שבועות של אינקובציה, חזותית לאשר הנוכחות של מבוגר מושבות באמצעות מיקרוסקופ אור (4 X הגדלה) ולסמן הבארות עם מושבות מבוגר אז הן גלויות כנקודות על החלק התחתון של הבארות.
    7. להכין צלחת אחת 96-ובכן עגול-התחתון עם µL 100 של RPMI w / AB לכל טוב. Resuspend בעדינות תאים של מסומן היטב על ידי pipetting. העברת 100 µL תא השעיה לבאר אחת של צלחת 96-ובכן החדש כבר המכיל 100 µL של RPMI w / AB, ואז לערבב בעדינות על ידי pipetting. העברת µL 100 של ההשעייה תא לתוך ריק השני הצלחת 96-ובכן עגול-התחתונה כדי לשכפל את הצלחת.
    8. להמשיך עם כל בארות מסומן עם מושבות בוגר. למלא כל הבארות ריק עם 200 µL של RPMI w / AB בינוני. דגירה הצלחות ב- 37 מעלות צלזיוס ו-5% CO2-
      הערה: באחת הצלחות האלה על הרחבה של תא בודד שיבוטים ("צלחת מניות") והשני ישמש "צלחת כפולים" להקרנה.
  2. הקרנה של שיבוטים תא בודד על-ידי cytometry זרימה ו- PCR
    הערה: בעוד שיבוטים תא בודד מתרחבים, להשתמש בלוח כפולים מהשלב 3.1.8 מסך תא בודד שיבוטים נוכחות של רצף כתב על ידי ה-PCR (צעדים 3.2.4–3.2.12) וביטוי של פלורסנט כתב על ידי cytometry זרימה (צעדים 3.2.2–3.2.3) (איור 3 c).
    1. תן את הצלחת כפולים תקופת דגירה של 24 עד 48 שעות ולשכפל את הצלחת שוב. כדי לעשות זאת, להוסיף 100 µL של RPMI w / AB כל טוב לערבב בעדינות על ידי pipetting, להעביר 100 µL צלחת 96-ובכן סיבוב המדרגה החדשה באמצעות של pipet רב-ערוצי. השתמש לוח אחד עבור הקרנה cytometry זרימה והשני להקרנה מבוססי ה-PCR.
    2. להקרנה cytometry זרימה, לגרות את התאים עם PMA-Iono. להכין את mastermix של 0.1 µL של Ionomocin (1 מ מ מניות), µL 0.1 של PMA (50 מניות µg/µL), µL 4.8 של RPMI w / AB לכל מספר של בארות, ואז להוסיף 5 µL של mastermix לכל טוב.
      הערה: אינדוקציה יש צורך לזהות בהצלחה שיבוטים, איפה LTR יכול להיות שקט transcriptionally לכן הכתב פלורסנט אינו מתבטא.
    3. תן תאים תקופת דגירה של 24 שעות ולהכין תאים עבור cytometry זרימה כפי שמתואר בשלב 2.3.3. שער לכל יחיד-התאים קיימא בהתבסס על גודל פיזור sideward ונראות ולנתח ביטוי גנים כתב פלורסנט מאת cytometry זרימה (לדוגמה תוצאות, ראה איור 3 c). אם הטלוויזיה עמוד השדרה מכיל כתב פלורסנט השני עם יזם (למשל, GFP), מסך כל השיבוטים לביטוי המרכזי (backbone) כתב גם (ראה צעד 1.2.2 ו את ההערה הבאה לקבלת הסבר).
      הערה: עמוד השדרה כתב הביטוי מציין שילוב בלתי רצויות של רצפים של עמוד השדרה.
    4. ברגע השיבוטים בצלחת כפולים השני גדלו במידה מספקת (בדרך כלל 24 עד 48 שעות לאחר שכפול של צלחת 96-ובכן), להכין lysates תא המכיל gDNA להקרנה PCR. צנטריפוגה הצלחת 10 דקות ב x 300 גרם -RT. בזהירות. תוריד את תגובת שיקוע מבלי להפריע בגדר תא
      הערה: כל השלבים להכנת lysates ותגובות PCR ניתן לבצע באמצעות פיפטות רב-ערוצי.
    5. לשטוף תאים עם µL 100 ל- PBS מאת pipetting ועדין צריך שתוציאו את הצלחת. בשביל 5 דקות ב x 300 גרם -RT. . תוריד את PBS ולהוסיף 200 µL מאגר פירוק [200 מ"מ NaCl, 100 מ מ טריס-HCl pH 8-8.5, 5 מ מ EDTA, 0.1% מרחביות; לאחר מכן להוסיף 250 – 1,000 µg/mL של proteinase K (lyophilized אבקת, להיכנס טרי)] לכל טוב. לערבב בעדינות על ידי pipetting, ולהעביר את המתלים צלחת חדשה ה-PCR.
    6. לאטום את הצלחת עם סרט פרפין, תקופת דגירה של h 1-55 מעלות צלזיוס thermocycler. צנטריפוגה במהירות מקסימלית 10 דקות (3,000 x g) לסובב את שאריות תאים, ולהעביר את תגובת שיקוע צלחת חדשה ה-PCR.
      הערה: תא lysates בתוך צלחות ניתן לאחסן בשלב זה ב 4 ° C עד שימוש נוסף.
    7. להכין צלחת PCR 96-ובכן עם µL 110 של dH2O ולהוסיף 10 µL של תא lysate (1:12 דילול). תא lysates ייתכן צמיגה וקשה pipet. להשתמש לפחות טיפים pipet 20-µL.
    8. בטל proteinase K מאת הדגירה למשך 10 דקות ב 99 ° C ב- thermocycler. לאחר מכן השתמש את lysates תא מוחלש, מדולל להקרנה PCR.
    9. עיצוב תחל לסינון PCR (P5 ו- P6) מבוסס על הרצף כתב שבחרת כדי להגביר 500-800 bp של הרצף הכתב. עבור בקרת חיובי PCR, להשתמש תחל P7 ו P8 המדגישים 630 bp של פראי-סוג, שאינן ממוקדות גנומית לוקוס (ג'יןNUP188 ) (איור 3 c וטבלה 5). עיצוב זוג פריימר השלישי זה מגביר את לחץ הדם 500-600 של עמוד השדרה טלוויזיה כפקד לשילוב לא ספציפי של רצפי המרכזי (backbone) טלוויזיה (עמוד השדרה ה-PCR).
    10. ההקרנה, שליטה של השדרה ה-PCR, להשתמש mastermix המסחרי של ה-PCR (ראה טבלאות 6 ו 7 עבור מרכיבים PCR ותנאי הרכיבה). השתמש 2 µL של מדולל, מוחלש lysate מוכן בשלב 3.2.8 כתבנית ולרוץ PCR 38 עד 40 מחזורי PCR הגברה בתבנית 96-ובכן.
    11. ניתוח µL 5 מוצרי ה-PCR על ג'ל agarose/טה 1.5%.
      הערה: עבור פקד PCR, להקה מסוימת של 630 bp להתייחס עבור כל דגימה, המאשר כי האיכות של תא lysates היא נאותה PCR. להקה מסוימת בהקרנת PCR (500-800 bp בהתאם לעיצוב פריימר) מציינת שילוב של הרצף כתב. להקה ספציפי עבור עמוד השדרה ה-PCR (500-600 bp, בהתאם לעיצוב פריימר) מציין שילוב בלתי רצויות של רצפי המרכזי (backbone) טלוויזיה (לדוגמה תוצאות, ראה איור 3 c).
    12. לשלב את התוצאות של cytometry זרימה (שלב 3.2.3), מבוסס-PCR ההקרנה (שלב ' ן 3.2.12). בחר שיבוטים אשר להציג גדלים נכונה של מוצרי ה-PCR הקרנת PCR חיובית והשליטה PCR, ביטוי של פלורסנט כתב לאחר אינדוקציה עם PMA-Iono ב cytometry זרימה. הכללת שיבוטים להראות לכל מוצר ה-PCR בתוך עמוד השדרה ה-PCR או ביטוי של טלוויזיה המרכזי (backbone) מקודד חלבון פלואורסצנטי, המציינת את האינטגרציה לא ספציפי של הטלוויזיה המרכזי (backbone) רצף.
    13. בהדרגה להרחיב שיבוטים שנבחרו מהצלחת מניות 96-ובכן לתבניות טוב יותר גדול (48/24/12/6-טוב) עד להשגת תבנית הבקבוק T75 התרבות התא על-ידי הוספת בינוני טריים כל 2-3 ימים. לשמור על צפיפות התאים בין עונה 1 פרק 105 עונה 1 פרק 106 תאים/מ ל....
    14. הקפד להכין תא מניות של שיבוטים במהלך הרחבה: לספור את התאים צנטריפוגה ב g x 300 דקות 5-RT, למחוק את תגובת שיקוע, להשעות את התאים בעדינות FCS + דימתיל סולפוקסיד 10%-5 x 106 תאים/מ ל.... Aliquot המבחנות קריוגני, שימוש קירור הקפאה מיכל להקפיא את התאים עד 80 ° C ב- 1 ° C/דקה. לאחסון לטווח ארוך, מעבירים את הנוזל N2.
      הערה: , רצוי לשמור על בקבוקון תרבות תא T75 (קרי, בסביבות 1 x 107 תאים) במהלך הרחבת בהכנה של gDNA עבור אימות של פילוח על-ידי הדרומי סופג (ראו סעיף 3.4).
  3. אימות של שילוב אתרים על-ידי ה-PCR/רצף שיבוטים שנבחרו
    הערה: 5' ו 3' int. צמתים של שיבוטים שנבחרו הן PCR מוגבר, נאספו כדי סנגר רצף כדי לוודא תקן מיקוד ברמת רצף ה-DNA.
    1. להכין את gDNA של שיבוטים שנבחרו, Jurkat פראי-סוג התאים באמצעות ערכת חילוץ gDNA מסחרי.
    2. השתמש זוגות פריימר איגוד 5' הסוף של הכתב ואת הזרם של 5' HA עבור 5' int. צומת (primers P1 ו- P2) ו 3' סוף הכתב במורד הזרם של 3' HA עבור 3' int. צומת (primers P3 ו- P4) כפי שמתואר בשלב 2.4. השתמש תחל P1 ו- P4 כדי להגביר את האתר אינטגרציה יישוב על אלל כתב לענייני integrant (איור 4a).
    3. להכין תגובות PCR עם 100-200 ng gDNA כתבנית ולבצע PCR באמצעות פולימראז של הגהה הפעילות (ראה טבלאות 1 ו- 2 עבור מרכיבים PCR ותנאי הרכיבה).
      הערה: אם הם נצפו להקות, לשקול את שינוי תנאי הרכיבה של ה-PCR על-ידי הגדלת מספר מחזורים או שינוי המאגר PCR (לדוגמה, על-ידי הוספת דימתיל סולפוקסיד או כמויות גדולות יותר של Mg2 +), או על-ידי שינוי של פולימראז.
    4. ניתוח µL 5 מוצרי ה-PCR על ג'ל agarose/טה 1.5%. אם הלהקה הנכון גדלים הם נצפו, לטהר את המוצר PCR הנותר באמצעות ערכת מסחרי, נושא זה סנגר רצף. ודא רצפים של int. צומת 5', int. צומת 3' ו אתר יישוב של אלל כתב לענייני integrant על-ידי הצבתם עם רצפי הצפוי.
      הערה: אלל הומולוגי מאיפה הכתב לא שילב יראה סביר בתיווך Cas9 שינויים באתר היעד, כגון נוקלאוטיד שהתוספות או המחיקות (איור 4a).
    5. עבור שיבוטים המציגים int. הנכון צומת רצפים לאחר יישור, לבצע PCR של הגברה לכתב כל יישוב, נושא זה סנגר רצף כדי לאמת את הרצף הנכון של integrant.
  4. תספיג דנ א ניתוח עבור אימות של פילוח שיבוטים שנבחרו
    הערה: ניתוח תספיג דנ א של שיבוטים שנבחרו נדרש כדי לוודא פילוח נכון או לא לכלול רקומבינציה בתיווך Cas9 אירועים שאירעו ב אתר יישוב אינטגרציה.
    1. לפתח אסטרטגיה לעיכול gDNA המתאים, לחקור את העיצוב לפני הפעלת הניסוי.
      1. בחר באנזים הגבלה על הגבלת gDNA שיוצר המתאים שברי אורך 2 עד 10 קילו ב אתר יישוב. אנזימי הגבלה מסוימת, כגון Asp718, באםHI, אליפותאני, BglII, לסביבהRV, השלישי הינד, המש, אני, Pstאני, PvuII, Scaאני, סטו, ו Sst אני שימשו בהצלחה עבור עיכול משקל מולקולרי גבוה gDNA.
      2. עיצוב שני רגשים הדרומי שונים: בדיקה ספציפית כתב עם בדיקה גנומית. המכשיר הספציפי כתב hybridizes לרצף בתוך הכתב (כלומר בדיקה ספציפית tdTomato של, ). החללית גנומית hybridizes לאזור גנומית קרוב (אך לא חופפים) HA אחת.
      3. לבחור את המכשיר גנומית כך השבר שנוצר על ידי עיכול gDNA כי יזוהו על-ידי בדיקה גנומית איגוד שונה אורך (יותר מ- 2 kb) מיישוב, שאינן ממוקדות אללים (איור 4b). אורך המכשיר של 400 עד 1,000 מומלצת bp.
      4. צבעי יסוד כדי להגביר את שני רגשים נדרש עיצוב ה-PCR. להגביר את המכשיר הספציפי כתב מתבנית טלוויזיה באמצעות של אמינות גבוהה DNA פולימראז (ראה טבלאות 3 ו- 4 עבור מרכיבים PCR ותנאי הרכיבה).
      5. להגביר את החללית גנומית של פראי-סוג Jurkat gDNA מוכן עם ערכת חילוץ gDNA מסחרי השימוש של ה-DNA פולימראז עם הגהה הפעילות (ראה טבלאות 1 ו- 2 עבור מרכיבים PCR ותנאי הרכיבה). לטהר את המוצרים ה-PCR ג'ל agarose/טה ולחלץ את שברי באמצעות ערכת חילוץ ג'ל מסחרי על פי הוראות היצרן.
    2. תמצית gDNA משקל מולקולרי גבוה מתאי7 עונה 1 פרק 10 של תאים Jurkat פראי-סוג שיבוטים שנבחרו מהשלב 3.2.14.
      1. גלולה התאים על ידי צנטריפוגה ב x 300 גרם במשך 5 דקות ב RT, לשטוף אותו פעם אחת עם PBS, וכן להשעות בגדר ב 4 מ של פירוק מאגר [200 מ"מ NaCL, 100 מ מ טריס-HCl pH 8, 5 מ מ EDTA, 0.1% מרחביות; לאחר מכן להוסיף 250 – 1,000 µg/mL proteinase K (אבקת lyophilized שוקלים טרי)]. דגירה o/n ב 55 ° C, רועדת-350 סל"ד ב thermomixer השולחן.
      2. מוסיפים 4 מ ל אלכוהול איזופרופיל ומערבבים על ידי היפוך פי 10 עד 20. GDNA צריך להיות גלוי כמו התמיסה לבן. ברקע את gDNA precipitated אל קצה פיפטה מזכוכית בסדר, לשטוף מאת המתעוררים 750 µL של 70% EtOH, ולתת יבש ב RT (5-10 דקות).
      3. לשפוך את התמיסה לתוך צינור התגובה 1.5 mL המכיל µL 500 x 1 טה מאגר (10 מ מ טריס-HCl pH 8.0, 1 מ מ EDTA) ולהשאיר להתמוסס o/n ב 4 ° C, רועדת-350 סל"ד. כל pipetting של gDNA של שלב זה צריך להיעשות עם טיפים נשא רחב כדי למנוע הטיה.
        הערה: הכנת gDNA משקל מולקולרי גבוה הוא חיוני לניתוח תספיג דנ א, ערכות הכנה gDNA הנמכרים אינם מתאימים.
    3. תקציר (שתי פעמים) 15 µg של gDNA של שיבוטים שנבחרו, פראי-סוג תאים Jurkat עם אנזים הגבלה שנבחר (ראה שלב 3.4.1.1) בתגובה 60 µL עם 6 µL של אנזים (20 יחידות/µL): ראשית, להוסיף את ה-DNA, מאגר עיכול, ו- ddH2O, דגירה o/n ב 37 ° C , ואז להוסיף את האנזים, דגירה o/n על טמפרטורה ספציפית אנזים עיכול. ug 15 של gDNA מתעכל נדרש לכל בדיקה הדרומי.
    4. השתמש µL 7 של התקציר הגבלת 60 µL בג'ל אנליטי על ג'ל agarose/טה 1%. כתם מעיד על עיכול מלא איכותי לניתוח תספיג דנ א.
    5. לזרז את התקציר הגבלת הנותרים על-ידי הוספת 1:10 3 מ' סודיום אצטט, אמצעי אחסון 2 100% EtOH, ואז תקופת דגירה של h 1-80 ° C ו צנטריפוגה למשך 30 דקות x 15,600 g ב- 4 מעלות צלזיוס.
    6. למחוק את תגובת שיקוע ולשטוף את גלולה עם 70% EtOH. צנטריפוגה למשך 15 דקות ב 15,600 x g ב 4 ° C, למחוק את תגובת שיקוע, תן בגדר מתייבשים בקצרה-RT, להמיס µL 20 של ddH2O.
    7. הפעל 1% agarose/טה סופג ג'ל, טעינת 20 uL של gDNA מתעכל בנתיב. הפעל את הג'ל על 2 h 60 V, 400 mA.
      הערה: אחוז agarose ג'ל ו לרוץ זמן/מתח עשוי להיות מותאם על פי גודל המקטע הצפוי לגילוי תספיג שחושבו בצעד 3.4.1.1. השלבים הבאים של ניתוח תספיג מתוארים בפירוט פרוטוקול משלים (שלבים 1 עד 18). שלבים אלה מהווים: שטיפה של הג'ל blotting, סופג אל ניילון ממברנה, בדיקה רדיואקטיבי הדור, הכלאה בדיקה ופיתוח של הסרט autoradiograph. להשוות את תבנית סימון שהושג לאחר פיתוח autoradiograph בשלב 18 (פרוטוקול משלים) עם דפוס הצפויות בהתאם לאסטרטגיה הדרומי (לדוגמה תוצאות, ראה איור 4b).
  5. ניתוח אירועים מחוץ-יעד
    הערה: מאז בהנדסת הגנום CRISPR Cas9-בתיווך יכול ליצור את המטרה אפקטים, PCR-להגביר את עשרת המדורגים הגבוהים silicoבחזה את המטרה אתרים שנבחרו שיבוטים, מעמיד אותם בפני סנגר רצף.
    1. השתמש CCTop16 (http://crispr.cos.uni-heidelberg.de) כדי ליצור רשימה של עשרת המדורגים הגבוהים סיליקו ניבא את המטרה רצפים.
      1. קלט את רצף gRNA כולל פאם משמש עבור מיקוד כמו הרצף שאילתה. בחר "הגולה" כמו פאם "הגנום האנושי" ההפניה לחיזוי חופש-יעד.
      2. להגדיר אי-התאמות סך מקסימלי "4", היעד באתר אורך אורך gRNA בלי פאם. קובץ הפלט תספק רשימה מדורגת של אתרים את המטרה גנומית gRNA בהתאמה.
    2. אין סיליקו לחלץ את bp רצף גנומית 500 ויוצאת של כל אחד עשר הגבוה ביותר בדירוג את המטרה הלהיטים באמצעות דפדפן הגנום UCSC (http://genome.edu.ucsc.edu) ואת המיקום של חופש-המטרה להכות מרשימת תוצאות CCTop.
    3. עבור כל אחד את האתרים היעד כדי להיות מנותח, עיצוב פריימר PCR זוג זה מגביר את קטע של 600-700 bp, כולל אתר חופש-היעד החזוי.
    4. תמצית gDNA מן שיבוטים שנבחרו Jurkat פראי-סוג התאים באמצעות ערכת חילוץ gDNA מסחרי. עבור כל אתר חופש-יעד, לבצע PCR משתמש של ה-DNA פולימראז עם הגהה הפעילות (ראה טבלאות 1 ו- 2 עבור מרכיבים PCR ותנאי הרכיבה) וביום פראי-סוג של gDNA נגזר שיבוט בהתאמה.
    5. ניתוח µL 5 מוצרי ה-PCR על ג'ל agarose/טה 1.5%. אם הלהקה הנכון גדלים הם נצפו, לטהר את המוצר PCR הנותר באמצעות ערכת טיהור PCR מסחרי, נושא זה סנגר רצף. להשוות רצפים של האתרים את המטרה בתאים Jurkat, יישוב שיבוטים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

בניסוי זה נציג בחרנו להתמקד עיתונאי HIV-1-derived מינימלי המורכב LTR, tdTomato-קידוד רצף, תיקים עשויים. האות רצף מנחלת שני באינטרון 5 של ג'ין BACH217. לוקוסים עבור המיקוד נבחרו על פי קרבה לאתרי שילוב חוזר ונשנה שפורסמו שנמצאו במחקרים שונים על ראשי T תאים נגועים ב- HIV2,4,5,6, 7,8 ואת נוכחותם של מוטיב פאם הגולה צורך בתיווך Cas9 אינדוקציה של מעברי כפול-strand. וקטורים היעד היו בנויים, transfected לפי הפרוטוקול המתואר. זרימת העבודה עבור תרביות תאים, בדיקת מיקוד אירועים, דור של תא בודד שיבוטים, ואת ההקרנה ומבחר של שיבוטים סכמטי מוצג באיור1.

שבועיים לאחר להעשרת-FACS transfected תאים, הצלחנו לזהות גנים כתב לאחר אינדוקציה PMA-Iono על-ידי cytometry זרימה 4 עד 12% של תאים, בהתאם לשילוב באתר (מידע לא מוצג) ומוצרים PCR על ה-DNA גנומי המתפרסות על-פני כל 5' 3' צומת אינטגרציה מן הזרם של 5' HA בתוך רצף כתב, במורד הזרם של 3' HA לתוך כתב רצף, בהתאמה (איור 3a ו- 3b). לאחר שווידא כי המיקוד אירועים התרחשה, הלכנו כדי ליצור שיבוטים תא בודד על-ידי הגבלת דילול יופיצ. בידיים שלנו, ציפוי 5 כדי 10 צלחות 96-ובכן לפי פילוח לבנות היה מספיק כדי להשיג מספיק שיבוטים עבור מסך מוצלח. בפרוטוקול (סעיף 3.2), הוא מתואר כיצד לבצע הקרנה של תא בודד שיבוטים ב 96 המשוכפלת-ולס. בהקשר זה, שיבוטים חיוביים בלבד חייב להיות מורחב, אשר חוסך זמן ומאמץ. איור 3 c, מוצגים נתונים לדוגמה של ההקרנה-FACS לאחר אינדוקציה PMA-Iono ו- PCR ההקרנה. נצפו מספר שיבוטים עם ביטוי גנים כתב גבוה, נמוך ולאחר לא פלורסנט (איור 3 c). PCR-להקרנה, חשוב לכלול פקד ה-PCR אשר מגביר את לוקוס גנומית של בחירה כדי לקבוע אם האיכות של תא lysates היא נאותה PCR. במקרה שלנו, בחרנו רצף bp 630 במיקומה ג'ין NUP188 עבור פקד ה-PCR (עבור רצפים פריימר, ראה טבלה 5). תחל לסינון PCR ואז נועדו להגביר את רצף קצר יותר ממוקם הכתב. בנוסף, ה-PCR לרצף עמוד שידרה וקטור היעד בוצעה כדי לא לכלול כל השיבוטים אשר היה unspecifically משולב היעד וקטור עמוד השדרה רצפים (עמוד השדרה PCR, הנתונים לא מוצג).

שיבוטים שנבחרו מראש היו אז מורחבת, ניתוח נוסף עבור מטרות נכונה לפי תספיג דנ א ו- PCR ורצף. תספיג דנ א בוצעה באמצעות בדיקה ספציפית כתב בדיקה ספציפית עבור האיגוד לוקוס גנומית מחוץ לכתב אך לא בתוך הזרועות הומולוגיה של וקטור מיקוד. מעניין, השיכפולים שנבדקו על ידי תספיג דנ א היו חיוביות בהקרנת PCR מראש, אך רק חלק הראה הלהקה הנכון גדלים בניתוח תספיג דנ א, היה heterozygously משולב הכתב (איור 4b). לכן יש צורך לא רק להסתמך על הקרנת PCR תוצאות אלא גם לבדוק פילוח נכון על ידי סופג הדרומי. כדי לוודא פילוח נכון ברמת רצף ה-DNA, אינטגרציה צמתי היו מוגבר על ידי ה-PCR, המוצרים היו נתונים סנגר רצף (איור 4a). ראוי לציין, רצף של היעד באתר הומולוגי אלל, איפה היה הכתב לא משולב, חשף בתיווך Cas9 שינויים. ב- איור 4a, דוגמאות עבור מחיקה בתיווך Cas9 מוצג. כדי לבדוק את Cas9 בתיווך ההשפעות את המטרה, רשימת האתרים את המטרה הגבוהה המדורגים נוצר כמתואר בסעיף 3.5. אתרי את המטרה הגבוהה ביותר בדירוג 10 היו הוגדל ל- PCR מ- DNA גנומי המשובטים, המוצרים נתון סנגר רצף. בתוך תא בודד יישוב שיבוטים יצרנו, אין וריאציות של רצפי פראי-סוג Jurkat נצפו באתרים עשר הגבוה ביותר בדירוג את המטרה.

Figure 3
איור 3: הקרנה של תא בודד שיבוטים הכוונת האירועים. () תיאור סכמטי של פריימר עיצוב עבור איתור מיקוד אירועים לפי ה-PCR באוכלוסיה לתא יישוב מעורב. פריימר זוגות לצורך זיהוי 5' אינטגרציה צומת (P1, P2) 3' אינטגרציה צומת (P3, P4) מסומנים כחצים. פריימר P1 ו- P4 משמשים גם כדי להגביר את לוקוס יישוב של אלל ללא כתב integrant (b) DNA גנומי מאוכלוסיית לתא יישוב מעורב היה מוכן 10 ימים לאחר FACS העשרה של תאים transfected וניתח עבור 5' אינטגרציה צומת (P1, P2 ), 3' אינטגרציה צומת (P3, P4; הנתונים לא מוצג), אלל פראי-סוג של יישוב מיקומה (P1, P4). פראי-סוג Jurkat תאים (wt) שימשו השליטה. (ג) המסך הראשון של תא בודד שיבוטים ב 96-ובכן צלחות. 96-ובכן צלחות עם שיבוטים תא בודד הוקרנו על מטרות נכונה לפי cytometry זרימה לאחר אינדוקציה PMA-Iono וניתוח PCR. התוצאות לדוגמה שיבוטים יוצגו. PCR בוצעה תא lysates עם עיתונאי ספציפי תחל (הקרנת PCR; P5, P6), תחל הגברה של לוקוס גנומית (שליטה. PCR, כאן: לוקוס NUP188; P7, P8). תא lysates של תאים Jurkat פראי-סוג (wt) ו- DNA גנומי HIVisB2 לשבט (B2)18 מוכן עם ערכת זמינים מסחרית שימש פקד שלילי לסינון PCR ושליטה חיובי עבור פקד PCR, בהתאמה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: ניתוח של שיבוטים שנבחרו תא בודד לשילוב הנכון כתב. () ניתוח רצף של אינטגרציה צמתים וכן יישוב לוקוס על אלל ללא כתב integrant. פריימר זוגות לצורך זיהוי של 5' אינטגרציה צומת (P1, P2), 3' אינטגרציה צומת (P3, P4), לוקוס יישוב של אלל כתב לענייני integrant (P1, P4) שימשו. מוצרי ה-PCR היו מוגבר מ- DNA גנומי של תא בודד שיבוטים ונחשפו סנגר רצף. רצף תוצאות היו המיושר רצפים הצפוי. מוצגות נתוני לדוגמה של אחד שיבוט. Chromatograms רצף בין צומת הגנום/HA HA/כתב צומת מוצגים עבור צומת אינטגרציה 5' והן 3'. התאמות מסומנות נקודות. אתר קישור של gRNA מסומן עם תיבה. Cas9-induced מוטציות מסומנים באדום. תיאור סכמטי של פריימר עיצוב מוצגת להלן. חיצים מציינים עמדות פריימר המשמש עבור הגברה. (b) ניתוח תספיג דנ א של שיבוטים שנבחרו תא בודד יישוב ותאים פראי-סוג Jurkat. תספיג דנ א ניתוח בוצע על ה-DNA גנומי עם החללית עיתונאי ספציפי ואת מכשיר בדיקה זיהוי רצף גנומית ביישוב והן פראי-סוג אלל (גנומית העצמית). נתוני של שיבוטים דוגמה 7 מוצגים. שיבוטים עם הלהקה הנכון גדלים מסומנים תיבות. היעד מדולל וקטור פלסמיד שימש בקרה חיובית (+). מפרטים טכניים עבור ניתוח תספיג דנ א מוצג להלן. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

מגיב הוספת לפי התגובה
קדימה פריימר (20 מיקרומטר) 1 ΜL
הפוך פריימר (20 מיקרומטר) 1 ΜL
10 x Taq מאגר 5 ΜL
µL 1 dNTPs (2.5 מ מ כל אחד) 1 ΜL
MgCl (50 מ מ) 1 ΜL
דימתיל סולפוקסיד 1.5 ΜL
gDNA (50-100 ng/µL) 2 ΜL
נוקלאז ללא מים מילוי µL עד 49.5
Taq DNA פולימראז (5 U/mL) 0.5 ΜL
התגובה נפח 50 ΜL

טבלה 1: מתכון PCR באמצעות פולימראז של הגהה פעילות. הכמות של כל ריאגנט שיש להוסיף לכל PCR תגובה מצוינת. PCR מיועד הגברה באמצעות DNA גנומי כתבנית. המתכון משמש שלב 1.2.2.2 (הגברה של הזרועות הומולוגיה), שלב 3.3.3 (אימות של שילוב אתרים), שלב 3.4.1.5 (דור של בדיקה גנומית עבור תספיג דנ א), שלב 3.5.4 (ניתוח אירועי חופש-יעד).

צעדים טמפרטורה זמן מחזורים
דנטורציה הראשונית 95 ° C 2 דקות 1
דנטורציה 95 ° C 40 s 30-35
חישול 58 ° C 45 s
סיומת 72 ° C 1 דקות/kb
סיומת הסופי 72 ° C 10 דקות 1

בטבלה 2: תנאי הרכיבה על ה-PCR באמצעות פולימראז של הגהה פעילות. תנאי הרכיבה תואמות מתכון PCR המפורטים בטבלה1.

מגיב הוספת לפי התגובה
קדימה פריימר (20 מיקרומטר) 1 ΜL
הפוך פריימר (20 מיקרומטר) 1 ΜL
5 x מאגר באיכות גבוהה 5 ΜL
µL 1 dNTPs (2.5 מ מ כל אחד) 1 ΜL
gDNA (50 – 100 ng/µL) או פלסמיד דנ א (50 ng/µL) 2 µL gDNA או
µL 1 פלסמיד דנ א
נוקלאז ללא מים מילוי µL עד 49.5
אמינות גבוהה DNA פולימראז 0.5 ΜL
התגובה נפח 50 ΜL

טבלה 3: מתכון PCR באמצעות פולימראז אמינות גבוהה של. הכמות של כל ריאגנט שיש להוסיף לכל PCR תגובה מצוינת. PCR מיועד הגברה חזקה של תבניות DNA. המתכון משמש שלב 2.4.2 (זיהוי של אירועים מיקוד) ועל שלב 3.4.1.4 (דור של בדיקה ספציפית כתב עבור תספיג דנ א).

צעדים טמפרטורה זמן מחזורים
דנטורציה הראשונית 98 ° C 30 s 1
דנטורציה 98 ° C 10 s 30 - 35
חישול 58 ° C 30 s
סיומת 72 ° C s 30/kb
סיומת הסופי 72 ° C 10 דקות 1

בטבלה 4: תנאי הרכיבה על ה-PCR באמצעות פולימראז אמינות גבוהה של. תנאי הרכיבה תואמות PCR מתכון מפורט בטבלה3.

פריימר רצף (5' – 3')
P7 שליטה PCR F CTTTGTTGGGTAAGCATGGAGGTC
שליטה P8 PCR R CAGTTACTCACCTTTGCACATAGG

טבלה 5: Oligonucleotide רצף עבור פקד ה-PCR. ואחורה צבעי יסוד ההגברה של שבר bp 630 של לוקוס NUP188 מצוינים.

מגיב הוספת לפי התגובה
מיקס מאסטר PCR מוכן לשימוש 8 ΜL
קדימה פריימר (20 מיקרומטר) 1 ΜL
הפוך פריימר (20 מיקרומטר) 1 ΜL
נוקלאז ללא מים 8 µl
תא lysate (1:12 דילול) 2 ΜL
התגובה סה כ נפח 20 ΜL

טבלה 6: מתכון הקרנה-PCR- הכמות של כל ריאגנט שיש להוסיף לכל PCR תגובה מצוינת. PCR המתכון מיועד לסינון PCR בשלב 3.2.11.

צעדים טמפרטורה זמן מחזורים
Pre-PCR דנטורציה 94 ° C 2 דקות 1
חישול 58 ° C 1 דקות
סיומת 72 ° C 1 דקות
דנטורציה 94 ° C 30 s 38
חישול 58 ° C 30 s
סיומת 72 ° C 1 דקות
סיומת הסופי 72 ° C 10 דקות 1

טבלה 7: תנאי הרכיבה על הקרנה-PCR- תנאי הרכיבה מתאימות את המתכון PCR המופיעים טבלה 6-

Subscription Required. Please recommend JoVE to your librarian.

Discussion

כאן, אנו מתארים את פרוטוקול ליצירת מודלים לכתבת HIV-1-נגזר Jurkat עם האתרים שבחרת שילוב proviral החלת בהנדסת הגנום המבוססות על CRISPR-Cas9.

מספר נקודות של הפרוטוקול דורשים תשומת לב רבה במהלך שלב התכנון. ראשית, מיקומה כדי להיות ממוקד יש לבחור בקפידה, כמו לוקוסים מסוימים ייתכן שיהיה קל יותר למטרה יותר מאחרים (למשל, בהתאם למצב כרומטין האזור לבין המטרה רצף עצמה). רצפים חוזרים הם הקשה. לשבט לתוך הווקטור מיקוד, והם לעתים קרובות לא ייחודי בתוך הגנום. מחוזות כרומטין דכאניים שקשה היעד עם19,CRISPR-Cas9 מערכת20.

שנית, הבחירה של gRNA חיונית CRISPR Cas9-בתיווך מיקוד. לצורך יצירת מודלים הידבקות ב- HIV עם שילוב נציג אתרים, אנשים רוצים את gRNA כדי לאגד קרוב ככל האפשר כדי נקודה חמה אינטגרציה. עם זאת, האתר הזה לא יהיה אידיאלי עבור גיוס Cas9; לכן, יש לבצע פשרה בין הקרבה של הרצף gRNA לאתר אינטגרציה של הבחירה ואיכות gRNA. מצאנו את webtool E-פריך אמין לניבוי gRNAs תפקודית. זה גם אפשרי לבצע בדיקה טרום gRNA בהבעת transiently מספר gRNAs יחד עם Cas9 בסוג התא להיות ממוקד, הקרנה על מוטציות. GRNA מתאים תפנה Cas9 ביעילות לאתר היעד ו האתר משלימים gRNA תציג מוטציות. אורך משמשת (1,000 bp ויוצאת של אתר אינטגרציה) נבחר על פי מחקרים שפורסמו בעבר11. באופן כללי, צמצום אורך הזרועות הומולוגיה תגרום בתדר מיקוד. באורך של 1000 bp של הזרוע הומולוגיה מציג פשרה טובה בין תדירות מיקוד מספקת וקלות היעד וקטור הבנייה.

שלישית, מספיק זמן חייב להיות בילה על עיצוב טוב של הבונה הכתב. הכתב מינימלי בשימוש פרוטוקול זה, אשר מכיל את NL4 של HIV-1-3 נגזר LTR ו- tdTomato של קידוד רצף, תוכנן בהתבסס על העיקרון הבא: LTRs יחיד תוארו אך ורק כתוצאה שנותרו שברי proviral על כמה מקרים של המשובטים הרחבת יחידים כרוני HIV-1-נגוע21. הוא צפוי כי משמאל לימין המצב חריפה השפעות כרומטין באתרים אינטגרציה ומארגן הגיוס של מתחמי הסלולר. אנחנו נבחר כתב HIV מינימלי התמקדות LTR HIV כרכיב העיקרי גנטי תקינה אז הציג tdTomato כסמן פלורסנט LTR פעילות במקום עוד גנים HIV-1, הגנום הנדסה תדירות דווח להיות גבוה עם קטן יותר פילוח מוסיף11. בהתחשב גוזלת זמן מדרגות טלוויזיה שיבוט, שבטים, הקרנה, ואימות של השיבוטים, מומלץ לשקול היטב את עיצוב הכתב HIV בהקשר של מחקרים פונקציונלי בסופו של דבר יבוצע על יישוב שורות תאים. אפשר, למשל, לשקול ההכללה של איסור פרסום מנהיג רצף, 3' HIV LTR, ו/או אחרים רצפי הגן ויראלי הכתב. הפרוטוקול ניתן להתאים בקלות כזו בונה כתב שונים.

באופן כללי, חשוב לשקול את הבחירה של סוג התא ניתן לפלח דור שיבוט מתא בודד יכול להיות קשה עם שורות תאים מסוימים. מצאנו כי תאים Jurkat אינם יעילים מאוד בדור שיבוט יחיד; עם זאת, החלטנו לבחור את סוג התא עבור השימוש ידועים החבויים HIV זיהום מודלים9. השגנו את התוצאות הטובות ביותר ב- Jurkat יופיצ דילול המשובטים בינונית ממוזגים-50%, כאשר לוחות נותרו ללא הפרעה באינקובטור שנפתח לא יותר מ 3 פעמים בשבוע. אם באמצעות שורת תאים שונים רצוי, מומלץ לבדוק מראש את האפשרות של יצירת שיבוטים תא בודד על-ידי ביצוע לדילול יופיצ הניסוי. נקודה נוספת שכדאי לזכור היא וריאציה של תרביות תאים המחירים של שורות תאים שונים. אם תרביות תאים הוא לא ריאלי עבור השורה שבחרת תא, electroporating התאים עבור מיקוד ייתכן שיהיה צורך. שימו לב כי הבחירה של שורת התאים המשמש עבור מיקוד עשויה לא להיקבע על ידי היבטים טכניים בלבד, כגון יעילות עבור תרביות תאים או שיבוט יחיד הדור. היבטים פונקציונליים עשויים גם להיחשב, כגון פעילות גנים ברמת השעתוק או inducibility של מיקומה ג'ין יישוב. זה עשוי לדרוש ההקרנה של שורות תאים שונים לפני שזרימת העבודה מיקוד.

יודגש, כי הפרוטוקול המתואר היא אינטנסיבית. זה צריך להיות צפוי לקחת 3 עד 6 חודשים מהצעד הראשון לקווים תא המשובטים הסופי. הניתוח של תספיג דנ א, אשר משמש לבדיקת לאירועים בייעודי לאתר שילוב יחיד, אולי נראה מסורבל, אבל מהנסיון שלנו חשוב מאוד - רק תת-קבוצה של שיבוטים תא בודד הראה השילוב הצפוי הראה צמתי לכל ה-PCR תקן המתבנת ב תספיג דנ א. באופן אידיאלי, ניסויים כדאי ליצור מספר שיבוטים עם הוספת אותו כמטרה לאותו אתר אינטגרציה לפקד עבור אפקטים המשובטים בכל הניסויים הבאים שהופכים להשתמש המשובטים. זה אפשרי לעשות משפחתית ולא משפחתית הטרוזיגוטיים וכן מיקוד homozygous. בקווים תא כתב משפחתית ולא משפחתית הטרוזיגוטיים, אלל ללא integrant סביר להניח הצג שינויים ב Cas9 פילוח אתר, אשר יכולים להיות מוקרן על ידי ה-PCR (איור 4a). עבור מיקוד homozygous, אנו מציעים שני אללים ניתן לפלח ברציפות.

ניקח בחשבון שיקולים אלה, זרימת עבודה זו מספקת אמצעי ליצירת דגמי הסלולר חזק יכול לשמש כדי להגדיל את ההבנה של הידבקות ב- HIV כרונית. לדוגמה, פעילות proviral בתגובה סוכנים היפוך השהיה יכול להיבדק בהקשר של שילוב חוזר ונשנה אתרים. זה עשוי להיות עניין מיוחד החוקרים בתחום, שכן עמדה אפקטים יש כבר גרמה לפגיעה HIV השהיה, היפוך22.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

אנו מודים ברטה Weseloh והבל בטינה לקבלת סיוע טכני. אנו מודים גם ארן Düsedau ו- Hennesen יאנה (לזרום cytometry בפלטפורמת הטכנולוגיה, היינריך Pette אינסטיטוט) לקבלת תמיכה טכנית.

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics