CRISPR-Cas9-기반 게놈 엔지니어링 선택한 Proviral 통합 사이트와 에이즈-1 감염에 대 한 Jurkat 기자 모델을 생성 하

* These authors contributed equally
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

우리는 선택 된 게놈 사이트에 proviral 통합 정리 에이즈-1 감염에 대 한 새로운 체 외 모델의 생성에 대 한 게놈 엔지니어링 워크플로우를 제시. 에이즈-파생 된 기자 들의 CRISPR Cas9 중재, 사이트별 게놈 조작에 의해 촉진 된다. 단일 셀 클론 세대, 심사, 그리고 올바른 대상 확인에 대 한 자세한 프로토콜 제공 됩니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Bialek, J. K., Walther, T., Hauber, J., Lange, U. C. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J. Vis. Exp. (141), e58572, doi:10.3791/58572 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

인간 면역 결핍 바이러스 (HIV)는 재발 사이트 및 게놈 핫스팟 호스트 세포 게놈으로 비 무작위로 proviral DNA를 통합합니다. 여기 우리가 선택한 게놈 통합 사이트 CRISPR-Cas9-기반 게놈 엔지니어링 기술을 사용 하 여 HIV 감염에 대 한 소설 체 외 모델의 생성에 대 한 자세한 프로토콜 제시. 이 방법으로 선택의 기자 시퀀스 수 있습니다 통합할 수는 타겟, 선택한 genomic 소재 시, 임상 관련 통합 사이트를 반영.

프로토콜, HIV 파생 기자의 디자인과 대상 사이트 및 gRNA 순서의 선택 설명 합니다. 상 동 팔 대상 벡터 생성 이며 Jurkat T 세포로 페. 기자 시퀀스 선택 된 게놈 사이트에 대상 사이트에 Cas9 중재 이중 가닥 브레이크에 의해 촉진 된 동종 재결합 대상 이다. 단일 셀 클론 생성 되며 cytometry 및 PCR에 의해 이벤트 대상에 대 한 상영. 선택 된 클론 확장 다음, 그리고 PCR, 시퀀싱, 그리고 남부 blotting에 의해 확인 된다 정확한 타겟팅. CRISPR Cas9 중재 하는 유전자 공학의 잠재적인 대상에서 이벤트는 분석 했다.

이 프로토콜, 소설 세포 배양 시스템을 사용 하 여 임상 관련 통합 사이트에서 그 모델 HIV 감염을 생성할 수 있습니다. 단일 세포 클론의 생성 및 올바른 기자 시퀀스 통합의 확인은 시간이 걸리는, 결과 클론 라인 proviral 통합 사이트 선택 기능 분석에 강력한 도구입니다.

Introduction

감염 시 호스트 게놈으로 통합 proviral DNA의 인간 면역 결핍 바이러스 (HIV)의 수명 주기에서 중요 한 단계입니다. 통합에 따라 HIV 메모리 CD4 + T 세포 같은 긴 CD4 + T 세포 부분 집합에서 대기 시간을 설정 하 여 유지 합니다. 에이즈 통합 비 무작위1,2나타납니다. Recurrently 통합 proviral dna 게놈 핫스팟의 숫자 심하게만 성으로 감염 된 개인2,,34 통합 사이트의 시퀀싱을 통해 여러 연구에서 발견 되었습니다. 5,6,,78. 흥미롭게도, 이러한 통합 사이트의 일부에 같은 로커 스 재발 사이트에서 통합 클론 확장1미칠 긍정적으로 생각을 이끌어 감염 된 세포의 큰 분수에서 발견 되었다.

재발 성 통합 사이트의 중요성에 대 한 우리의 이해를 사전에 proviral 통합 사이트 선택 탐구 해야 합니다. 그러나 여러 가지 기술적인 측면 공부 에이즈 통합을 방해 하는, 선택과 결과 사이트. JLat 셀 라인 임상 관련 재발 통합 사이트9를 반영 하지 않습니다 처럼 광범위 하 게 HIV 대기 시간에 대 한 셀 문화 모델 사용. 기본 환자 파생 셀에 대 한 연구 한 한편으로, 통합 사이트 프리의 설명 연속 있지만 기능 분석에 대 한 허용 하지 않습니다. 우리의 지식을 하려면, 아무 적절 한 실험 모델은 선택 된 임상 관련 통합 사이트를 분석 하는 기능을 사용할 수 있습니다.

여기 CRISPR-Cas9-기반 게놈 엔지니어링 기술을 사용 하 여 HIV 감염에 대 한 새로운 모델을 생성 하는 자세한 워크플로 선물이. 여기에 설명 된 워크플로 HIV 감염, 선택한 통합 사이트에서 genomically 통합된 proviral 기자를 들고 모델 T 세포 유래 기자 셀 라인을 생성 하기 위해 사용할 수 있습니다. 그들은 따라서 proviral 통합 사이트 에이즈 생물학 영향을 미칠 수 어떻게는 provirus 다른 치료 전략 (예: 대기 시간 역전 에이전트에서, inducibility)에 응답 하는 방법을 탐구 하는 새로운 도구로 봉사는. 우리의 방법은 CRISPR-Cas9-기반 게놈 엔지니어링, 기자는 통합에 동종 재결합 하 여 시퀀스는 대상 사이트에서 Cas9 nuclease 유도 이중 가닥 브레이크에 의해 촉진 된의 장점을 사용 합니다. 통합에 대 한 대상 사이트는 HIV에 감염 된 개인과 Cas9 중재 게놈 엔지니어링에 대 한 적합 한 PAM 모티프의 존재에 대 한 연구에서 설명된 재발 통합 사이트에 근접에 따라 선택 됩니다.

우리의 훌륭한 결과에서 우리는 BACH2 유전자 소재 시는 BTB와 CNC 상 동 transcriptional 레 귤 레이 터 2에 대 한 코드에 집중 했다. 항 레트로 바이러스 치료에만 성으로 HIV 감염 된 개인, BACH2 통합된 HIV-1 시퀀스3,6,7,,810의 농축을 보여주는 loci 중 하나입니다. 우리는 우리 BACH2 intron 5에서에서 두 개의 특정 사이트를 대상으로 HIV 1 파생 긴 단말기 반복 (LTR), tdTomato 코딩 시퀀스, 소 성장 호르몬 (BGH) polyadenylation 신호 (PA)의 구성 된 최소한의 HIV 파생 기자를 선택 했습니다. 제시 프로토콜 Jurkat 세포 인간의 CD4 + T 세포에서 파생 된 현 탁 액 셀 라인, 하지만 다른 셀 라인을 사용할 수 있습니다, 적절 하 게 적응 하는 프로토콜 최적화 되어 있습니다. 선물이 다양 한 대상 사이트, 대상 상 동 팔, CRISPR-Cas9-중재 선택한 게놈 사이트, 생성 및 클론 라인의 선택으로 취재의 대상으로 하 고 포괄적인 벡터의 건설에 대 한 자세한 워크플로 확인 새로 생성 된, 대상 기자 셀 라인의.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 게놈 엔지니어링 및 벡터 (tv) 디자인을 타겟팅에 대 한 전략을 타겟팅

참고: 유전자 공학의 첫 번째 단계는 선택 및 필요한 도구 CRISPR Cas9 중재 하는 대상에 대 한 포함 됩니다. 게놈 통합 사이트 로커 스의 선택, 타겟팅, 셀 형식의 선택 그리고 디자인의 통합에 대 한 HIV 파생 기자가이 단계를 선행 한다. 이 프로토콜은 Jurkat 대상 세포로 HIV-LTR_tdTomato_BGH-PA 최소한의 취재의 대상으로 설명 합니다. CRISPR-Cas9-기반 타겟팅, 세대, 심사 및 검증을 위한 클론 선의 워크플로의 순서도 그림 1에 묘사 된다. 설명된 대상 전략 S. pyogenes Cas9를 사용 하 여 선택한 통합 사이트에서 gRNA 감독 dsDNA 나누기 생성 하 (SpCas9). 기자 제공 하는 비 오는지 대상 벡터 (tv) 소위 5'과 3' 상 동 팔 (HA)11에 의해 형벌 기자 시퀀스를 포함 하 여 동종 재결합을 통해 선택한 genomic 소재 시에 다음 타겟입니다.

  1. 타겟된 로커 스, gRNA, 및 벡터 디자인 대상의 선택
    1. 개별 과학 질문에 따라 타겟이 될 thegenomic 소재 시에 선택 합니다. 에이즈의 재발 통합 사이트의 게시 된 목록에 환자에서 다른 발견 사용 연구2,3,,45,6,7,8 로 지침 서입니다. 실리콘 추출 대상된 ()의 순서는 완전 한 유전자 또는 genomic 순서의 적어도 5 kb 원하는 genomic 소재 시 게놈 시퀀스 UCSC 게놈 브라우저 (http:// genome.edu.ucsc.edu)를 사용 하 여.
    2. 선택 가이드 (gRNAs) 20의 RNAs E-선명 webtool (http://www.e-crisp.org)를 사용 하 여 선택한 genomic 소재 시의 대상에 대 한 nt.
      1. 유기 체로 "호모 사피엔스 GRCh38"를 선택 합니다. 취재 단계 1.1.1에서에서 추출 원하는 genomic 소재 시 게놈 시퀀스의 입력 2000 혈압.
      2. 중간 응용 프로그램 설정 (모든 팸, 어떤 5' 기본, 오프-대상 용납 불일치, 및 introns/CPG 섬 제외)를 사용 하 여 gRNA 검색을 시작 합니다. 가능한 gRNA 디자인 목록이 표시 됩니다, 특이성 그리고 효율성에 대 한 점수를 낮은 높은 순위.
      3. 선호 특이성 그리고 효율성에 대 한 높은 점수를 표시 하 고 타겟이 될 원하는 genomic 소재 시에 최대한 가까이 gRNA를 선택 합니다.
        참고: 원하는 genomic 소재 시에 근접 및 특정 하 고 효율적인 gRNA의 디자인 사이 타협 찾을 수 있다.
    3. GRNA 바인딩 사이트의 고유성에 대 한 확인 NCBI 폭발 브라우저 (https://blast.ncbi.nlm.nih.gov)를 사용 하 여 참조 게놈에 대 한 선택한 gRNA 시퀀스를 폭발.
      1. 게놈으로 "인간"을 선택 합니다. 쿼리 시퀀스로 gRNA 시퀀스를 입력 합니다. "매우 비슷한 시퀀스" 선택 (megablast) 프로그램으로. GRNA 시퀀스 고유한 있는지 확인 합니다. 그렇지 않으면, 선택 다른 gRNA 단계 1.1.2.3과 폭발에서 다시.
    4. 일단 gRNA 시퀀스를 선택 따라 5'과 3' 하 단계 1.1.1에서에서 추출한 게놈 시퀀스에서 철에 1000 bp 업스트림과 다운스트림 gRNA 시퀀스를 선택 합니다.
      참고: 는 gRNAs 선택한 게놈 통합 사이트 로커 스에 일치 해야 하 고 protospacer 인접 한 모티브에 인접 한 위치 (팸; 예를 들어, SpCas9에 대 한 NGG) (그림 2a). Tv 5'과 3'가 있는 기자 시퀀스를 포함 되어 있습니다. 업스트림 및 다운스트림 gRNA 시퀀스11의 커버 1000 bp를 있다. 전체 gRNA 시퀀스는 HA에 포함 되지 해야 합니다. 최대 5 중첩 nt는 허용 (그림 2a).
  2. GRNA 및 벡터를 타겟팅의 세대
    참고: 벡터 구성표, 그림 2b참조.
    1. SpCas9와 gRNA의 표현에 대 한 벡터를 생성 하는 SpCas9와 단일 가이드 RNA (sgRNA) 표현 될 수 있다 동시에 중추로 서 pX330-U6-Chimeric_BB-cBh-hSpCas9를 사용 합니다. 등뼈에 gRNA 시퀀스를 복제 하려면 BbsI 제한 사이트12를 사용 합니다.
    2. Tv를 생성 하려면 백본 (예:, pMK 또는 cDNA3.1)로 높은 사본 플라스 미드를 선택 합니다.
      1. 첫째, 기자를 조립 (이 프로토콜에서: LTR_tdTomato_BGH PA) 깁슨 어셈블리 clong에 의해 구성 등뼈로13 복제 상업 어셈블리를 사용 하 여 키트, 그리고 5'과 3' 측면에 서는 금지 사이트 소개 (예:, 5' 3'과 PacI SmaI) 이후 제한 소화는가의 복제에 대 한.
      2. 타겟이 될 셀 타입의 게놈 DNA (gDNA)에서 단계 1.1.4에서에서 선택한 HA 조각의 1000 bp를 증폭 (이 프로토콜: Jurkat 세포) 활동 교정와 DNA 중 합 효소를 사용 하 여 ( 표 12 PCR 재료에 대 한 참조 및 사이클링 조건). 그런 다음, 기자 측면에 서는 각 하 (PacI에 5' 하 양 끝에 3' 양쪽에 HA SmaI)의 5'과 3' 끝에 제한 사이트 소개.
      3. 순차적으로 복제 구문 백본14,15복제 제한 효소에 의해 이미 포함 하는 (단계 1.2.2.1에서에서 생성) 기자로 있다. 첫째, 5' 하에 복제 다음에 3' HA 복제 PacI 제한 사이트를 사용 하 여 SmaI 제한 사이트를 사용 하 여.
        참고: Tv 백본 추가 형광 기자 있으면 원치 않는 백본 통합 cytometry에 의해 평가 될 수 있다 (3.2.2, 3.2.3 단계 참조). Tv 백본 아무 형광 기자 있으면 백본 통합 평가 해야 PCR를 사용 하 여 (단계 3.2.8 참조).

Figure 1
그림 1: CRISPR Cas9 중재 하는 대상으로, 생성 및 다양 한 클론 기자에 대 한 워크플로 정의 통합 사이트 선. (A) 대상 벡터 생성 및 transduce 대상 벡터와 Cas9/gRNA 식 플라스 미드 Jurkat T 세포. (B) 리치 transfected 세포 72 h 게시물 transfection FACS에 의해 (C) 하자 셀 10 ~ 14 일에 대 한 성장를 대상으로 PCR에 의해 이벤트의 발생을 확인 하 고 cytometry 흐름. (D) 생성 희석 하 고 클론을 제한 하 여 단일 세포 클론 3 주 동안 성장. (E)는 PCR에 의해 올바른 대상에 대 한 클론 화면 하 고 96 잘 형식에서 cytometry 흐름. 선택 된 클론 확장 합니다. (F) 남쪽 오 점, PCR 및 시퀀싱, 및 Cas9 endonuclease 활동의 대상에서 이벤트의 분석에 의해 선택 된 클론에서 타겟팅 올바른 확인 하십시오. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 전략 및 벡터를 대상으로. () gRNA 그리고 상 동 팔의 선택. 20 nt gRNA 선택한 게놈 대상 사이트에 동종 이며 무기는 gRNA의 다운스트림 1000 bp까지-보완 하 고 gRNA 시퀀스를 포함 하지 않아야 PAM. 상 동에 인접 한 위치. (b) gRNA/Cas9 벡터와 벡터를 타겟팅의 설계도. 5'과 3' 상 동 팔에 의해 형벌 선택한 기자 시퀀스 대상 벡터에 의하여 이루어져 있다. GRNA/Cas9 벡터 pX330-U6-Chimeric_BB-cBh-hSpCas9 백본 기반으로 합니다. (c) 동종 재결합 하 여 타겟팅의 회로도. 대상 벡터 및 guideRNA/Cas9 벡터 Jurkat 세포로 페는. Cas9 중재 게놈 대상 사이트에서 이중 가닥 휴식 (표시 *) 동종 재결합 기자 시퀀스 게놈 대상 현장으로의 통합을 용이 하 게 하 고. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

2. CRISPR-Cas9-기반 Jurkat 세포의 대상으로

  1. Jurkat 세포의 transfection
    1. transfection, 플레이트 1.25 x 106 Jurkat T 이전 24 시간 10% (v/v) 송아지 태아 혈 청 (FCS) 및 4 m m L-글루타민 [라고도 "RPMI w.o. 항생제 (AB)"] 6 음 셀 문화 접시의 당 보충 RPMI 1640의 2.5 mL에 세포. 단일 대상 실험에 대 한 하나의 완전 한 6-잘 접시 준비 (예:, 6 우물 각각 세포 현 탁 액의 2.5 mL).
    2. 다음 날, 공동 원형 tv와 pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA Jurkat 세포의 transfection 시 약 관련 된을 사용 하 여 셀 transfect.
      1. 추가 원형 tv의 2 µ g와 2 µ g pX330-U6-Chimeric_BB-cBh-hSpCas9/gRNA 잘 당의 상업 RPMI 매체의 250 µ L에 감소 된 혈 청 농도 transfection (50% 감소 된 혈 청 RPMI)에 대 한 최적화 된 반응 관에 잘 혼합.
      2. 튜브의 벽을 건드리지 않고 DNA/매체에 천천히 transfection 시 약의 12 µ L를 추가 하 고 소용돌이. 혼합물이 15 분 동안 품 어 및 셀의 한 잘에 dropwise 추가 하자. 37 ° C, 5% CO2에서 셀을 품 어.
        참고: Transfection 반응의 준비 확장할 수 있습니다. 매체 변화는 transfection 후 필요 합니다.
  2. 농축 transfected 셀 형광 활성화 (FACS) 정렬
    1. 72 h 후 transfection transfected 세포 그들, 계산 수영장과 FACS에 의해 농축에 대 한 준비. 4 분 50 mL 원뿔 튜브, g 및 실 온 (RT) x 300에서 원심 분리기에 있는 세포를 수집, 셀 PBS에 한 번 씻고, 다시 원심, 1 x 10 FACS 버퍼 (PBS 1 %FCS + 1 mM EDTA 보충)의 적절 한 금액에 펠 릿을 일시 중단 7 셀/mL, 그리고 마침내 FACS 튜브로 전송.
    2. FACS 셀 제목 및 tv (예:이 프로토콜에서, tdTomato)의 형광 기자를 표현 하는 그를 정렬 합니다. 셀 RPMI 1640 보충 10 %FCS, 4 m L-글루타민, m 50 U/mL 페니실린과 스 ("AB 승 RPMI" 라고도 함)에 수집 합니다.
    3. 후 FACS 정렬, 세척 한 번 정렬된 셀에 AB / RPMI의 20 mL를 추가 하 여 셀 셀 펠 릿 AB 승 RPMI의 적절 한 금액에서 실시간 Resuspend에서 4 분의 300 x g 에서 원심 고 셀에 있는 셀 문화 판에의 한 잘 접시는 셀 번호 게시물-FACS에 따라 적절 한 볼륨.
      참고: 문화 포스트 (최대 80-90%)을 대상으로 첫 주에 관찰 되었습니다 세포 죽음의 상당한 수준으로 작은 볼륨 (예:, 24-잘)에 셀을 정렬 합니다.
    4. 1 x 106 셀/mL 75 ² 셀 문화 플라스 크에의 한 밀도까지 혼합된 타겟된 세포 인구를 확장 합니다. 이것은 10-14 일 게시물 FACS 정렬 주위 걸릴 것입니다.
  3. Cytometry 혼합된 타겟된 세포 인구에 의해 이벤트 대상의 확인
    1. 10-14 일 후 확장 (해당 되는 경우 셀에는 1 x 106 셀/mL 75 cm는2 셀은 문화 플라스 크에서의 밀도 도달 했습니다), 1 x 106 세포 혼합의 판 두 웰 스 대상 12 잘 세포 배양에서 AB 승 RPMI의 1 mL에 세포 인구 플레이트입니다.
    2. 기자의 HIV LTR 유도 (tv의 생성 단계 1.2.2.1에서에서 설명 되어 있습니다.) 50 ng/mL phorbol myristate 12 13-아세테이트 (PMA)을 추가 하 여 우물 중 하나에 1 µ m Ionomycin (PMA Iono 라고도 함). 두 번째 잘 비 유도 제어 셀을 사용 합니다. 문화는 유도 및 24 h에 대 한 비 유도 세포.
    3. (각각) 비 유도 및 유도 된 세포의 세포 현 탁 액의 0.5 mL를가지고, PBS에 한 번 그들을 씻어 및 FACS 버퍼의 200 µ L에서 각각 일시 중단.
    4. 100000 셀 cytometry 분석. 앞으로 측면 분산형에 크기에 따라 가능한 단일 셀 게이트 및 형광 성 취재 원 유전자 발현 분석.
      참고: (10-14 일 게시물 FACS 정렬)이이 단계에서 과도 한 표현의 transfection에 의해 형광 기자 이상 해야 감지. 이 시간 포인트에 형광 식 기자 시퀀스의 게놈 통합을 나타냅니다.
  4. 혼합된 대상된 셀 인구의 genomic DNA에서 PCR에 의해 이벤트 대상의 검출
    참고: 디자인 두 뇌관 쌍 통합 (int.) 접점 5'과 3' int. 접점에 대 한 특정 PCR 통해 대상 이벤트를 감지 하. 5' int. 교차점 PCR에 대 한 앞으로 뇌관 바인딩해야 5' 하 고 기자 (P1 및 P2 그림 3a에서 뇌관)의 LTR에서 역방향 뇌관의 업스트림. 3' int. 접합에 대 한 뇌관 쌍 PCR 기자의 PA에서 3' HA (P3 및 P4 그림 3a에서 뇌관)의 하류 100-200 bp 스팬 한다. 프라이 머 p 1과 p 4 또한 혼합 대상 인구에서 대상 비 대립 유전자의 증폭에 대 한 될 것입니다. 회로도, 그림 3a참조.
    1. 단계의 2.2.4 혼합된 타겟된 세포 인구 세포 현 탁 액 2 mL에서 gDNA를 준비 합니다. 제조 업체의 프로토콜에 따라 gDNA 추출 키트를 사용 합니다. 다음 컨트롤으로 비 대상 셀의 gDNA를 준비 합니다.
    2. Int. 접합 PCRs 수행 (5'과 3' int. 접점를 위한 뇌관 P1/P2 및 P3/P4 각각) 및 대상 비 대립 유전자 PCR (뇌관 P1/P4)는 고 충실도 DNA 중 합 효소를 사용 하 여 ( 표 3 4 PCR 재료 및 순환 조건 참조) . 5 µ L의 1.5 %agarose / 태 젤에 PCR 제품을 분석.
      참고: 혼합된 대상된 인구 게놈 엔지니어링 받은 셀 있으면 특정 PCR 제품 관찰 해야 그 gDNA 비 대상 셀 (부정적인 제어)에서 감지 되지 않습니다. 타겟 비 대립 유전자 PCR에 대 한 하나 모두 대상 및 비 대상 셀 (genomic P1 및 p 4 뇌관에 대 한 긍정적인 제어)에 대 한 동일한 크기의 제품을 관찰 해야 한다. 아무 밴드, 관찰 하는 경우에 사이클의 수를 증가 또는 변경 (예를 들어 통해 DMSO 또는 Mg2 +의 증가 금액의 추가), PCR 버퍼 또는 중 합 효소를 변경 하 여 PCR 순환 상태를 변경 하는 것이 좋습니다.

3. 올바른 대상에 대 한 클론 라인 및 심사의 세대

참고: Cytometry 및 PCR (섹션 2.2-2.4), 혼합된 타겟된 세포 인구에서 대상 이벤트의 확인 후 단일 세포 클론 생성 (기간: 28 ~ 35 일)와 올바른 통합 기자 시퀀스의 화면.

  1. 희석 도금을 통해 단일 세포 클론의 세대
    1. Jurkat 조절 매체 미리 준비: 1 x 106 셀/mL, 300 x g에 5 분 동안 원심 분리기로 성장 하는 건강 한, 치료 되지 않는 Jurkat T 세포에서 AB 중간 승 RPMI 고 상쾌한 0.22 μ m 주사기 필터 장치를 사용 필터.
      참고: 단기 저장을 위해 4 ° C에 또는 저장 1 주 이상-20 ° C에서 조절된 매체를 유지. 20 ~ 30 mL 희석 도금 전에 바른된 매체의 준비.
    2. 확장의 10-14 일 후 2.2.4 단계에서 대상 셀 그리고 1 x 105 셀/mL의 농도에 AB / RPMI에 그들을 희석. 1 x 105 셀/mL 해결책의 100 µ L을 1, 000 셀/mL의 농도 달성 하기 위해 매체의 9.9 mL로 희석. 1, 000 셀/mL 해결책의 1 mL를 100 세포/mL의 농도 달성 하기 위해 매체의 9 mL로 희석.
    3. 플레이트 96 잘 접시 잘 당 1 셀을 포함 하 고 잘 당 2 셀. 잘 당 1 셀에 대 한 100 셀/mL 해결책의 1 mL 고 바른된 매체의 5 mL와 멸 균 시 저수지에 신선한 매체의 4 mL 부드럽게 혼합.
    4. 잘 당 2 셀 100 셀/mL 해결책의 2 mL 고 부드럽게 조절된 매체의 5 mL와 3 mL 신선한 매체의 혼합. 잘 사용 하 여 멀티 채널 피펫으로 당 각각 셀 희석의 100 µ L로 플레이트 96 잘 라운드-하단 접시.
      참고: 구조를 대상으로 당 96 잘 접시 10에 5은 심사에 대 한 클론을 얻기 위해 충분 한.
    5. 각 스택에 포함 하는 각 음에 PBS의 3 mL 6 잘 플레이트 커버와 3 주 동안 5% CO2 습도 셀 문화 인큐베이터에서 37 ° C에서 번호판을 품 어, 96 잘 접시 스택.
      참고: 이 시간 동안 세포 배양 매체를 변경 하지 마십시오. 열지 마십시오 인큐베이터 번 이상 주. 최상의 결과 오픈 워터 저수지와 인큐베이터에서 관찰 된다.
    6. 외피의 3 주 후 시각적으로 가벼운 현미경 검사 법 (4 배 확대)를 사용 하 여 성장된 식민지의 존재를 확인 하 고 그들은 우물의 하단에 점으로 표시 되므로 성장된 식민지와 우물을 표시 합니다.
    7. 한 96-잘 라운드-바닥판 잘 당 AB 승 RPMI의 100 µ L 준비 합니다. 부드럽게 resuspend 셀의 표시는 pipetting에 의해 잘. 이미 포함 된 RPMI AB, 승의 100 µ L 새로운 96 잘 접시의 한 잘에 세포 현 탁 액의 100 µ L를 전송 다음 pipetting으로 부드럽게 혼합 합니다. 두 번째 빈 96 잘 라운드-바닥판 접시를 중복으로이 세포 현 탁 액의 100 µ L를 전송 합니다.
    8. 계속 성장된 식민지와 모든 표시 된 우물. 모든 빈 우물을 AB 중간 승 RPMI의 200 µ L을 채우십시오. 37 ° C, 5%에서 번호판을 품 어 공동2.
      참고: 하나 이러한 접시의 단일 세포 클론 (이 하 "주식 접시")의 확장 및 다른 심사에 대 한 "중복 판"으로 될 것입니다.
  2. Cytometry 및 PCR에 의해 단일 세포 클론의 심사
    참고: 단일 셀 클론 확대는 하는 동안 화면 단일 세포 클론을 단계 3.1.8에서에서 중복 플레이트를 사용 하 여 PCR (단계 3.2.4–3.2.12)에 의해 기자 시퀀스의 존재 및 형광 기자 cytometry (단계 3.2.2–3.2.3)에 의해 표현의 (그림 3c)입니다.
    1. 24 ~ 48 시간 품 어 접시를 다시 중복 중복 접시를 보자. 이렇게 하려면 모든 잘을 AB 승 RPMI의 100 µ L을 추가 하 고 pipetting, 부드럽게 혼합 사용 하 여 멀티 채널 피펫으로 새로운 96-잘 라운드-하단 플레이트에 100 µ L를 전송. 한 접시를 사용 하 여 흐름 cytometry 심사 및 PCR 기반 심사에 대 한 다른.
    2. 교류 cytometry 심사에 대 한 PMA Iono와 세포를 자극. Ionomocin (1 m m 재고), PMA의 0.1 µ L의 0.1 µ L의 mastermix 준비 (50 µ g / µ L 주식), AB, 우물의 수 승 RPMI의 4.8 µ L 당 잘 mastermix의 5 µ L 추가.
      참고: 유도 성공적으로 클론, 어디는 LTR transcriptionally 침묵 고 형광 기자 표현 되지 따라서 식별 하는 데 필요한.
    3. 셀 24 h에 대 한 품 어 cytometry 2.3.3 단계에서 설명한 대로 셀을 준비 하자. 앞으로 측면 분산형에 크기에 따라 모든 가능한 단일 셀 게이트, cytometry로 형광 성 취재 원 유전자 발현을 분석 (예를 들어 결과 그림 3 c참조). Tv 백본 모터와 두 번째 형광 기자 포함 되어 있습니다 (예:, GFP), 또한 어떤 클론 백본 기자 식에 대 한 화면 (단계 1.2.2 및 설명에 대 한 다음 참고 참조).
      참고: 백본 기자 식 중추 시퀀스의 원치 않는 통합을 나타냅니다.
    4. 두 번째 중복 접시에 클론 충분히 성장 되 면 (대개 24 ~ 48 h 후 96 잘 접시의 중복), PCR 검사 gDNA를 포함 하는 세포 lysates 준비. 실시간 신중 하 게에서 300 x g 에서 10 분 원심 분리기는 격판덮개는 셀 펠 렛을 방해 하지 않고는 상쾌한 이륙.
      참고: 멀티 채널 펫으로 lysates의 PCR 반응 준비에 대 한 모든 단계를 수행할 수 있습니다.
    5. 부드러운 pipetting와 실시간에 300 x g 에 5 분 동안 접시 centrifuging PBS의 100 µ L로 세포를 씻어 PBS를 제거 하 고 세포의 용 해 버퍼의 200 µ L를 추가 [200 m m NaCl, 100 mM Tris HCl pH 8-8.5, 5 mM EDTA, 0.1 %SDS; 250-1000 µ g/mL 가수분해 K의 추가 (동결 건조 된 분말, 무게 갓)] 잘 당. Pipetting, 부드럽게 혼합 하 고 새로운 PCR 접시에 정지를 전송.
    6. 파라핀 영화와 함께 접시를 봉인 하 고는 thermocycler에서 55 ° C에서 1 시간에 품 어. 셀 파편, 아래로 10 분 (3000 x g) 회전에 대 한 최대 속도로 centrifuge 그리고 새로운 PCR 접시에는 상쾌한 전송.
      참고: 세포 lysates 접시에는 추가 사용까지 4 ° C에서이 단계에서 저장 될 수 있다.
    7. DH2O의 110 µ L 96 잘 PCR 접시를 준비 하 고 세포 lysate의 10 µ L를 추가 (1시 12분 희석). 세포 lysates 점성 피펫으로 하기 어려운 수 있습니다. 적어도 사용 20 µ L 피펫으로 팁.
    8. 외피는 thermocycler에 99 ° C에서 10 분에 의해 가수분해 K를 비활성화. 그 후 사 및 희석 세포 lysates를 사용 하 여 PCR 검사에 대 한.
    9. 검사 PCR (P5 및 P6) 선택한 기자 순서에 따라 500-800 bp 기자 시퀀스의 증폭을 위한 뇌관 디자인. 긍정적인 제어 PCR 위해 뇌관 p 7과 P8 630 증폭 bp는 야생-타입, 비 대상 게놈 소재 시 (NUP188 유전자)의 사용 (그림 3 c 표 5). 난다 통합 tv 백본 시퀀스 (백본 PCR)에 대 한 제어로 tv 등뼈의 500-600 bp를 증폭 하는 세 번째 뇌관 쌍을 디자인 합니다.
    10. 심사, 제어, 및 백본 PCR 사용 하 여 상업 PCR mastermix ( 테이블 6 7 PCR 재료 및 순환 조건 참조). 2 µ L 희석 하 고 불활성의 lysate 단계는 서식 파일로 3.2.8에서 준비 하 고 96 잘 형식에 PCR 확대의 38 ~ 40 사이클에 대 한 PCR을 실행을 사용 합니다.
    11. 5 µ L의 1.5 %agarose / 태 젤에 PCR 제품을 분석.
      참고: 제어 PCR, 630의 특정 밴드에 대 한 모든 샘플을 확인 하는 세포 lysates의 품질은 PCR를 위한 적절 한 혈압을 관찰 해야 합니다. PCR (뇌관 디자인에 따라 500-800 bp) 심사에서 특정 대역 기자 시퀀스의 통합을 나타냅니다. 백본 PCR (500-600 bp, 뇌관 디자인에 따라)에 대 한 특정 대역 tv 백본 시퀀스 (예를 들어 결과 그림 3 c참조)의 통합을 원치 않는 나타냅니다.
    12. Cytometry (3.2.3 단계) 및 PCR 기반 검사 (단계 3.2.12)의 결과 결합 합니다. PCR 및 긍정적인 PCR 컨트롤과 cytometry에 PMA Iono와 유도 후 형광 기자의 식 심사에 PCR 제품의 정확한 크기를 표시 하는 클론을 선택 합니다. 백본 PCR PCR 제품 또는 tv 백본 인코딩 형광 단백질, tv 백본 시퀀스의 불특정 통합을 나타내는의 식을 보여 주는 클론을 제외 합니다.
    13. 점차적으로 2 ~ 3 일 마다 신선한 매체를 추가 하 여 셀 문화 T75 플라스 크 형식 달성까지 더 큰 잘 형식 (48/24/12/6-잘) 주식 96 잘 접시에서 선택 된 클론 확장 합니다. 1 x 105 와 1 x 106 셀/mL 사이 셀 밀도 유지 합니다.
    14. 확장 중 클론의 셀 주식 준비 확인: 셀 계산, RT 5 분에 대 한 300 x g에서 원심, 상쾌한, 폐기 및 FCS + 5 x 106 셀/mL에 10 %DMSO 부드럽게 세포를 중단. 극저온 튜브 및 1 ° C/min에서 80 ° C에 세포를 동결 사용 cryo-냉동 컨테이너에 약 수. 장기 저장을 위한 액체 N2로 전송.
      참고: GDNA 남부 럽 (섹션 3.4 참조)에 의해 대상의 확인에 대 한 준비에 확장 하는 동안 T75 셀 문화 술병 (즉,, 1 x 107 셀)을 유지 하는 것이 좋습니다.
  3. 선택 된 클론에서 PCR/연속 통합 사이트의 확인
    참고: 선택 된 클론의 5'과 3' int. 접합부는 PCR 증폭 및 생어를 확인 하는 시퀀싱 수정 DNA 시퀀스 레벨에서 타겟팅.
    1. 선택 된 클론 및 상업 gDNA 추출 키트를 사용 하 여 Jurkat 야생-타입 셀 gDNA를 준비 합니다.
    2. 5' 기자와 5' 5' int. 접합 (p 1과 P2 뇌관)에 대 한 HA의 업스트림 끝과 끝 3' 기자와 2.4 단계에서 설명한 대로 3' 3' int. 접합 (P3 및 P4 뇌관)에 대 한 HA의 다운스트림 바인딩 뇌관 쌍을 사용 합니다. 프라이 머 p 1과 p 4를 사용 하 여 대상된 통합 사이트 기자 integrant (그림 4a) 없이 대립 유전자를 증폭 하는.
    3. 템플릿으로 gDNA의 100-200 ng와 PCR 반응 준비 및 교정 활동으로는 중 합 효소를 사용 하 여 PCR을 수행 ( 표 1 2 PCR 재료 및 순환 조건 참조).
      참고: 아무 밴드, 관찰 하는 경우는 사이클의 수를 증가 하거나 (예를 들어 추가 하 여 DMSO 또는 증가 양의 마그네슘2 +), PCR 버퍼를 변경 하 여 PCR 순환 상태를 변경 고려는 중 합 효소를 변경 하 여.
    4. 5 µ L의 1.5 %agarose / 태 젤에 PCR 제품을 분석. 올바른 밴드 크기를 관찰 하는 경우 상업 키트를 사용 하 여 나머지 PCR 제품을 정화 하 고 생어 제목 순서. 예상 시퀀스 정렬 하 여 5' int. 접합, 3' int. 접합, 그리고 기자 integrant 없이 대립 유전자의 타겟된 사이트의 시퀀스를 확인 합니다.
      참고: 기자는 통합 하지 동종 대립 유전자 Cas9 중재 뉴클레오티드 삽입 또는 삭제 (그림 4a) 같은 대상 사이트에서 변경 가능성이 나타납니다.
    5. 정렬 후 올바른 int. 접점 시퀀스를 보여 주는 클론에 대 한 전체 대상된 기자 증폭 PCR를 수행 하 고 생어 주제는 integrant의 정확한 순서를 확인 하는 순서.
  4. 선택 된 클론에서 대상으로의 남쪽 오 점 분석
    참고: 선택 된 클론의 남쪽 오 점 분석은 정확한 타겟팅을 확인 하 고 대상된 통합 사이트에서 발생 한 수 있습니다 Cas9 중재 재결합 이벤트를 제외 하는 데 필요한.
    1. 적절 한 gDNA 소화에 대 한 전략을 개발 하 고 실험을 시작 하기 전에 디자인을 조사.
      1. 대상된 사이트에서 2 ~ 10 kb 길이의 적절 한 조각을 생성 하 gDNA 제한에 대 한 제한 효소를 선택 합니다. Asp718, BamHI, Bgl등 특정 제한 효소 나, BglII, 에코RV, 뒷 다리III, Nco내가, 태평양 표준시나, PvuII, Sca나, 스 투, 그리고 Sst 나는 성공적으로 높은 분자량 gDNA를 소화에 대 한 사용 되었습니다.
      2. 두 개의 다른 남부 프로브 디자인: 기자 전용 프로브 및 게놈 조사. 기자 전용 프로브 기자 (즉,, tdTomato 전용 프로브) 내에서 시퀀스를 hybridizes. 게놈 프로브 (하지 중복) 하지만 가까이 게놈 영역에 hybridizes 한 하.
      3. 길이 (이상 2 kb) (그림 4b) 대상 및 비 대립 유전자에서 게놈 프로브 바인딩에서 검색 합니다 gDNA 소화에 의해 생성 된 조각 다릅니다 게놈 프로브를 선택. 프로브 길이 400 1000 bp는 것이 좋습니다.
      4. 증폭 두 필요 프로브 PCR 뇌관 디자인. 고 충실도 DNA 중 합 효소를 사용 하 여 tv 템플릿에서 기자 전용 프로브를 증폭 ( 테이블 3 4 PCR 재료 및 순환 조건 참조).
      5. 야생-타입 Jurkat gDNA DNA 중 합 효소를 사용 하 여 교정 활동와 상업 gDNA 추출 키트 준비에서 게놈 프로브를 증폭 ( 표 1 2 PCR 재료 및 순환 조건 참조). Agarose/태 젤에 PCR 제품을 정화 하 고 제조업체의 지침에 따라 상업 젤 추출 키트를 사용 하 여 조각을 추출.
    2. 야생-타입 Jurkat 세포 단계의 3.2.14 선택 된 클론의 1 x 107 셀에서 높은 분자량 gDNA를 추출 합니다.
      1. RT 5 분에 대 한 300 x g 에서 원심 분리 하 여 세포를 작은, PBS, 한 번 그것을 씻어 하 고 세포의 용 해 버퍼의 4 mL에 펠 릿을 일시 중단 [200 m m NaCL, 100 mM Tris HCl pH 8, 5 mM EDTA, 0.1 %SDS; 다음 250-1000 µ g/mL 가수분해 K (동결 건조 된 분말을 추가 갓 무게)]. O/n 탁상 thermomixer에서 350 rpm에서 떨고 55 ° c를 품 어.
      2. 소 프로 파 놀의 4 mL를 추가 하 고 10 ~ 20 배 변환에 의해 혼합. gDNA 흰색 침전으로 표시 될 것입니다. 유리 피 펫의 정밀한 끝에 침전 된 gDNA를 스풀, 신흥 70 %EtOH의 750 µ L에서 RT (5 ~ 10 분)에서 건조 하 여 세척.
      3. 1 x 테 버퍼 (10 mM Tris HCl pH 8.0, 1 mM EDTA)의 500 µ L을 포함 하는 1.5 mL 반응 관에 침전을 흘리 고 o/n 350 rpm에서 떨고 4 ° C에서 분해를 떠나. 어떤의이 단계에서 gDNA pipetting 넓은 구멍 팁을 기울이기 피하기 위해 행해져야 한다.
        참고: 높은 분자량 gDNA의 준비 남쪽 오 점 분석을 위해 필수적 이며 상용 gDNA 준비 키트 적합 하지 않습니다.
    3. 선택 된 클론 및 선택한 제한 효소와 야생-타입 Jurkat 세포 gDNA의 다이제스트 (두 번) 15 µ g (단계 3.4.1.1 참조) 효소 (20 단위 / µ L)의 6 µ L와 함께 60 µ L 반응: 첫째, DNA, 추가 소화 버퍼, 그리고 ddH2O, 품 어 o/n 37 ° C에서 다음 효소를 추가 하 고 o/n 소화 효소 특정 온도에서 품 어. 소화 gDNA의 15 ug는 남부 조사 당 필요 합니다.
    4. 60 µ L 제한 다이제스트의 7 µ L를 사용 하 여 분석 젤 전기 이동 법 1 %agarose / 태 젤에 대 한. 얼룩 완전 한 소화 남쪽 오 점 분석에 대 한 좋은 DNA 품질을 나타냅니다.
    5. 1시 10분 추가 하 여 나머지 제한 다이제스트 침전 3 M 나트륨 아세테이트 및 2 볼륨 100 %EtOH, 다음-80 ° C 원심 분리기에서 4 ° c.에 15,600 x g 30 분에서 1 시간에 품 어
    6. 삭제는 상쾌한 고 70%와 펠 릿을 세척 EtOH. Centrifuge 15,600 x g 4 ° C에서 15 분, 삭제는 상쾌한, RT에 잠시 건조 하 고 ddH2오 20 µ L에 용 해 펠 릿
    7. 1 %agarose / 태 더 럽 히 젤, 레인 당 소화 gDNA의 20 uL 로드를 실행 합니다. 60 V, 400에서 2 h 젤 실행 mA.
      참고: Agarose 젤 및 실행 시간/전압의 비율은 남부 오 탐지 단계 3.4.1.1에서에서 계산에 대 한 예상된 조각 크기에 따라 조정 될 수 있습니다. 남쪽 오 점 분석의 다음 단계는 보조 프로토콜 (단계 1 ~ 18)에 자세히 설명 되어 있습니다. 구성 하는 다음이 단계: 나일론 막, 방사성 조사 생성, 프로브 교 잡, 및 autoradiograph 필름의 개발에 럽 더 럽 히 젤의 세척. 단계 18 (보충 프로토콜) 남부 전략에 따르면 예상된 패턴에서에서 autoradiograph 개발 후 얻은 밴딩 패턴 비교 (예를 들어 결과, 그림 4b참조).
  5. 대상에서 이벤트의 분석
    참고: CRISPR Cas9 중재 하는 유전자 공학에서 대상 효과, 최고 순위 10 PCR 증폭 에 철을 생성할 수 있습니다 이후-오프 대상 사이트에 클론을 선택 하 고 생어에 대상 예측 연속.
    1. CCTop16 (http://crispr.cos.uni-heidelberg.de)를 사용 하 여 높은 순위가 10의 목록을 생성 철에 오프 대상 시퀀스 예측.
      1. PAM 쿼리 시퀀스도 대상에 대 한 사용을 포함 하 여 gRNA 시퀀스를 입력 합니다. 대상에서 예측에 대 한 참조로 "NGG" 팸과 "인간 게놈"를 선택 합니다.
      2. 최대 총 불일치 "4" 및 대상 설정 사이트 팸 없이 gRNA의 길이에 길이. 출력 파일 각각 gRNA 게놈에서 대상 사이트의 순위 목록을 제공 합니다.
    2. 철에 게놈 시퀀스 500 bp을 업스트림과 다운스트림 10 높은 순위에서 대상 안타 UCSC 게놈 브라우저 (http://genome.edu.ucsc.edu) 및 오프-대상의 CCTop 결과 목록에서 충돌 위치를 사용 하 여 각각의 압축을 풉니다.
    3. 각 분석 대상 사이트에서 PCR 뇌관 쌍을 디자인 600에서 700의 조각을 증폭 bp 길이 예측된 대상 오프 사이트를 포함 하 여.
    4. 선택 된 클론 및 상업 gDNA 추출 키트를 사용 하 여 Jurkat 야생-타입 셀에서 gDNA를 추출 합니다. 모든 오프 대상 사이트에 대 한 교정 활동와 DNA 중 합 효소를 사용 하 여 PCR을 수행 ( 표 1 2 PCR 재료와 순환 조건에 대 한 참조) 야생-타입 및 각 복제 파생 gDNA.
    5. 5 µ L의 1.5 %agarose / 태 젤에 PCR 제품을 분석. 올바른 밴드 크기를 관찰 하는 경우 상업 PCR 정화 키트를 사용 하 여 나머지 PCR 제품을 정화 하 고 생어 제목 순서. Jurkat 세포에서 오프 대상 사이트와 타겟된 클론의 시퀀스를 비교 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

대표적인 실험에서 LTR, tdTomato 코딩 순서, 및17의 BACH2 유전자 intron 5 두 loci polyA 신호 시퀀스의 구성 된 최소한의 HIV-1 파생 기자를 대상으로 선택 했습니다. 대상에 대 한 loci HIV 감염 환자2,,45,6, 기본 T 세포에 다른 연구에서 발견 된 재발 통합 사이트에 근접에 따라 선정 됐다 7,8 과 팸 모티브 NGG 더블-스트랜드 나누기의 Cas9 중재 유도에 필요한 존재. 대상 벡터 생성 되었고 설명된 프로토콜에 따라 페. Transfection에 대 한 워크플로 이벤트 대상에 대 한 검사, 단일 세포 클론 및 심사의 세대와 클론의 선택은 개요로 1에 표시 된 그림.

FACS-농축 transfected 세포의 후 2 주 PMA Iono 유도 후 취재 원 유전자 발현 cytometry 통합 사이트 (데이터 표시 되지 않음)에 따라 셀의 4 ~ 12%와 5' 전체를 망라 하는 genomic DNA에서 PCR 제품에 의해 감지 수 있었습니다. 그리고 3'의 3' 기자로 하의 5' 하 기자 시퀀스와 다운스트림 업스트림에서 통합 접합 순서, 각각 (그림 3a3b). 데는 발생 한 이벤트를 대상으로 확인, 우리 희석 도금을 제한 하 여 단일 세포 클론을 생성 하 갔다. 우리 손에 도금 구조를 대상으로 당 10 96 잘 접시를 5 성공적인 스크린에 대 한 충분 한 클론을 얻기 위해 충분 했다. 프로토콜 (3.2 단원), 그것은 중복된 96-웰 스에 단일 세포 클론의 심사를 수행 하는 방법을 설명 합니다. 이와 관련, 유일한 긍정적인 클론 해야 합니다 확대는 저장 시간 및 노력. 그림 3 c, PMA Iono 유도 및 PCR 검사 후 FACS-상영의 예제 데이터가 표시 됩니다. 우리는 높은, 낮은, 그리고 더 형광 성 취재 원 유전자 발현 (그림 3c)와 클론의 수를 관찰. PCR 검사에 대 한 PCR 증폭 하는 세포 lysates의 품질 PCR에 대 한 충분 한 인지 확인 하는 선택의 게놈 소재 시는 컨트롤을 포함 하도록 중요 하다. 우리의 경우, 우리는 선택 제어 PCR 위한 NUP188 유전자 소재 시에 630 bp 시퀀스 (뇌관 순서 표 5참조). PCR 검사를 위한 뇌관 다음 기자에 위치한 짧은 시퀀스를 증폭 하도록 설계 되었습니다. 또한, 대상 벡터 등뼈에 시퀀스에 대 한 PCR 제외 대상 벡터 백본 시퀀스 (백본 PCR, 데이터 표시 되지 않음)를 통합 했다 unspecifically 모든 클론을 수행 되었다.

미리 선택 된 클론 다음 확장 되었고 더욱더 정확한 타겟팅 남쪽 오 점 및 PCR 및 시퀀싱에 대 한 분석. 남부 오 기자 밖에 하지만 대상 벡터의 상 동 팔 내 genomic 소재 시 바인딩에 대 한 기자 전용 프로브 및 프로브 특정를 사용 하 여 수행 되었다. 흥미롭게도, 남부 오에 의해 테스트 모든 클론 미리, PCR 검사에서 긍정 했다 하지만 일부만 남쪽 오 점 분석에 올바른 밴드 크기를 보였다 heterozygously 기자 (그림 4b)를 통합 했다. 그것은 그러므로 PCR 결과 심사에 의존 뿐만 아니라 또한 남부 blotting에 의해 정확한 타겟팅을 확인 하는 데 필요한입니다. DNA 시퀀스 수준에서 정확한 타겟팅을 확인 하려면 통합 접합 PCR에 의해 증폭 되었다 고 제품 생어 시퀀싱 (그림 4a) 대상이 됐다. 특히, 대상 사이트 동종 대립 유전자의, 어디 기자 통합 되지 했다, 시퀀싱 Cas9 중재 변화를 밝혔다. 그림 4a, Cas9 중재 삭제에 대 한 예제에 표시 됩니다. Cas9 중재 대상 오프 효과 테스트 하려면 3.5 섹션에 설명 된 대로 높은 순위에서 대상 사이트의 목록이 생성 되었습니다. 10 가장 높은 순위에서 대상 사이트는 클론의 genomic DNA에서 PCR 증폭 되었고 제품 대상이 생어 시퀀싱. 생성 대상된 단일 셀 클론, Jurkat 야생-타입 시퀀스에서 아무 변화가 10 높은 순위에서 대상 사이트에서 관찰 되었다.

Figure 3
그림 3: 이벤트를 대상으로 단일 셀 클론의 심사. () 뇌관의 회로도 디자인 혼합된 타겟된 세포 인구에서 PCR에 의해 이벤트 대상의 검출에 대 한. 5' 통합 접점 (P1, P2)과 3' 통합 접점 (P3, P4)의 탐지를 위한 뇌관 쌍 화살표로 표시 됩니다. 뇌관 P1 및 p 4 또한 증폭 봉사 기자 integrant (b) 혼합된 대상된 셀의 Genomic DNA 없이 대립 유전자의 표적으로 로커 스 transfected 세포의 FACS 농축 후 10 일 준비 되었고 5' 통합 접합 (P1, p 2에 대 한 분석 ), 3' 통합 접점 (P3, P4, 데이터 표시 되지 않음)과 대상된 로커 스 (P1, P4)의 야생 형 대립 유전자. 야생-타입 Jurkat 세포 (wt) 제어로 제공. (c) 96 잘 접시에 단일 세포 클론의 첫 화면. 단일 셀 클론 96 잘 접시 PMA Iono 유도 및 PCR 분석 후 cytometry에 의해 올바른 대상에 대 한 상영 했다. 결과 예 클론 표시 됩니다. PCR 기자 전용 프라이 머 (검사 PCR; 세포 lysates에 수행 되었다 P5, P6) 및 뇌관 genomic 소재 시 증폭 (PCR, 여기 제어: 로커 스 NUP188; P7, P8)입니다. 세포 lysates 야생-타입 Jurkat 세포 (wt)의 HIVisB2에서 게놈 DNA 복제 (B2)18 PCR 및 제어 PCR, 긍정적인 제어를 각각 심사에 대 한 부정적인 제어를 역임 상용 키트와 함께 준비 하 고. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: 올바른 기자 통합에 대 한 선택 된 단일 세포 클론의 분석. () 통합 접합 및 기자 integrant 없이 대립 유전자에 타겟된 로커 스의 순서 분석. 뇌관 쌍 검출을 위한 5' 통합 접점 (P1, P2), 3' 통합 접합 (P3, P4)과 기자 integrant 없이 대립 유전자의 표적으로 로커 스의 (P1, P4) 사용 되었다. PCR 제품 단일 세포 클론의 genomic DNA에서 증폭 되었고 생어 대상이 연속. 시퀀싱 결과 예상된 시퀀스를 정렬 했다. 한 복제의 예제 데이터입니다. 게놈/HA 접점과 HA/기자 접점에서 시퀀스 chromatograms 5'과 3' 통합 연결에 대 한 표시 됩니다. 일치 점 들으로 표시 됩니다. GRNA의 바인딩 사이트 상자에 표시 됩니다. Cas9 유도 된 돌연변이 빨간색으로 강조 표시 됩니다. 뇌관 디자인의 회로도 다음과 같습니다. 화살표는 증폭에 사용 되는 뇌관 위치를 나타냅니다. (b) 선택한 대상된 단일 셀 클론과 Jurkat 야생-타입 셀의 남쪽 오 점 분석. 남쪽 오 점 분석 기자 전용 프로브와 대상 및 야생 형 대립 유전자 (게놈 조사)에서 게놈 시퀀스를 인식 하는 프로브 genomic DNA에 실행 되었다. 7 예제 클론의 데이터가 표시 됩니다. 클론 올바른 밴드 크기 상자에 표시 됩니다. 희석된 대상 벡터 플라스 미드는 긍정적인 컨트롤 (+) 역임. 남쪽 오 점 분석에 대 한 개략도 다음과 같습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

시 약 반응 당 추가
뇌관을 전달 (20 µ M) 1 Μ L
반전 뇌관 (20 µ M) 1 Μ L
Taq 버퍼 x 10 5 Μ L
1 µ L dNTPs (2.5 m m 각) 1 Μ L
MgCl (50mm) 1 Μ L
DMSO 1.5 Μ L
gDNA (50-100 ng / µ L) 2 Μ L
Nuclease 무료 물 채우기 최대 49.5 µ L
Taq DNA 중 합 효소 (5 U/mL) 0.5 Μ L
반응 볼륨 50 Μ L

표 1: 교정 활동으로는 중 합 효소를 사용 하 여 PCR에 대 한 제조 법. PCR 반응 당 추가 시 각 약의 양을 표시 됩니다. PCR 증폭 템플릿으로 게놈 DNA를 사용 하 여 위한 것입니다. 제조 법 단계 1.2.2.2 (상 동 팔의 증폭), 단계 3.3.3 (통합 사이트의 확인), 3.4.1.5 (남쪽 오 점에 대 한 게놈 조사의 세대), 단계와 단계 3.5.4 (오프 대상 이벤트의 분석)에서 사용 됩니다.

단계 온도 시간 사이클
초기 변성 95 ° C 2 분 1
변성 95 ° C 40 s 30-35
어 닐 링 58 ° C 45 s
확장 72 ° C 1 분/kb
마지막 확장 72 ° C 10 분 1

표 2: 교정 활동으로는 중 합 효소를 사용 하 여 PCR 순환 조건. 사이클링 조건 표 1에 나열 된 PCR 조리법에 해당 합니다.

시 약 반응 당 추가
뇌관을 전달 (20 µ M) 1 Μ L
반전 뇌관 (20 µ M) 1 Μ L
높은 충실도 버퍼 x 5 5 Μ L
1 µ L dNTPs (2.5 m m 각) 1 Μ L
gDNA (50-100 ng / µ L) 또는 플라스 미드 DNA (50 ng / µ L) 2 µ L gDNA 또는
1 µ L 플라스 미드 DNA
Nuclease 무료 물 채우기 최대 49.5 µ L
고 충실도 DNA 중 합 효소 0.5 Μ L
반응 볼륨 50 Μ L

표 3: 높은 중 합 효소를 사용 하 여 PCR에 대 한 제조 법. PCR 반응 당 추가 시 각 약의 양을 표시 됩니다. PCR는 DNA 템플렛의 강력한 확대를 위한 것입니다. 제조 법은 2.4.2 (대상 이벤트의 검출) 단계와 단계 3.4.1.4 (기자 전용 프로브의 남쪽 오 점 세대)에 사용 됩니다.

단계 온도 시간 사이클
초기 변성 98 ° C 30 s 1
변성 98 ° C 10 s 30-35
어 닐 링 58 ° C 30 s
확장 72 ° C 30 s/kb
마지막 확장 72 ° C 10 분 1

표 4: 높은 중 합 효소를 사용 하 여 PCR 순환 조건. 사이클링 조건 표 3에 나열 된 PCR 조리법에 해당 합니다.

뇌관 시퀀스 (5'-3')
P7 제어 PCR F CTTTGTTGGGTAAGCATGGAGGTC
P8 제어 PCR R CAGTTACTCACCTTTGCACATAGG

표 5: Oligonucleotide 시퀀스 제어 PCR 위한. NUP188 소재 시의 630 bp 파편의 확대에 대 한 정방향 및 역방향 뇌관 표시 됩니다.

시 약 반응 당 추가
준비-사용 PCR 마스터 믹스 8 Μ L
뇌관을 전달 (20 µ M) 1 Μ L
반전 뇌관 (20 µ M) 1 Μ L
Nuclease 무료 물 8 µ l
세포 lysate (1시 12분 희석) 2 Μ L
총 반응 볼륨 20 Μ L

표 6: PCR 검사에 대 한 제조 법. PCR 반응 당 추가 시 각 약의 양을 표시 됩니다. PCR 제조 법 단계 3.2.11에서에서 PCR 검사 위한 것입니다.

단계 온도 시간 사이클
사전-PCR 변성 94 ° C 2 분 1
어 닐 링 58 ° C 1 분
확장 72 ° C 1 분
변성 94 ° C 30 s 38
어 닐 링 58 ° C 30 s
확장 72 ° C 1 분
마지막 확장 72 ° C 10 분 1

표 7: 심사-PCR 순환 조건. PCR 제조 법에 나열 된에 해당 하는 자전거 조건 표 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

여기, 우리가 선택한 proviral 통합 사이트 CRISPR-Cas9-기반 게놈 엔지니어링 적용 HIV 1 파생 Jurkat 기자 모델을 생성 하는 프로토콜을 설명 합니다.

프로토콜의 몇 가지 포인트는 계획 단계에서 주의 필요합니다. 첫째, 타겟이 될 장소 선택 해야 신중 하 게, 일부 loci 대상에 다른 사람 보다 쉽게 될 수 있습니다 (예:, 지역 및 대상의 염색 질 상태에 따라 자체 순서). 반복 시퀀스 대상 벡터에 복제 어렵다 고 게놈 내에서 고유 자주 없습니다. 억압 적인 chromatin의 영역은 더 CRISPR-Cas9 시스템19,20대상입니다.

둘째, gRNA의 CRISPR Cas9 중재 하는 대상에 대 한 결정적 이다. 대표적인 통합 사이트와 HIV 감염에 대 한 모델을 생성 하기 위해 하나는 통합 핫스팟 최대한 가까이 바인딩할 gRNA를 원하는 것 이다. 그러나,이 사이트 수 있습니다 적합 하지 않을 Cas9 모집; 따라서, 선택 및 gRNA 품질의 통합 사이트에 gRNA 시퀀스의 근접 사이 타협 하셔야 합니다. 우리는 예측 기능 gRNAs에 신뢰할 수 있는 E-선명 webtool 발견. 그것은 또한 gRNA 사전 테스트 대상, 돌연변이 대 한 심사 뒤 셀 형식에 Cas9 함께 여러 gRNAs를 뚜렷이 표현 하 여 수행 가능. 적당 한 gRNA는 대상 사이트에 Cas9를 효율적으로 직접 것입니다 그리고 gRNA 무료 사이트 돌연변이 표시 됩니다. 길이 (1000 bp 업스트림과 다운스트림 통합 사이트의) 이전 출판된 연구11에 선정 되었다. 일반적으로, 상 동 팔의 길이 줄이는 감소 대상 주파수 발생 합니다. 1000의 길이 상 동 팔의 혈압 충분 한 대상 주파수와 대상 벡터 건설의 용이성 사이 좋은 타협을 선물 한다.

셋째, 충분 한 시간 기자 구문의 좋은 디자인에 지출 해야 합니다. 포함 한 HIV-1 NL4-3이이 프로토콜에 사용 되는 최소한의 기자 파생 LTR와 코딩 시퀀스 tdTomato, 다음과 같은 원칙에 따라 설계 되었다: 단일 LTRs 전적으로 설명 되었습니다 클론의 여러 경우에 proviral 조각 남은 만 성으로 HIV 1 감염 개인21에 확장. 그는 LTR 강하게 영향 통합 사이트에서 chromatin 상태 이며 세포 단지의 모집 조직으로 예상 된다. 우리 최소한의 HIV 기자 주요 규제 유전 요소, HIV LTR에 초점을 맞추고 선택 다음 게놈 엔지니어링 주파수와 높은 작은 이기 위하여 보고 되었다 tdTomato 더 에이즈-1 유전자 대신 형광 LTR 활동 표식으로 도입 타겟팅11을삽입합니다. Tv 복제, 클론 선택, 심사, 그리고 클론의 확인의 시간이 많이 걸리는 단계를 고려 하 고 신중 하 게 타겟 HIV 기자 결국에 실시 됩니다 기능 연구의 맥락에서의 디자인을 고려 하도록 조언 된다 셀 라인입니다. 하나, 예를 들어 개 그 리더 시퀀스, 3' 에이즈 LTR, 및 다른 바이러스 성 유전자 시퀀스 기자에 포함을 고려 하십시오. 프로토콜 같은 다른 기자 구문에 쉽게 적용할 수 있습니다.

일반적으로, 그것은 단일 셀 클론 생성 특정 셀 라인 수로 타겟이 될 셀 형식의 선택을 고려 하는 것이 중요. 우리가 발견 Jurkat 세포는 매우 효율적인 단일 클론 세대; 그러나, 우리는 잠재 HIV 감염 모델9에 그것의 이전에 알려진된 사용에 대 한이 셀 유형을 선택 하기로 결정 했습니다. 우리 때 접시를 일주일에 3 번 열었을 인큐베이터에 그대로 남았다 50% 조절 매체, Jurkat 클론 희석 도금에서 최상의 결과 얻을. 다른 셀 라인을 사용 하 여 원하는 경우 미리 희석 도금 실험을 수행 하 여 단일 세포 클론 생성의 가능성을 테스트 하는 것이 좋습니다. 또 다른 점은 마음에 계속 다른 세포의 transfection 속도의 변화 이다. Transfection 선택한 셀 라인에 대 한 가능한 경우, electroporating 셀 대상에 대 한 필요할 수 있습니다. 메모는 셀 선 대상에 대 한 사용의 선택 하지 결정 될 수 있습니다만, 기술적인 측면에 의해 transfection 또는 단일 클론 세대에 대 한 효율 등. 기능적 측면 또한 고려 될지도 모른다, transcriptional 활동 등 대상된 유전자 소재 시의 inducibility. 이 대상 워크플로 전에 다른 셀 라인의 심사를 요구할 수 있습니다.

그것은 설명된 프로토콜은 시간 많이 사용을 강조 한다. 그것은 최종 클론 세포 라인에 첫 번째 단계에서 3 ~ 6 개월을 예상 한다. 사이트별 단일 통합 이벤트에 대 한 확인에 사용 되는 남쪽 오 점 분석 처럼 보일 수 있습니다 성가신, 하지만 우리의 경험에서 매우 중요 한-는 예상된 통합 단일 세포 클론의 하위 집합만 PCR 당 접합 보여주면서는 남쪽 오 점에 패턴을 수정 합니다. 이상적으로, 경험 같은 통합 사이트에 클론 효과 대 한 제어를 대상으로 동일한 삽입과 클론의 수를 생성 해야 하는 후속 실험 클론의 사용. 그것은 heterozygous homozygous 타겟팅 뿐만 아니라 할 수 있습니다. Heterozygous 기자 셀 라인에는 integrant 없이 대립 유전자 PCR (그림 4a)에 의해 검사 될 수 있는 사이트를 대상으로 Cas9에서 수정 표시 것입니다. Homozygous 대상에 대 한 두 대립 유전자는 연속적으로 타겟팅 하는 것이 좋습니다.

이러한 고려 사항 고려,이 워크플로 만성 HIV 감염의 이해를 증가 하는 데 사용할 수 있는 강력한 세포 모델을 생성 하는 수단을 제공 합니다. 예를 들어 대기 시간 반전 에이전트에 대 한 응답에서 proviral 활동 재발 통합 사이트의 맥락에서 테스트할 수 있습니다. 이 위치 효과 HIV 대기 시간 및 반전22영향을 가정 되는 필드에 연구원에 게 특정 관심의 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

우리 기술 지원 Britta Weseloh와 베티 아벨 감사합니다. 우리 또한 감사 아르네 두 제 다우와 Jana Hennesen (교류 cytometry 기술 플랫폼, 하인리히 Pette Institut) 기술 지원.

Materials

Name Company Catalog Number Comments
pX330-U6-Chimeric_BB-cBh-hSpCas9 Addgene 42230 vector for expression of SpCas9 and gRNA
pMK GeneArt mammalian expression vector for cloning
cDNA3.1 Invitrogen V79020 mammalian expression vector for cloning
BbsI New England Biolabs R0539S restriction enzyme
NEBuilder Hifi DNA Assembly Cloning Kit New England Biolabs E5520S Assembly cloning kit used for target vector generation
TaqPlus Precision PCR System Agilent Technologies 600210 DNA polymerase with proofreading activity used for amplification of homology arms (step 1.2.2.2), verification of integration site and reporter sequence (step 3.3.3 and 3.3.5), generation of genomic probe for Southern blot (step 3.4.1.5) and analysis of off-target events (step 3.5.4)
96-well tissue culture plate (round-bottom) TPP 92097 tissue culture plates for dilution plating
Phusion High-Fidelity DNA polymerase New England Biolabs M0530 L DNA polymerase used for detection of targeting events (step 2.4.2) and generation ofreporter-specific probe for Southern blot (step 3.4.1.4)
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D9170 dimethyl sulfoxide as PCR additive
Magnesium Chloride (MgCl2) Solution New England Biolabs B9021S MgCl2 solution as PCR additive
Deoxynucleotide (dNTP) Solution Mix New England Biolabs N0447S dNTP mixture with 10 mM of each nt for PCR reactions
5PRIME HotMasterMix 5PRIME 2200400 ready-to-use PCR mix used for screening PCR (step 3.2.11)
QIAamp DNA blood mini kit Qiagen 51106 DNA isolation and purification kit
QIAquick PCR Purification Kit Qiagen 28106 PCR Purification Kit
RPMI 1640 without glutamine Lonza BE12-167F cell culture medium
Fetal Bovine Serum South Africa Charge PAN Biotech P123002 cell culture medium supplement
L-glutamine Biochrom K 0282 cell culture medium supplement
Penicillin/Streptomycin 10.000 U/mL/ 10.000 µg/mL Biochrom A 2212 cell culture medium supplement
Gibco Opti-MEM Reduced Serum Media Thermo Fisher Scientific 31985062 cell culture medium with reduced serum concentration optimized for transfection
TransIT-Jurkat Mirus Bio MIR2125 transfection reagent
phorbol 12-myristate 13-acetate Sigma-Aldrich P8139-1MG cell culture reagent
Ionomycin Sigma-Aldrich I0634-1MG cell culture reagent
Syringe-driven filter unit, PES membrane, 0,22 µm Millex SLGP033RB filter unit for sterile filtration
Heracell 150i incubator Thermo Fisher Scientific 51026280 tissue culture incubator
Amershan Hybond-N+ GE Healthcare RPN1520B positively charged nylon membrane for DNA and RNA blotting
Stratalinker 1800 Stratagene 400072 UV crosslinker
High Prime Roche 11585592001 kit for labeling of DNA with radioactive dCTP using random oligonucleotides as primers
illustra ProbeQuant G-50 Micro Columns GE Healthcare 28-9034-08 chromatography spin-columns for purification of labeled DNA

DOWNLOAD MATERIALS LIST

References

  1. Hughes, S. H., Coffin, J. M. What Integration Sites Tell Us about HIV Persistence. Cell Host and Microbe. 19, (5), 588-598 (2016).
  2. Marini, B., Kertesz-Farkas, A., et al. Nuclear architecture dictates HIV-1 integration site selection. Nature. 521, (7551), 227-231 (2015).
  3. Cesana, D., Santoni de Sio, F. R., et al. HIV-1-mediated insertional activation of STAT5B and BACH2 trigger viral reservoir in T regulatory cells. Nature Communications. 8, (1), 498 (2017).
  4. Cohn, L. B., Silva, I. T., et al. HIV-1 Integration Landscape during Latent and Active Infection. Cell. 160, (3), 420-432 (2015).
  5. Han, Y., Lassen, K., et al. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. Journal of Virology. 78, (12), 6122-6133 (2004).
  6. Ikeda, T., Shibata, J., Yoshimura, K., Koito, A., Matsushita, S. Recurrent HIV-1 integration at the BACH2 locus in resting CD4+ T cell populations during effective highly active antiretroviral therapy. The Journal of Infectious Diseases. 195, (5), 716-725 (2007).
  7. Wagner, T. A., Mclaughlin, S., et al. Proliferation of cells with HIV integrated into cancer genes contributes to persistent infection. Science. 345, (6196), 570-573 (2014).
  8. Maldarelli, F., Wu, X., et al. Specific HIV integration sites are linked to clonal expansion and persistence of infected cells. Science. 345, (6193), 179-183 (2014).
  9. Jordan, A., Bisgrove, D., Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. The EMBO Journal. 22, (8), 1868-1877 (2003).
  10. Mack, K. D., Jin, X., et al. HIV insertions within and proximal to host cell genes are a common finding in tissues containing high levels of HIV DNA and macrophage-associated p24 antigen expression. Journal of Acquired Immune Deficiency Syndromes. 33, (3), 308-320 (2003).
  11. Byrne, S. M., Ortiz, L., Mali, P., Aach, J., Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research. 43, (3), 1-12 (2014).
  12. ZhangLab. CRISPR Genome Engineering Toolbox: Target Sequence Cloning Protocol. Addgene website. Available from: https://www.addgene.org/static/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf (2013).
  13. Moser, F. Addgene. Gibson Assembly Protocol. Addgene website. Available from: https://www.addgene.org/protocols/gibson-assembly/ (2009).
  14. Addgene Plasmid Cloning by PCR. Addgene website. Available from: https://www.addgene.org/protocols/pcr-cloning/ (2014).
  15. Addgene Plasmid Cloning by Restriction Enzyme Digest (aka Subcloning). Addgene website. Available from: https://www.addgene.org/protocols/subcloning/ (2013).
  16. Stemmer, M., Thumberger, T., Del Sol Keyer, M., Wittbrodt, J., Mateo, J. L. CCTop: An intuitive, flexible and reliable CRISPR-Cas9 target prediction tool. Public Library of Science (PLoS) ONE. 10, (4), (2015).
  17. Lange, U. C., Bialek, J. K., Walther, T., Hauber, J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Research. 249, (2018).
  18. Bialek, J. K., Dunay, G. A., et al. Targeted HIV-1 Latency Reversal Using CRISPR-Cas9-Derived Transcriptional Activator Systems. PloS ONE. 11, (6), e0158294 (2016).
  19. Lee, C. M., Davis, T. H., Bao, G. Examination of CRISPR-Cas9 design tools and the effect of target site accessibility on Cas9 activity. Experimental Physiology. 103, (4), 456-460 (2018).
  20. Jensen, K. T., Fløe, L., et al. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Letters. 591, (13), 1892-1901 (2017).
  21. Simonetti, F. R., Sobolewski, M. D., et al. Clonally expanded CD4 + T cells can produce infectious HIV-1 in vivo. Proceedings of the National Academy of Sciences. 113, (7), 1883-1888 (2016).
  22. Chen, H. C., Martinez, J. P., Zorita, E., Meyerhans, A., Filion, G. J. Position effects influence HIV latency reversal. Nature Structural and Molecular Biology. 24, (1), 47-54 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics