Парамиксовирусы для ориентированных на опухоль иммуномодуляция: дизайн и оценке Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Этот протокол описывает подробный рабочий процесс для поколения и ex vivo характеристика онколитического вирусов для выражения иммуномодуляторов, используя вирусы Кори кодирования bispecific Т-клеток Ингейджер качестве примера. Применение и адаптация для других платформ вектор и трансгенов будет ускорить разработку Роман immunovirotherapeutics для клинических перевода.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Успешное Рак иммунотерапия имеет потенциал для достижения долгосрочного управления опухоли. Несмотря на недавние успехи клинической сохраняется настоятельная необходимость для безопасного и эффективного лечения, с учетом индивидуального тумора иммунной профилей. Онколитического вирусов позволяют индукции противоопухолевого иммунного ответа, а также экспрессии генов, опухоль ограничена. Этот протокол описывает поколения и ex vivo анализ иммуномодулирующих онколитического векторов. Сосредоточение внимания на вирусы вакцины кори кодирования bispecific Т-клеток Ингейджер качестве примера, Общая методология может быть адаптирована для других видов вирусов и трансгенов. Представлен рабочий процесс включает в себя дизайн, клонирование, спасения и распространение рекомбинантных вирусов. Анализы для анализа кинетики репликации и литические деятельность вектора, а также функциональных возможностей изолированных иммуномодулятора ex vivo включены, способствуя тем самым поколения Роман агентов для дальнейшего развития в доклинических моделях и в конечном счете Клинические перевод.

Introduction

Онколитического вирусы (ОВС) разрабатываются как против рака терапии, что конкретно реплицировать в пределах и убить опухолевые клетки, оставляя нетронутыми здоровые ткани. Это сейчас стало общее понимание что онколитического Виротерапии (ОВТ), в большинстве случаев, не полагаться исключительно на распад опухоли полной эффективности репликации и распространение вируса, но требует дополнительных механизмов действий, для успеха лечения, включая сосудистой и стромальных ориентации и, главное, стимуляции иммунной1,2,3,4. Хотя многие ранние исследования ов используется неизмененное вирусов, текущие исследования выгоду от улучшения биологических, понимание, вирус биобанках, что потенциально содержат Роман OVs и возможности, предоставляемые генной инженерии для создания передовых OV платформы5,6,7.

Учитывая недавний успех иммунотерапия, иммуномодулирующих трансгенов представляют особый интерес о генной инженерии OVs. Целевые выражение такого гена продукции OV-инфицированных опухолевых клеток снижает токсичность, по сравнению с системного администрирования. Таргетинг достигается с помощью вирусов с присущие oncoselectivity или изменяя вирусный тропизм8. Местные иммуномодуляция повышает многогранный механизмы противоопухолевого ОВТ. Кроме того эта стратегия играет важную роль в опрашивания взаимодействие между вирусов, опухолевых клеток и иммунной системе хоста. С этой целью этот протокол обеспечивает применимым и регулируемый рабочий процесс проектирования, клонировать, спасение, распространять и проверить онколитического парамиксовирус (специально вирус кори) векторы кодирования такие трансгенов.

Модуляции иммунного ответа может быть достигнуто путем широкий спектр продукции трансген, ориентация различные этапы рака иммунитет цикла9, включая укрепление опухолевые антигены [например, опухольассоциированных антигенов (ТААС) или индукторов из комплекс гистосовместимости (MHC) сорта молекул] над поддержкой дендритные клетки созревания для презентации эффективного антигена (цитокинов); Рекрутинг и такие как активация желаемого иммунные клетки цитотоксическим и вспомогательные Т-клеток [chemokines, bispecific Ингейджер Т-клеток (BTEs)]; ориентация подавляющие клетки, такие как регулирования T-клетки, клетки миелоидного производные супрессор, связанный тумором макрофагов и связанных рака фибробластов (антител, BTEs, цитокинов); и предотвращение эффекторных клеток торможение и истощения (ингибиторы контрольно-пропускного пункта). Таким образом имеется множество биологических агентов. Оценка таких вирусов кодировке иммуномодуляторов о терапевтической эффективности и возможного синергизма, а также понимания соответствующих механизмов необходимо усовершенствовать терапии рака.

Негативном смысле одноцепочечной РНК-вирусов Paramyxoviridae семьи были характерны несколько функций способствуют их использования как онколитического векторов. К ним относятся природные oncotropism, большой геномной емкости для трансгенов (более 5 КБ)10,11, эффективного распространения, включая syncytia формирования и высокую иммуногенность12. Таким образом OV платформы, основанные на плотоядных вирус13, паротита вирус14, вирус болезни Ньюкасла15, Сэндай вирус16,17, обезьяний вирус 518и Tupaia парамиксовирус19 были разработаны. Наиболее заметно живой аттенуированной вакцины от кори вирус вакцины штаммов (MV) продвинулись в доклинической и клинической разработки20,21. Эти штаммы вируса были использованы на протяжении десятилетий для плановой иммунизации с отличным безопасности записи22. Кроме того нет никакого риска для инсерционному мутагенезу благодаря строго цитозольной репликации парамиксовирусы. Универсальный обратной генетики система, основанная на анти геномной cDNA, который позволяет для вставки трансгенов в дополнительных транскрипции единиц (АТУС) является наличие11,23,24. MV векторов кодирования Симпорт йодистого натрия (MV-ННГ) для изображений и радиотерапии или растворимые раковоэмбрионального антиген (MV-Сеа) как суррогат маркера для экспрессии вирусных генов в настоящее время оцениваются в клинических исследованиях (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 и NCT00408590). Безопасное управление было подтверждено и эффективности противоопухолевой были случаи в предыдущих исследованиях25,26,27,28,29, 30 (обзор Msaouel et др.31), проложив путь для дополнительных онколитического Кори вирусов, которые были разработаны и испытаны preclinically. MV, кодирование иммуномодулирующих, молекулы, ориентация разнообразные шаги цикла рака иммунитет показали задержки роста опухоли и/или продлить выживание в мышей, с доказательствами для иммунной системы эффективности и долгосрочной защитной иммунной памяти в сингенных модели мыши. Вектор кодировке трансгенов включают гранулоцитарно макрофагальный колонии стимулирующий фактор (ГМ-КСФ)32,33, активация нейтрофилов белка пилорусов 34, ингибиторы иммунной контрольно-пропускного пункта35, Интерлейкин-12 (IL-12)36, ТААС37и BTEs38, которые перекрестные ссылки опухоль поверхностного антигена с CD3 и таким образом побудить противоопухолевую активность поликлональных Т-клеток, независимо от того, Т-клеток рецепторов специфичность и Сопредседатель стимуляции ( Рисунок 1). Перспективных доклинические результаты, полученные для этих конструкций спроса дальнейшие поступательные усилия.

Talimogene laherparepvec (Т-VEC), типа я кодирования ГМ-КСФ, вирус простого герпеса является единственным онколитического терапевтический одобрен США продовольствия и медикаментов (FDA) и Европейское агентство лекарственных средств (EMA). Не исследование III фазы, ведущих к утверждения в конце 2015 года только показал эффективность на сайте интра опухолевой инъекции, но и абскопальные эффекты (то есть, ремиссии не вводили поражений) в передовые меланомы39. T-VEC вступил дополнительные испытания для применения в других опухолевых образований (например,, не Меланома кожи рак, NCT03458117; рак поджелудочной железы, NCT03086642) и для оценки комбинированной терапии, особенно с иммунной контрольно-пропускной пункт ингибиторы (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 и Рибас et др.40).

Это демонстрирует не только потенциал иммунотерапия онколитического, но и необходимость дальнейших научных исследований для выявления Улучшенный комбинации ОВТ и имуннокорекция. Рациональная конструкция дополнительных векторов и их развития для доклинических испытаний является ключом к этой деятельности. Это будет также способствовать понимание основных механизмов и имеет последствия для перехода к более персонализированные лечения рака. С этой целью эта публикация представляет методологию для модификации и развития Парамиксовирусы для целевых Рак иммунотерапия и, более конкретно, вирусы Кори онколитического, кодирование Т клеток привлечение антител (рис. 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Примечание: [O], [P] и [М] указывают подразделов, применимые к: OVs, в целом, (большинство) Парамиксовирусы или MV только, соответственно. [B] указывает конкретные разделы для Заушных трансгенов.

1 клонирование иммуномодулятор кодирования трансгенов в векторы вирус кори

  1. [O] дизайн вставка последовательности.
    1. [O] решение о иммуномодулятор интерес, на основе исследования литературы или исследовательские данные, такие как генетические экраны41 и получают соответствующие cDNA последовательность из соответствующих баз данных, таких как GenBank, Европейский Архив нуклеотидов, или международные иммуногенетики информационная система (IMGT).
    2. [O] добавьте дополнительные функции к трансген последовательности (рис. 3). Выражение может повысить предыдущей последовательности Козак и оптимизации вегетационных кодон. Сигнальные последовательности требуются для секреции. Включают последовательности кодирования N - или C-терминал белка теги для обнаружения и очистки42. Включить ограничение сайты для вставки в вектор.
      Примечание: [M] дополнительные транскрипции единицы (АТУС) укрывательство ген МВ полимеразы начала и стоп-сигналов необходимы для трансген выражение из рекомбинантных MV геномов. Подходящие анти геномной cDNA векторов, контролируемых ЦМВ промоутеров и содержащий АТУС с места уникального ограничения для внедрения в позитивном смысле трансгенов в определенных позициях, были разработаны ранее11. [P] адекватного позиционирования трансген имеет решающее значение, поскольку она затрагивает вирусной репликации и трансген выражение из-за выражение градиент, типичные для Парамиксовирусы43. Введение в АТО близко к 3' концу анти генома (т.е.., в позиции лидера или течению гена P ) обычно приводит к высокой трансген выражение за счет снижения вирусной репликации. Увеличение репликации и более низких уровнях трансген выражения можно ожидать при использовании АТГ по течению H гена. Упаковку генома несколько Парамиксовирусы, включая вирус кори, требует привязка шести нуклеотидов каждой нуклеокапсидом протеин44. Для вставки трансгенов в таких вирусов убедитесь, что количество нуклеотидов полного генома будет делится на шесть. Это также именуется как «правило шести»45,46. При необходимости включите дополнительные нуклеотидов в insert (вверх по течению от последовательности Козак или ниже по течению от стоп-кодон) без введения смены кадра или преждевременной остановки кодонов. [M] Избегайте определенной последовательности в трансген, которые похожи на начало ген МВ (AGGRNCMARGW) и остановить сигналов (RTTAWANAAAA) и РНК, редактирование последовательностей (AAAAAGGG). Были опубликованы такие последовательности консенсуса (см. Например, парки и др.47).
    3. [O] приобрести олигонуклеотида желаемой последовательности или собрать из доступных последовательностей с использованием стандартных молекулярного клонирования48.
      Примечание: [O] для амплификации PCR трансген дизайн вперед грунт, включая вышестоящих ограничения сайта и первые 15-20 нуклеотидов вставки и обратный грунтовка, включая последние 15-20 нуклеотидов вставки следуют ниже по течению ограничения сайт.
  2. [O] клон вставляют в ДНК кодирования геном вируса (анти-).
    1. [O] клонировать insert в ДНК векторов или ДНК анти геномах РНК-вирусов, стандарт молекулярного клонирования методы48 (т.е. следуют перешнуровка дна ограничение ферментативного, ).
      1. [O] предотвратить повторное перешнуровка вектора с помощью ограничения-совместимых сайтах или де фосфорилирование до перевязки.
      2. [O] изолируйте продукт перешнуровки электрофорез геля агарозы и последующих гель очистки с помощью коммерчески доступные наборы. В общем оптимального лигирование эффективность достигается в соотношении 3:1 Молярная вставки в векторный.
    2. [O] преобразования перешнуровки продукт в компетентных бактерии подходит для эффективного восстановления больших плазмид (т.е., выполняют теплового шока E. coli49) и выявления бактериальных клоны, укрывательство правильный ДНК колонии PCR50 .
    3. [O] изолировать усиленный ДНК от одного бактериальных клон с помощью коммерчески доступные наборы подготовки ДНК. Подтвердить геномной целостности управления дайджест с соответствующим энзимами ограничения (например, HindIII для МВ геномов [М]). Подтвердите правильность подсоединения и целостности трансген путем sequencing.
      Примечание: [M] для трансгенов вставлен в MV H- АТО, выполняют Сэнгер виртуализации с следующих грунтовок: H-9018 [вперед грунт, связывается с МВ генома позиции 9018 H открытые чтения кадра (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (обратная грунт, связывается с позиции генома MV 9249 в L ORF): 5' CAGATAGCGAGTCCATAACGG 3'.

2. спасение рекомбинантных Кори вирусных частиц кодирования иммуномодуляторы

  1. [O] создания рекомбинантных вирусных частиц из (анти-) геномная ДНК через transfection клеток продюсер вирус согласно стандартным протоколом для соответствующих вируса. Следуйте рекомендациям для работы в стерильных условиях. Выполните клеточной культуры под капюшонами, в частности все с участием вирус в шкафы биологической безопасности II класса.
    1. [M] для спасательных вируса кори cDNA23,24, пластины производитель MV (Африканский зеленых мартышек почек производных Vero) равномерно на пластине 6-ну 24 h перед transfection клетки. Семенной 2 x 105 клеток в 2 мл Дульбекко изменение орла среднего (DMEM) содержащий 10% плода бычьим сывороточным (ФБС) за хорошо для достижения 65 – 75% confluency в то время transfection.
      Примечание: [P] уменьшить число клеток, если клетки зарастают до формирования вирус индуцированной syncytia.
    2. [P] Transfect клетки с ДНК кодирования вирусный анти генома, необходимые вспомогательные плазмиды, и, при необходимости, плазмида кодирования флуоресцентные репортер оценить эффективность трансфекции.
      1. [M] смесь 5 мкг рекомбинантной ДНК кодирования анти генома вируса кори, 500 нг млекопитающих выражение плазмид кодирования вирус кори N и L белков и 100 нг кодирования P белка и флуоресцентные репортер в общем объеме 200 мкл DMEM плазмид.
      2. 18.6 мкл Реагента липосомальных трансфекции, сразу смешать, стряхивая трубки и проинкубируйте 25 мин при комнатной температуре (RT).
      3. [P] заменить средний 1.8 мл DMEM, 2% FBS, канамицин 50 мкг/мл (или других антибиотиков для предотвращения загрязнения) в колодец, затем добавьте смесь трансфекции каплям колодец и вихрем тщательно. Инкубируйте клетки на ночь при 37 ° C, 5% CO2. Заменить средний 2 мл свежего DMEM, 2% FBS и 50 мкг/мл канамицин следующий день; Повторите эту процедуру, когда средний становится кислой.
        ОСТОРОЖНОСТЬЮ: [O] обрабатывайте клетки и материалы согласно правил биобезопасности, как вирус может присутствовать от трансфекции через следующие шаги. Надлежащим образом распоряжаться (потенциально) инфекционные отходы.
  2. [P] собирать и распространять вирусных частиц.
    1. [P] наблюдать клетки ежедневно по микроскопии формирования Репортер ген выражение и syncytia (рис. 4). Урожай вируса, когда большие syncytia, состоящий из 20 или более ячеек, видны, или когда клетки становятся слишком плотной (т.е.., когда они начинают расти в несколько слоев, обычно после 7-9 дней).
      Примечание: [P] Если не syncytia наблюдаются для заданного вектора конструкции, это не обязательно означает сбой спасения. Как инфекционные вирусы могут присутствовать тем не менее в образце, передать свежие продюсер клетки для пассированый.
    2. [P] семян около 1,5 х 106 клеток продюсер в 12 мл DMEM с 10% FBS, на 10 см блюда 24 часа до ожидаемого урожая, или 2,5 х 106 клеток / тарелка 4-6 ч до пассированый вируса по достижению 65-75% confluency в то время вирус inoculat Ион.
    3. [P] собирать вирус потомству, тщательно скрести адэрентных продюсер клетки от пластины с помощью скребка клетки и передачи супернатанта, содержащие клетки в пластиковых пробирок. Удалите мусор клетки центрифугированием 5 мин на 2500 x g и 4 ° C.
      Примечание: Царапины клетки могут быть переданы непосредственно без центрифугирования максимизировать вирус уноса ценой субоптимальные культуры условий и потенциальных микроскопии артефактов.
      Предостережение: Избегайте [O] разлив СМИ, когда соскоб клеток. Минимизации образования аэрозолей.
    4. [P] Подготовьте посевным материалом, смешивая супернатант свободной ячейки из шага 2.2.3 с сыворотка свободный средних окончательный объем 4 мл. Заменить средство на клетки продюсер посевным материалом и инкубации клеток для по крайней мере 2 ч при 37 ° C и 5% CO2. Добавить 6 мл DMEM с 10% FBS и инкубации клеток на ночь перед изменением среды до 12 мл свежего DMEM с 10% FBS.
    5. [P] наблюдать клетки по крайней мере два раза в день и урожай вируса до syncytia взрыв (т.е., , когда нарушение мембраны становится видимым). Урожай первый проход вируса, удалить супернатант от плиты, 600 мкл сыворотки свободной среды, скрести клетки с ячейки стеклоподъёмника и передать чистый трубки.
      Примечание: [M] в зависимости от штамма вируса51,52 и прогрессирования инфекции передача пластин с инфицированных клеток до 32 ° C для облегчения вирусной репликации и распространения. В общем MV Schwarz штаммов распространять хорошо при 37 ° C, при передаче клетки, инфицированные вирусами штамма Edmonston B до 32 ° C приводит к медленнее syncytia формирования, но более высокие титры.
      Примечание: [P] не позволяют слоя клеток для сушки во время сбора урожая, как это приведет к сокращению инфективности вирусных частиц. Хотя некоторые вирус теряется, когда отбрасывая супернатант инфицированных клеток, более высокие титры можно получить из слоя клеток.
    6. [P] немедленно заморозить вирус подвеска в жидком азоте. Хранить при температуре-80 ° C для по крайней мере 24 часа для обеспечения тщательного замораживания. Распространяется на несколько дней, чтобы прервать процедуру, если необходимо.
    7. Освободите вирусных частиц, размораживание при 37 ° C. Однородный, vortexing и центрифуги для 5 мин на 2500 x g и 4 ° C. Передать supernatants помечены cryotubes и хранить при температуре-80 ° C.
      Примечание: [O] хранят вирусов в аликвота размеров для последующих экспериментов, как они преимущественно талой только один раз и немедленно использовать. [P] далее замораживания оттаивания циклов или хранения при 4 ° C в течение нескольких дней приводят к значительному снижению вирусной титры.
    8. [P] один день до дальнейшего пассированый для достижения требуемой суммы и титр, семян 4 x 106 клеток продюсер в 12 мл DMEM с 10% FBS на 15 см блюда. Прививать с вирусом в разносторонности инфекции (МВД) 0,03. Заразить 8 мл сыворотки свободной среды на пластину и изменить среде DMEM с 10% FBS после инкубации клеток для по крайней мере 2 h. масштаба вверх с помощью нескольких пластин.
    9. Урожай как описано в разделе Шаг 2.2.5, когда syncytia распространились по всей клеточных слоев. Бильярд полученной суспензии в 50 мл трубки и процесс, как описано в шагах 2.2.6–2.2.7.
      Примечание: [O] важно проверить все пластины визуально для бактериального и грибкового заражения до сбора урожая. В общем проверьте все клеточные линии регулярно за загрязнение микоплазмы или случайного вирусов мультиплексной ПЦР.
  3. [P] Evaluate вирусный титры. Определите титры запасов вируса в octuplicates за Алиготе, используя 96-луночных пластины. Выполнение титрования трех отдельных аликвоты за вирус спасения и использовать среднее значение для вычисления количества вируса подвеска использоваться в экспериментах.
    1. [P] бассейн Производитель клетки, граф и приспособиться к 1,5 x 105 клеток / мл в среде DMEM с 10% FBS.
    2. [P] 90 Накапайте µL DMEM с 10% FBS в каждой скважине 96-луночных плиты.
    3. [P] добавить 10 мкл от одной Алиготе акций вирус все 8 скважин в первом столбце пластины и тщательно перемешать, закупорить вверх и вниз по крайней мере 10 раз.
    4. [P] выполняют серийных разведений десятикратного вируса. Передача 10 мкл каждой скважины из первого во второй столбец с помощью многоканальные пипетки. Тщательно перемешать, закупорить вверх и вниз и использовать свежие накапайте советы для каждого шага разрежения. Сбросить 10 мкл от каждой скважины последнего столбца.
      Примечание: Каждая пластина 96-луночных позволяет 12 шагов серийный разрежения. [M] для МВ векторов 8 шагов десятикратного разведений обычно достаточно, как титры выше 1 х 109 клеток инфекционных единиц/мл (КИУ) редко получаются методом распространения, описанный в шаге 2.2. [P] контроля скважин без вируса может использоваться для сравнения и мониторинга загрязнения.
    5. [P] добавить 100 мкл суспензии клеток в каждой скважине и инкубировать при 37 ° C, 5% CO2 на 48 ч. обеспечить отсутствие скопления клеток в суспензии для достижения однородной распределения клеток.
    6. [P] Проверка с использованием световой микроскоп syncytia. Граф syncytia в каждой скважине столбца с высокий коэффициент разрежения, содержащие видимых syncytia.
    7. [P] вычислить среднее количество syncytia за хорошо в этом столбце путем деления общего числа syncytia на восемь. Умножить что средний с коэффициент разбавления соответствующего столбца, начиная с 10 ciu2 мл для первого столбца53 (см. рис. 5 в качестве примера).

3. определение возможностей репликативной и цитотоксических вирусных векторов, кодировка иммуномодуляторы

  1. [O] Сравните репликации кинетики сгенерированный рекомбинантных вирус и неизмененной вектора с одноэтапный или многоэтапный кривых роста (ГСК). Для одношагового GCs вирусного потомства оцениваются после одновременного инфицирования всех клеток (теоретически, 100% инфекции). Многоступенчатый GCs старт на низкий процент инфицированных клеток следовать несколько раундов репликации вируса.
    1. [M] для анализа кинетики репликации вируса кори, семян 1 х 105 Vero клеток в 1 мл 10% раствора DMEM FBS в колодец на 12-ну пластин за один день до инфекции. Пластины по крайней мере две скважины для каждого timepoint интерес как технические реплицирует.
    2. [O] заразить клетки с вирусом на низкой МВД для многоступенчатой или высоких МВД для одношагового GCs [М] (0,03 и 3 MV репликации на Vero клеток, соответственно). Заменить средний 300 мкл сыворотки свободный носитель, содержащий соответствующее количество вируса и Инкубируйте на 37 ° C и 5% CO2 для по крайней мере 2 h. удалить посевным материалом, добавить 1 мл 10% раствора DMEM FBS и продолжить инкубации.
    3. [P] на соответствующих timepoints например, 12 24, 36, 48, 72 и 96 ч после инфекции, урожай вирусного потомства, непосредственно соскоб клеток в среду. Перенести содержимое из каждой скважины в отдельные трубки, оснастки замораживание в жидком азоте и хранить при температуре-80 ° C до титрования.
      Примечание: [P] реплицировать образцы могут объединяться на этот шаг для анализа средней титры.
    4. [P] Соберите образцы от всех timepoints. Оттепель одновременно при 37 ° C для оценки вирусного потомства. Вортекс и Пелле мусора клетки центрифугированием на 5 мин на 2500 x g и 4 ° C.
    5. [P] Вычислите среднее титры каждой конструкции и timepoint, как описано выше. Участок титры с течением времени. Сравнение кривых роста векторов с и без вставленной трансгенов, с различными трансгенов, или с трансгенов вставлены в различных положениях (см. рис. 6).
  2. [O] Сравните литические деятельность иммуномодулятор кодирования и unmodified вирусов.
    1. [O] выбор из возможных методологий, включая измерения импеданса, лактатдегидрогеназа (LDH) освободить пробирного или жизнеспособность на основе метаболизм клеток колориметрические assays [например, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (МТТ ) и 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assays].
      1. [M] для анализа цитотоксичности Кори вирусных векторов с использованием XTT пробирного, клеток Vero семян, как описано в шаге 3.1.1. Включать реплицирует неинфицированных управления для каждого timepoint.
        Примечание: [O] выполнение пробирного XTT в разных timepoints на том же образце можно ограничить технические ошибки, но многократную стирку и подверженности XTT реагент влияет на количество жизнеспособных клеток. Импеданс предоставляет альтернативный индикация для непрерывных измерений.
    2. [M] заразить клеток Веро в MOI 1, как описано в шаге 3.1.2.
      Примечание: [M] для заражения менее разрешительной целевых клеток, таких как некоторые линии мышиных опухолевых клеток могут потребоваться выше MOI 3 или 5.
    3. [O] в timepoints интереса (например., 12, 24, 36, 48, 72 и 96 ч после инфекции) подготовить необходимое количество XTT реагента (т.е.., 300 мкл ну плюс 10% избыток). Избегайте воздействия света.
    4. [M] в каждом timepoint удалите среднего из соответствующих скважин. Заменить на 300 мкл Реагента XTT и инкубировать при 37 ° C в темноте. Собирать supernatants, когда реагентов в скважины управления превратилась темно-красный, который обычно занимает от 15 минут и 2 h, и заморозить при температуре-20 ° C.
      Примечание: [O] инкубации раз зависят от вируса конструкции, типа клеток, плотности и цитопатического эффекта.
    5. [O] после сбора всех образцов, оттепель одновременно. Передать плиту 96-луночных 100 мкл каждого образца и измерения оптического поглощения в 450 Нм, с 630 Нм как ссылка волны.
    6. [O] сюжет timepoints (ось x) против. оптического поглощения образцов относительно элементов управления, указывающее метаболической активности как суррогат для жизнеспособности клеток (ось y). Снижение относительного поглощения со временем подразумевает вирусный цитотоксичности (см. Рисунок 6B).

4. Анализ активности вируса кодировке иммуномодуляторов, выделяется из инфицированных клеток

  1. [O] изолировать секретируемые трансген продукты выраженные клеток-мишеней, инфицированных вирусом.
    1. [P] пусть продюсер вирусом клетки растут до 70% confluency в T175 колбы.
    2. [P] удалить среднего из клеток и мыть дважды с 12 мл PBS для удаления сыворотки. Прививок клетки с вирусом в MOI 0.03 в 12 мл сыворотки свободной среды и Инкубируйте на 37 ° C и 5% CO2 на ночь. Замените средний 12 мл свежей сыворотки бесплатно среды.
      1. [M] для Edmonston B вирусов клетки перехода от 37 до 32 ° C после 40 h еще 24 ч инкубации для облегчения инфекции и предотвращения преждевременного разрыва syncytia. В зависимости от штамма вируса51,52 и syncytia прогрессии, температуры инкубации и время может быть скорректирована для оптимального белка урожай и чистоты.
    3. [P] тщательно Соберите supernatants без отсоединение клетки до syncytia взрыв. Оптимально syncytia распространились по всей ячейки слой. Бассейн supernatants в 50 мл трубки.
      Примечание: [P] для эффективной очистки продукта трансген избежать разрывать syncytia и свести к минимуму мусора клеток при уборке supernatants инфицированных клеток.
    4. [P] удалите ячейки мусор из супернатант центрифугированием 5 мин на 2500 x g и 4 ° C и проходящей через 0,22 мкм фильтры. В зависимости от общего объема фильтрата это можно выполнить с помощью шприца или вакуумного насоса.
    5. [O] изолируйте трансген продукта с помощью метода соответствующей очистки. Очищайте протеины с тегом гекса гистидин (его) хромотографией сродства обмен с помощью Ni-НТА мини-спин столбцы38 , как описано здесь в краткой (шаги 4.1.5.1–4.1.5.4).
      Примечание: [O] выполните все быстро и на льду. Предварительно охладить буферов и предварительно прохладно центрифугирования до 4 ° C.
      1. [O] Подготовьте 100 мл буфера с PBS, хлорид натрия 200 мм и имидазола в окончательном концентрациях 10 мм (Отмывающий буфер 1, WB1), 20 (отмывающего буфера 2, WB2) и 500 мм (Элюирующий буфер, EB). Отрегулируйте пэ-аш WB1 и WB2 8.0 и EB до 7.0. В зависимости от белка, чтобы очиститься имидазола концентрации может должны быть скорректированы.
      2. [O] сбалансировать столбцы с 600 мкл WB1 и центрифуги на 800 x g на 2 мин с открытой крышкой.
      3. [O] нагрузки 600 мкл отфильтрованных supernatants на столбцы. Разрешите привязку его меткой белков к матрице столбца центрифугированием на 200 x g 5 минут с закрытой крышкой. Загрузка и привязка может повторяться до в общей сложности 300 мкг его меткой белка на столбец.
      4. [O] промыть трижды WB1 и один раз с WB2, или до тех пор, пока поток через бесцветный. Добавьте 600 мкл буфера и спина на 800 x g на 2 мин с открытой крышкой.
      5. [O] элюировать белка в свежий трубку, выполнив два элюции шаги с 300 мкл EB и центрифугирования для 2 мин на 800 x g.
      6. [O] опреснения и сконцентрировать продукта с использованием центробежные фильтры по словам размер продукта. Добавьте PBS объемом 15 мл и фильтра через центрифугирования 10 мин на 4000 x g. Повторите до желаемой чистоты и концентрация достигается. Чтобы увеличить концентрацию белка, уменьшите окончательный объем примерно 200 мкл центрифугированием 40 мин на 4000 x g.
  2. [O] подтверждают чистоты и личности продукта.
    1. [O] подсчитать количество общего белка в изолятах, используя стандартные колориметрические анализов bicinchoninic кислоты (BCA) или Брэдфорд пробирного54,55. [M] типичные значения могут варьироваться от 1-3 мкг трансген продукта на мл супернатант инфицированных клеток.
    2. [O] для количественной оценки относительной белковых изолятов отдельные через натрия Додециловый сульфат электрофореза геля полиакриламида (SDS-PAGE) и выполнять Кумасси, окрашивание56.
    3. [O] подтвердите личность очищенных продуктов, immunoblotting, с использованием специфических антител, белка или связанных пептидной тег57.
    4. [O] анализ белков специфики привязки с помощью соответствующих методов, которые могут включать энзим соединенный assay иммуносорбента (ELISA) или проточная цитометрия (см. Рисунок 7). Ячейка привязки может быть подтверждено с помощью недавно описан магнитные пулдаун пробирного38.
      Примечание: [O] используйте соответствующие элементы управления. В ячейку привязки анализов включают негативный контроль с клетки, не выражая целевых молекулы (как на рис. 9) и ненацеливания белка суррогаты (рис. 8). В экспериментах цитометрия потоков, включают позитивные, негативные и изотипа контроля (рис. 7).
      1. [O] совместно инкубировать целевой клетки и протеин изолировать разрешить привязку. [B] для связывания анализ BTEs периферической крови мононуклеаров (получения) изолированный от крови человека58, инкубировать 2,5 х 106 клеток с 200 ng БТЭ в 100 мкл PBS с 1% FBS (привязки буфер, BB) за 1 ч на льду.
      2. [B] мыть ячейки с 1 мл раствора BB для того чтобы удалить несвязанные белка. Центрифуга на 300 x g 5 минут, удалить супернатант и Ресуспензируйте Пелле в 100 мкл BB. Добавить биотинилированным антитела протеина интереса или тег связан пептида и инкубировать на льду за 30 мин. Для BTEs с тегом гриппа гемагглютинина (HA), нг использования 100 анти Ха-биотин (клон 3F10).
      3. [B] вымыть клетки дважды с 1 мл раствора BB и Ресуспензируйте в 80 мкл BB. 20 мкл стрептавидина сочетании магнитных микрошарики и Инкубируйте 15 мин при 4 ° C.
      4. [B] мыть один раз, чтобы удалить избыток бусины и Ресуспензируйте Пелле в 500 мкл BB с 2 мм ЭДТА (столбец буфер, CB).
      5. [B] изолируйте клетки с колоннами и магнитного стенд согласно инструкции поставщика.
        1. [B] макроэкономическую, позволяя 500 мкл CB пройти через колонку самотечный поток.
          Примечание: [B] столбце никогда не должен работать всухую. Накапайте тщательно и Дега буферы, чтобы избежать пузырей.
        2. [B] место чистой трубки в столбце и применять подвеска клеток/шарик к столбцу. Промойте колонку три раза с 500 мкл CB в мыть. Сбор образцов потока через подвески и по крайней мере первый шаг стиральная в трубе, а затем хранить на льду.
        3. [B] элюировать шарик прыгните клетки сохранили магнитным полем. С этой целью удалите столбец из магнитного стенд, поместите его над чистой трубки, добавляют 1 мл CB и быстро Вставьте трубку с помощью плунжера буфера через колонку. Держите трубку на льду.
      6. [B] центрифуги трубки содержащие проточных и элюции образцы для 20 минут, 16000 x g и 4 ° C до Пелле клетки. Отменить supernatants и лизировать клетки в буфере пробирного (RIPA), radioimmunoprecipitation (предлагаемые: 75 мкл). Выполните SDS-PAGE56.
      7. [B] выполните immunoblotting, с помощью подходящего первичного антитела. Антитела могут быть ориентированы трансген продукта или клеточных белков (например., β-актина, рис. 8) для оценки BTE-ячейку привязки.
  3. [O] оценки иммунологического функциональность изолированных иммуномодуляторов.
    1. [O] выявления соответствующих анализов по характеристикам закодированные иммуномодулятор. Относительно ожидаемого иммуномодулирующих деятельности могут применяться методы оценки пролиферации клеток, миграция, созревания, активации или цитотоксичности.
      Примечание: [O] пролиферации могут быть проанализированы по CFSE59 маркировки или Ki67 окрашивание60. Transwell или поцарапать эксперименты доступны для анализа миграции клеток61. Созревания и активации клеток можно оценить с помощью соответствующего пятная протоколы для соответствующих маркеров. [B] имеющиеся методы оценки BTE-опосредованной клеточной цитотоксичности включают импеданс измерений и хрома релиз пробирного. Если выбирают для assay выпуска хрома, соблюдаете должные меры безопасности при обращении с радиоактивными материалами.
    2. [B] как нерадиоактивных альтернатива ниже описывает подробно оценить BTE-индуцированной, клеточный цитотоксичность, ЛДГ релиз пробирного (описанное ранее в краткое38).
      1. [B] решили на условиях проверяться в ходе эксперимента (см. Рисунок 9 в качестве примера). Timepoints (часов до суток), концентрации иммуномодулятора (ПГ/мл до мкг/мл) и эффекторных коэффициентов целевой ячейки (E:T) (от 1:50 и 50: 1, например) может быть изменено. Всегда готовить образцы в triplicates.
      2. [B] включают образцы без белка и без эффекторных клеток, элементы управления для спонтанного ЛДГ выпустить одну ячейку типов (Tsp и Esp), целевой максимальный лизис ячейки (TМакс) с моющее средство добавлено до индикации, средний только элемент управления и регулятор громкости для ТМакс.
        Примечание: [B] требуется количество клеток-мишеней и инкубации раз может меняться. Выполнение первоначального теста без эффекторных клеток и иммуномодуляторы для определения оптимальных параметров. Включать Tsp и ТМакс образцы и соответствующие элементы управления для оценки числа различных клеток и timepoints.
      3. [B] изолируйте иммунной эффекторных клеток, например, путем (плотность градиентного центрифугирования крови человека для получения получения58 ) или негативный выбор мышиных Т-клеток от мыши splenocytes62.
      4. [B] семян целевых ячеек в зависимости от шага 4.3.2 (например, 5 x 10³ за хорошо) в пластине U-дно 96-луночных.
      5. [B] добавьте изолированные белка в желаемой концентрации для соответствующих образцов. Добавьте иммунные эффекторных клеток в желаемых показателей. Добавьте средний суммарный объем 100 мкл в колодец.
      6. [B] инкубировать сроки определены в шаг 4.3.2, обычно между 4 и 48 h (24 часа для кератоз репликацию и 48 h для свежевыделенных мышиных Т-клеток; короче инкубационного раз можно применять для prestimulated иммунные клетки), при 37 ° C и 5% CO2.
      7. [B] 45 минут до сбора образцов, добавить 10 мкл 10 x лизис решения скважин, содержащих TМакс образцов и соответствующих средних элементов управления. Продолжить инкубации.
      8. [B] спин вниз клетки на 250 x g для 4 мин передачи 50 мкл каждого супернатант 96-луночных пластины с плоским дном. Не передавать клетки, чтобы избежать ЛДГ клеток прыгните.
      9. [B] Подготовьте раствора субстрата в зависимости от производителя. Добавьте 50 мкл каждой скважины и Инкубируйте на RT в темноте для 30 минут или пока ТМакс образцы превратить глубокий красный цвет.
      10. [B] 50 мкл стоп решения для каждой скважины. Удаление пузырьков воздуха центрифугированием за 1 мин на 4000 x gи вручную с помощью полой иглы. Измерить оптического поглощения в 490 Нм.
      11. [B] вычислить значения конкретных лизис % для каждого образца.
        1. [B] рассчитать средние для реплицирует средних элементов управления с и без лизис решения. Вычитание полученные значения из экспериментальных образцов и ТМакс и Самопроизвольный отпуск управления, соответственно. Используйте эти фон исправлены значения для дальнейших вычислений.
        2. [B] рассчитать средние скорректированные по фону ТМакс, Tsp, и Esp элементов управления. Используя эти средние значения, следующее уравнение дает процент конкретных лизиса для каждого образца:

          Equation 1
        3. [B] участок % конкретных лизис значения против концентрации протеина или соотношение E:T и сравните ненацеливания контрольных образцов.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Рисунок 1 иллюстрирует механизм действия вирусов Кори онколитического кодирования Ингейджер bispecific Т-клеток. Изображением рабочего процесса этот протокол блок-схема представлена на рисунке 2. На рисунке 3 показан пример генома вируса кори модифицированных онколитического. Это обеспечивает визуальное представление конкретных изменений, примененных к функциям анти генома и особый вирус кори вставленных трансгенов. На рисунке 4изображены типичные Кори вирус индуцированной syncytia. Обратите внимание на плотность высокая клеток в timepoint уборки спасения (A, B), указав, что ячейка может быть уменьшена при повторить эксперимент. Температуры инкубации и - раз могут быть оптимизированы для пассированый клеток Веро (C, D) для достижения улучшения распространения syncytia через пластину. Рисунок 5 представляет итоги анализа типичных титрования. Рисунок 6, кривых роста одношаговый (A) и относительные жизнеспособности (B) после прививки с неизмененным (MV) и Заушных кодирования указаны вирусы Кори онколитического (MV-H-mCD3xhCD20). В то время как выглядеть кривых роста по сравнению векторов на клетках Vero, литические активность вируса трансген кодирования отстает в мышиных опухолевых клеток линии. Проточная цитометрия, данные целевых антиген выражая клетки инкубировали с BTEs на пяти различных разведениях приводится в Рисунок 7, указывающее BTE привязки клетками, в зависимости от концентрации. Рисунок 8 представляет образцовую immunoblot после магнитные пулдаун BTE связанных клеток. Пулдаун с ненацеливания BTEs (n1, n2) не дали обнаружению количество клеток, в то время как полосы в элюции фракции, свидетельствует о связанных ячеек, наблюдались для ориентации BTE образцы (t1, т-2). БТЭ опосредованной, целевой антиген специфические и концентрации зависимой цитотоксичности мышиных Т-клеток обозначается представитель пробирного релиз LDH на рисунке 9.

Figure 1
Рисунок 1 : Механизм действия вирусов Кори онколитического кодирования bispecific Т-клеток наниматель (MV-БТЭ). Инфекция опухолевых клеток (инфицированных: серый, неинфицированным: светло-голубой) с MV-БТЭ следуют вирусной репликации и распространения всей опухоли, что приводит к стимуляции лизис и иммунной клетки опухоли. Одновременно BTEs, [состоящий из двух один цепей производного от антител против CD3 на Т-клетки (желтый) и опухоль поверхностного антигена (синий)] производятся и локально инфицированных вирусом клеток. БТЭ опосредованной cross-linking с опухолевых клеток вызывает активацию покоящихся, Поликлональные Т-клеток, что приводит к дальнейшему опухолевых клеток убийства. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Блок-схемы, описывающие процесс проектирования, создания и оценки новых вирусных векторов кодирования иммуномодулирующих трансгенов. Шаги 1-4 отражают соответствующие разделы протокола. Маркеры указывают соответствующие соображения и подэтапы. Благодаря эмпирический характер процедуры коррективов или уточнений может стать необходимым на любом шаге рабочего процесса. Кроме того экспериментальные результаты могут привести к новые гипотезы и вдохновлять разработку дополнительных векторов или комбинированного лечения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Схематическое представление генома вируса кори. Более Зеленый флуоресцентный белок (eGFP) кодируется в подразделение дополнительной транскрипции, вниз по течению лидер (ld) последовательности. N, P, M, F, H и L назначить генов, кодирующих Нуклеопротеиды структурных белков вируса кори, белок P, матрица белка, синтез белка, белка гемагглютинина и большой белок (полимеразы), соответственно, которые дифференцировано выражаются как визуализирована выше. Трансген наниматель (БТЭ) Т-клеток bispecific вставляется в дополнительных транскрипции подразделение (АТП) вниз по течению H открытые чтения кадра. Трансген кодирует лидер пептидные Igκ для эффективного секреции, а также гриппа гемагглютинина (HA) и белок Теги гекса гистидин (его) для обнаружения и очистки. Генов, кодирующих переменной тяжелых (VH) и лёгкие цепи (VL) доменов антител против CD3 и CD20, соответственно, являются компоновщика подключенного через пептид последовательностей, содержащих глицин (G) и остатков Серина (S). Трансген последовательность предшествует последовательности Козак. Вниз по течению от кодирования региона, были включены дополнительные нуклеотидов образцово соблюдать правило шести. Вставьте кассету в окружении два места ограничения позволяет вставки соответствующих АТГ. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4 : Кори вирус индуцированной syncytia. (A, B) Vero клетки были transfected с cDNA для спасения рекомбинантных Кори вирусов кодирования расширенной зеленого флуоресцентного белка (eGFP) и bispecific Т-клеток наниматель (БТЭ) против мышиных CD3 и человека CD20. Наличие флуоресцентный синцития (белые стрелки) указывает успешное спасение инфекционных вирусов. (C, D) Вирусы Кори были собраны после спасения и распространяются на клеток Веро (проход 1). Большие syncytia сформировали и уже начинают взрыв (Желтые стрелки). Изображения были приобретены фазового контраста (B, D) и микроскопии флуоресцирования после возбуждения для 80 мс (A) и 100 мс (C). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5 : Представитель результат анализа титрования. Титрование партии третьего проход MV-H-mCD3xhCD20, Заушных кодирования онколитического вирус кори, на клетках Vero. Десятикратного серийный разрежения была выполнена на 96-луночных тарелку, начиная с 10 мкл вирус подвеска в каждой скважине 1. столбец не syncytia были видны в колонке 7, как указано в нули. Для следующего низкие разведения вирусов подвеска в колонке 6 в среднем шесть syncytia за хорошо было отмечено, что приводит к окончательной титр приблизительно 6 x 107 клетки инфекционных единиц (КИУ) в мл суспензии вирус. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6 : Кинетика репликации и литические активность рекомбинантного Кори вирусов. (A) форма кривых роста были созданы после заражения клеток Vero с вирусом кори в неизмененном онколитического (MV) или кодирования bispecific Т-клеток наниматель (MV-H-mCD3xhCD20) в MOI 1 вирус кори. Титры вирусного потомства были оценены в назначенный timepoints после инфекции, указанием аналогичные кинетики репликации вируса. Средства и стандартные отклонения восьми образцов (четыре технических реплицирует каждый из двух биологических реплицирует за timepoint) показано. (B) клеток, жизнеспособность оценивали по MC38 мышиных колоректальные карциномы клетки, стабильно выражая человеческие раковоэмбрионального антиген и MV рецептора CD46 (MC38-CEA-CD46), после прививки с средних только (макет) или указано вирусов в MOI 1. Assay жизнеспособности клетки XTT была исполнена на указанных timepoints. В более ранних timepoints для неизмененных вектора наблюдалось снижение жизнеспособности клеток. Значения более чем на 100%, рассчитанные для МВ-H-mCD3xhCD20 на 12 ч timepoint, часто наблюдаются вскоре после заражения, которое может быть вызвано клеточного стресса или клеток факторов в вирус подвеска. Средние значения плюс стандартные отклонения трех технических реплицирует отображаются для каждого timepoint. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 7
Рисунок 7 : Целевой ячейки обвязки bispecific Ингейджер Т-клеток (BTEs) выразил от кори инфицированные вирусом клетки. Человека Мантия клеточная лимфома клетки эндогенно выражая CD20 (Granta-519) инкубировали с человеческого иммуноглобулина G блокировать рецепторы Fc, следуют инкубации с 2, 4, 6, 8 или 10 мкл (A) решения BTE очищенный mCD3xhCD20, соответственно. БТЭ прыгните клетки были обнаружены с помощью фикоэритрин (PE)-конъюгированных антител, ориентация связанные BTE ха тег. Процент окрашенных клеток, коррелирует с концентрацией BTE. (B) контроля за избирательность и специфика привязки. Показано здесь являются элементы управления из независимый эксперимент, включая один образец клеток не инкубировали с BTE но ориентация BTE антитела только (контроль для неспецифической Связывание антитела к клеткам) или Заушных, который известен для привязки к клеткам интереса , следуют инкубации с isotype антитела или ориентации BTE антитела (положительный контроль). Если доступны, isogenic клетки, не выражая антигена целевого выбора могут быть использованы для дальнейшей проверки привязки избирательности. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 8
Рисунок 8 : Магнитные пулдаун человека периферической крови мононуклеаров (получения) обязательность кодировке вирус кори BTEs. Клетки инкубировали с двух разных партий человека против Т клеток (t1, t2) или ненацеливания управления BTEs (n1, n2), соответственно. БТЭ прыгните клетки были сохранены на столбцы с помощью магнитной бусины, гранулированных и лизированы. Β-актина в лизатов был обнаружен immunoblotting. Интенсивностей полос в образцах элюции указывают относительное BTE-ячейку привязки. Поток через образцы подтверждают наличие клеток во всех образцах. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 9
Рисунок 9 : Цитотоксическую активность Кори вирус кодировке BTEs. Целевой опухолевых клеток (5 x 10³ B16-CD20-CD46 за хорошо) инкубировали с мышиных Т-клеток в соотношении 1:50. BTEs, ранее очищенного от супернатант MV-H-mCD3xhCD20-инфицированных клеток были добавлены в указанных концентрациях. Относительный lysis клеток-мишеней оценивали ЛДГ релиз пробирного после 48 ч. клетки не хватает BTE целевых антигена (B16-CD46) служил эталоном для оценки антиген специфические цитотоксичности. Указаны средства плюс стандартные отклонения трех технических реплицирует на сэмпл. Антиген выражая клетки-мишени были специально лизированы образом зависящих от концентрации BTE. Чистоты выражения антигена BTE продукта и целевых уровней влияние клетки убийства. В примере 15% определенных ячеек убийство было достигнуто при относительно высокой концентрации BTE 1 мкг/мл. Это типичное значение для такой экспериментальной установки с длиной совместно инкубации раз и субоптимальные Т-клеток культуры условий. В других настройках до 60% конкретные убийства была достигнута с помощью BTEs, очищенного от MV-инфицированных supernatants, достигнув плато в концентрации 100 нг/мл и выше38BTE. Это означает, что, counter-intuitively, предел этот assay меньше 100% конкретные убийства, которые могут быть объяснены различные роста кинетики в TМакс по сравнению с образцами культуры совместного управления. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Иммунотерапия онколитического (т.е.., ОВТ в сочетании с иммуномодуляция) имеет большие перспективы для лечения рака, требуют дальнейшего развития и оптимизации онколитического вирусов кодирования иммуномодулирующих белков. Этот протокол описывает методы для создания и проверки таких векторов для последующего тестирования в соответствующих доклинических моделей и потенциальных будущих клинических перевод романа терапия против рака.

Многочисленные различные онколитического вирус платформы с явные преимущества являются доступны63. Помимо рака специфичность, вектор безопасности, требования для производства, эффективность в лизис опухолевых клеток и индукции иммунной реакции клонирование потенциала является ключевым для успешного векторизации иммуномодуляторов, с использованием конкретных онколитического. К сожалению прямых сравнений различных OVs в настоящее время отсутствуют и должны осуществляться с целью выявления оптимальных методов лечения для отдельных пациентов. Это может быть облегчено рациональное развитие и тестирование векторов романа кодирования трансген, примером здесь для МВ-БТЭ. Учитывая полезные свойства MV (то есть,, oncotropism, безопасность, fusogenicity, иммуногенность, возможности генетической модификации) этот протокол фокусируется на этой онколитического вектор, который может быть обобщена для других OV, особенно Парамиксовирусы .

Для рационального выбора потенциально соответствующие иммуномодуляторы как кандидат трансгенов (шаг 1.1.1) глубокое понимание цикла рака иммунитет имеет важное значение, делая систематической литературе исследований незаменимым. Кроме того, крупномасштабные экраны, хотя дорого, может оказаться ценным для выявления новых объектов (например, см. Патель et al.41).

Для разработки рекомбинантных OVs следует рассмотреть профили нужное выражение. В случае РНК-вирусов экспрессии генов на уровне РНК контролируется соответствующими полимеразы. При проектировании трансген кассеты для вставки в MV геномов (шаг 1.1.2), избегая последовательностей, которые напоминают MV полимеразы гена старт/стоп сигналов и РНК редактирования сайтов и следуя правилу шести имеет решающее значение для успешного вектор развития. Кроме того уровни выражения гена парамиксовирус соответствуют позиционирования в геноме, результатом выражения градиента43. В общем позиционирование трансген в вышестоящем положении увеличивает выражение за счет снижения репликации. Однако эти параметры также зависит от размера, структуры и последовательности соответствующих трансген. Следовательно ограничение по методике, описанной в настоящем протоколе необходимо для эмпирического тестирования новых векторных конструкций. В конкретных случаях, корректировки трансген последовательности или позиционирование может быть необходимым для достижения желаемого вектор характеристик (рис. 2). Систематическое сравнение различных позиций на контрольно-пропускном пункте антитела вставляет показала оптимальные результаты для H- Ату (неопубликованные данные). Как BTE вставки имеют сопоставимые свойства (размер и иммуноглобулина доменов), MV-БТЭ векторов клонированы аналогично38.

Для некоторых конструкций спасения инфекционных частиц от вируса cDNA (шаг 2.1) может потребоваться несколько попыток. Настройка числа клеток можно оптимизировать плотность клеток для формирования syncytia. Хотя некоторые плотность необходима для эффективного распространения для клеток и синтез клеточных мембран, ингибирование контакт уменьшает вирусной репликации. Кроме того количество инфекционных частиц может быть не достаточно, чтобы побудить фьюжн видимые ячейки. Однако как вирусы могут присутствовать в отсутствие syncytia, спасательных образцы можно тем не менее собраны и переданы свежий производитель клетки для потенциального распространения. Неэффективные трансфекции из-за низкого качества ДНК или неподобающе или деградированных трансфекции реагенты представляют собой типичные проблемы, которые относительно легко оценить и устранить путем создания новых препаратов ДНК и тестирования различных реагентов, соответственно.

Распространение успешного вирус (шаг 2.2) принципиально зависит от условий, определяющих вирусной репликации и lysis клетки. Рекомендуется использовать низкий проход количество клеток продюсер, и инфицированных клеток необходимо регулярно проверяться на прогрессирование syncytia. Корректировка числа клеток, температуры и инкубации раз может потребоваться сбалансировать вирусного распространения против. пролиферации.

Важным ограничением описан способ производства вирус является подготовка вирус суспензий от сырой lysates клетки. Исследователи должны осознавать тот факт, что вирус суспензии содержит клеточных факторов. Вирусные частицы могут быть сосредоточены через плотность градиент/сахарозы подушки ultracentrifugation за счет общего числа инфекционных частиц и также потенциально увеличение концентрации клеточных остатков. Вирус также может быть сосредоточено от инфицированной клетки supernatants, повышение чистоты, но снижается урожайность. GMP и крупномасштабное производство Парамиксовирусы обычно осуществляется с помощью нескольких слоев клеток продюсер посеян на накаливания чистой в биореакторах для увеличение титра доходность63. Точный мониторинг, сплошных сред exchange, сыворотка свободных условий и последующей фильтрации шаги обеспечивают высокой чистоты производимых вируса.

Оценка вирусной титры (шаги 2.3 и 3.1) через описанные syncytia подсчитывая метод не является точным, но это легко выполнить и достаточно точным, при использовании надлежащего числа технических реплицирует. При оценке OV-опосредованная цитотоксичность (шаг 3.2), ограничения имеющихся анализов необходимо учитывать. Метаболические анализов не различают цитостатического и цитолитических эффекты экспериментальное лечение. Чтобы измерить цитолиза, ЛДГ релиз assay могут быть выполнены. Однако оба типа анализов могут быть затронуты содержание вируса препаратов из сырой lysates клетки (рис. 6).

Изоляция белков, выраженные инфицированные вирусом клетки (шаг 4.1) может сильно различаться в урожайности и чистоты, в зависимости от соответствующих трансген и вирус используется, а также о технической точности. Таким образом контроль качества очистки белков имеет решающее значение для оценки соответствующих экспериментальных результатов.

Как исчерпывающее описание потенциальных функциональных анализов, охватывающих широкий спектр возможных иммуномодуляторы выходит за рамки этой публикации, этот протокол посвящен ex vivo методологии для измерения клеточной цитотоксичности (шаг 4.3). Клеточной цитотоксичности, особенно путем CD8 + Т-клеток, является важным посредником управления иммунологических опухоли в успешной immunotherapies64. Это имеет важные последствия для текущей иммунотерапия подходы с использованием антител для повышения противоопухолевый иммунный ответ в целом и bispecific Т-клеток Ингейджер в частности. Местное выражение BTE векторами онколитического принесло многообещающие результаты в нескольких доклинических исследованиях, в том числе38 РНК и ДНК вирусов65,,6667,68.

Из-за сложного взаимодействия опухоли, вирус, трансген продукта и принимающих иммунной системы в живых организмах проверки иммуномодулятор кодирования онколитического векторы в культуре клеток как показано здесь, не является достаточным для прогнозирования терапевтические результаты. Главное предлагаемой изолированных оценки функций векторных и иммуномодулятор, соответственно, имеет важное значение для подтверждения концепции, но не описывают потенциальные факторы синергизма и сложных взаимодействий в рамках микроокружения опухоли. Тестирование на токсичность и эффективность в соответствующих моделей в естественных условиях имеет решающее значение для дальнейшего развития Роман рекомбинантных вектора конструкции, но не выполняется легко. Иммунологической безопасности регулярно контролируется в нечеловеческих приматов как макак и мышь модели используются для накопление и эффективность анализирует20,-69. Однако многие из этих моделей имеют ограничения относительно экспрессию рецепторов вируса в ткани узла и вседозволенности, принимающих, и некоторые только недостаточно имитировать сложного OV, опухоли и иммунных микроокружения. Таким образом тщательное рассмотрение соответствующих моделей является обязательным.

MV-БТЭ лечение ранее был оценен в человека ксенотрансплантата и мышь сингенных модели. Не BTE трансген продукты были обнаруживаемыми в сыворотке мышей, получавших BTE-кодирования MV38, указанием успешного предупреждения системного воздействия даже без дальнейшего ослабления естественно oncotropic вакцинный штамм вирус. Местное выражение имеет решающее значение для OV-кодировке иммунокорректоров, которые являются токсичными при ведении системно. При необходимости, специфика опухоли может быть повышена благодаря требуемой в ячейку поверхности маркеры выбора70,,7172 и на основе микроРНК ненацеливание для расширенной oncotropism (74 )73, Обзор Руис и Рассел-75). Дополнительные изменения могут быть введены для оптимизации векторы для конкретных терапевтических использования (рассмотрены Miest и Каттанео-76), включая вставки трансгенов для диагностических целей77,78 или пролекарство преобразование к минимуму побочные эффекты химиотерапии79,80, введение безопасности переключается81и ориентации опухоли стромы или сосудистую (например, через bispecific антитела82).

Помимо генетической модификации вирусный вектор сочетание лечения с химерных антигена рецепторов (автомобиль) Т-клеток передачи83, химиотерапии84,,8586или радиотерапии87, 88 , 89 далее расширить репертуар ОВТ. Как MV иммунитет очень распространены, были разработаны стратегии для обхода нейтрализации антител, включая обмен гликопротеинов конверт для тех соответствующих Парамиксовирусы90, полимерное покрытие частиц, с помощью перевозчиков ячейки доставить вирусов и переходных иммуносупрессией (рассмотрен Рассел et al.6). Дальнейшее развитие передовых схем иммунотерапия OV требует тестирования безопасности и терапевтической эффективности соответствующих моделях животных, с пациентом материала и, в конечном счете, в контролируемых клинических исследованиях.

Учитывая огромное количество возможных комбинаций, комплексное тестирование не осуществимо. Математическое моделирование может помочь в приоритетности возможных комбинации режимов, а также их соответствующих дозирования и планирование, прогнозирование результатов лечения в silico (рассмотрен Сантьяго et al.91). При тестировании узкоспециализированного романа, рационально разработан векторов, звук сопровождающих трансляционного исследования для более глубокого понимания основных вирусологические и иммунологические процессы. Это имеет решающее значение для создания надлежащих моделей, информация о дальнейших возможных целей и улучшения в области в целом. В заключение из первых рук представление о соответствующих методов дизайн вектор, поколения и характеристика в этой линии работы будет ускорить разработку и поддержку исследованию Роман терапии для будущих клинических перевода.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Н.э. Engeland значится как соизобретателем патента в отношении РНК-вирусов для рака Immunovirotherapy, принадлежащие Гейдельбергского университета. J.P.W. Heidbuechel имеет ничего, чтобы раскрыть.

Acknowledgments

Эти методы были установлены в группе Виротерапии, возглавляемая Проф д-р д-р Ги Ungerechts в национальном центре опухолевых болезней в Гейдельберге. Мы признательны ему и всем членам группы лаборатории, особенно спек Тобиас доктор, доктор Rūta Veinalde, Джудит Förster, Биргит Hoyler и Джессика Альберт. Эта работа была поддержана, остальное Kröner-Fresenius-Stiftung (Грант 2015_A78 до н.э. Engeland) и немецкий Национальный научный фонд (DFG, Грант EN 1119/2-1 до н.э. Engeland). J.P.W. Heidbuechel получает стипендию, Гельмгольца Международная высшая школа для исследований рака.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics