종양 대상 Immunomodulation에 대 한 paramyxoviruses: 설계 및 평가 전 비보

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

이 프로토콜 설명 합니다 자세한 워크플로 생성에 대 한 immunomodulators, 예를 들어 bispecific T 세포 engagers를 인코딩 하는 홍 역 바이러스를 사용 하 여 표현 위한 oncolytic 바이러스의 비보 특성화 전. 응용 프로그램 및 다른 벡터 플랫폼 및 transgenes 적응 임상 번역 소설 immunovirotherapeutics의 개발을 가속화할 것 이다.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

성공적인 암 immunotherapy 장기 종양 제어 달성 가능성이 있다. 최근 임상 성공에도 불구 하 고 개별 종양 면역 프로 파일에 맞게 안전 하 고 효과적인 치료를 위한 긴급 한 필요가 남아 있습니다. Oncolytic 바이러스는 항 종양 면역 반응으로 종양 제한 유전자 발현 유도 사용합니다. 이 프로토콜의 immunomodulatory oncolytic 벡터 생성 및 전 비보 분석을 설명합니다. 예를 들어 bispecific T 세포 engagers를 인코딩 하는 홍 역 백신 바이러스에 초점을 맞추고, 일반적인 방법 다른 바이러스 종 및 transgenes 적응 될 수 있다. 제시 워크플로 디자인, 클로닝, 구조, 및 재조합 형 바이러스의 전파를 포함 되어 있습니다. 복제 속도 론 및 벡터의 용균성 활동 ex vivo 격리 된 immunomodulator의 기능을 분석 하는 분석 되어, 전 임상 모델에서 추가 개발을 위한 새로운의 생성을 촉진 하 고 궁극적으로 임상 번역입니다.

Introduction

Oncolytic 바이러스 (OVs) 특별히 내에서 복제 하 고 건강 한 조직을 그대로 하면서 종양 세포를 죽 일 항 암 치료제로 개발 되 고 있다. 그것은 지금 이해 하는 oncolytic virotherapy (OVT), 대부분의 경우에서 공통 되고있다, 효율적인 복제 및 바이러스의 확산에 의해 완전 한 종양 세포에 전적으로 의존 하지 않는 하지만 치료 성공에 대 한 행동의 추가 메커니즘을 필요로 포함 혈관 및 실질 대상 및, 중요 한 것은, 면역 자극1,2,,34. 현재 연구는 이해 하 고, 잠재적으로 소설 OVs, 그리고 유전 공학 고급 오븐을 만들기 위해 제공 하는 가능성을 포함 하는 바이러스 바이오 뱅크 개선된 생물에서 이익이 되었다 많은 초기 OV 연구 수정 되지 않은 바이러스를 사용 하는 동안 플랫폼5,,67.

OVs. 의 유전 공학에 관한 특별 한 관심의 immunomodulatory transgenes는 immunotherapy의 최근 성공을 감안할 때, OV 감염 된 종양 세포에 의해 같은 유전자 제품의 타겟된 식 조직 관리에 비해 독성을 감소 시킨다. 타겟팅 고유의 oncoselectivity 바이러스를 사용 하 여 또는 바이러스 성 차 있는 굴곡 운동8수정 하 여 이루어집니다. 로컬 immunomodulation OVT의 다각적인 안티 종양 메커니즘을 향상 시킵니다. 또한,이 전략은 심문 바이러스, 종양 세포 및 숙주 면역 체계 사이 상호 작용에. 이 위해이 프로토콜 설계, 복제, 구출, 전파, 및 oncolytic 바이러스인 (특히 홍 역 바이러스) 벡터 같은 transgenes 인코딩 유효성을 검사 하는 적용 및 조정 가능한 워크플로우를 제공 합니다.

변조 면역 반응의 다양 한 암 면역 주기9, 종양 항 원 인식 [예, 종양 관련 항 원 (다시) 또는 inducers의 강화 등의 다른 단계를 대상으로 하는 transgene 제품에 의해 달성 될 수 있다 중요 한 조직 적합성 복잡 한 (MHC) 종류 I 분자] 효율적인 항 원 프레 젠 테이 션 (cytokines);에 대 한 수지상 세포 성숙 지원 통해 보충 하 고와 같은 원하는 면역 세포를 활성화 세포 독성 그리고 헬퍼 T 세포 [발산, bispecific T 셀 engagers (BTEs)]; 규정 하는 T 세포, 억압 파생 골수성 세포, 종양 관련 된 대 식 세포 등 암 관련 된 섬유 아 세포 (항 체, BTEs, cytokines); 진압 세포를 대상으로 이펙터 세포 억제와 피로 (검사점 억제제)을 방지 하 고. 따라서, 생물 학적 에이전트의 과다 제공 됩니다. 각 메커니즘의 이해 뿐만 아니라 치료 효능과 가능한 시너지 효과 관한 이러한 바이러스 인코딩된 immunomodulators의 평가 암 치료를 개선 하는 데 필요한.

Paramyxoviridae 가족의 부정적인 감각 단일 가닥 RNA 바이러스 oncolytic 벡터로 그들의 사용에 도움이 되는 몇 가지 기능이 특징입니다. 이러한 자연 oncotropism, transgenes (5 kb 이상)10,11, 확산 syncytia 형성 및 높은 immunogenicity12를 포함 하 여 효율적인 대용량 게놈을 포함 됩니다. 따라서, OV 플랫폼에 따라 개 디 스템 퍼 바이러스13, 유행 성 이하선염 바이러스14, 뉴캐슬 질병 바이러스15, 센다이 바이러스16,17, 유인원 바이러스 518, Tupaia 바이러스인19 개발 되었습니다. 가장 눈에 띄게, 긴장 (MV) 전 임상 및 임상 개발20,21에서 진행 하는 감쇠 홍 역 바이러스 백신 라이브. 이러한 바이러스 변종 우수한 안전 기록22와 일상적인 예방 접종에 대 한 수십 년 동안 사용 되었습니다. 또한, paramyxoviruses의 엄격 하 게 cytosolic 복제로 인해 insertional mutagenesis에 대 한 위험이 있다. 다재 다능 한 반전 유전학 시스템 추가 전사 단위 (ATUs)로 transgenes의 삽입을 허용 하는 안티 게놈 cDNA에 따라 사용할 수 있는11,,2324입니다. MV 벡터 바이러스 성 유전자 발현에 대 한 대리 표식으로 나트륨 요오드 화물 symporter (MV-NIS) 이미징 및 방사선 치료 또는 녹는 carcinoembryonic 항 원 (CEA MV)에 대 한 인코딩 (NCT02962167, NCT02068794, 임상 시험에서 평가 되 고 현재 NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590, 및 NCT00408590). 안전 관리를 확인 하 고 항 종양 효과의 경우 이전 연구25,26,,2728,29, 에서 보고 되었습니다 30 (Msaouel et al.31검토), 개발 및 preclinically 테스트 추가 oncolytic 홍 역 바이러스에 대 한 방법을 포장. 분자 암 면역 주기의 다양 한 단계를 대상으로 종양의 성장을 지연 및 면역 중재 효능 및 장기 보호 면역 메모리 syngeneic에 증거와 쥐, 생존을 연장 표시 되었습니다 immunomodulatory 인코딩 MV 마우스 모델입니다. 벡터 인코딩된 transgenes granulocyte-대 식 세포 콜로 니 자극 인자 (GM-CSF)32,33, 헬리코박터 neutrophil 활성화 단백질34, 검사점 면역 억제제35를 포함 인터 루 킨-12 (IL-12)36,37, 다시 및 BTEs38, CD3와 종양 표면 항 원 상호 링크 따라서 polyclonal T 세포, T 세포 수용 체 특이성 및 공동 자극 (에 관계 없이 안티 종양 활동을 유도 그림 1)입니다. 유망한 임상 결과 얻은 이러한 구문에 대 한 수요가 더 변환 노력.

Talimogene laherparepvec (T-VEC), 형식이 나 인코딩 GM-CSF, 포진 심 플렉스 바이러스는 미국 식품 의약품 안전 청 (FDA) 및 유럽 의약품 청 (EMA)에 의해 승인 된 유일한 oncolytic 치료. 늦은 2015 년에 승인으로 이어지는 단계 III 연구는만 고급 흑색 종39종양 내 주입, 아니라 abscopal 효과 (즉, 병 변 비 주입의 remissions)의 사이트에서 효능을 표시 하지는. T-VEC 다른 종양 엔터티 (예: NCT03458117,, 비 흑색 종 피부 암, 췌장암, NCT03086642)에서 응용 프로그램 및 면역 검사점으로 특히 조합 치료의 평가 대 한 추가 재판 이후 들어갔습니다. 억제제 (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297, 및 스 et al.40).

이것는 oncolytic immunotherapy의 잠재력 뿐만 아니라 OVT immunomodulation의 뛰어난 조합을 식별 하는 추가 연구에 대 한 필요성을 보여줍니다. 합리적인 디자인 추가 벡터 및 전 임상 시험에 대 한 그들의 개발의이 사업에 열쇠 이다. 이 또한 기본 메커니즘의 이해를 사전 그리고 더 맞춤된 암 치료 쪽으로 진행에 대 한 의미를 갖는다. 이 위해,이 게시 수정 및 표적된 암 immunotherapy에 대 한 paramyxoviruses의, 더 구체적으로, T 세포-매력적인 항 체 (그림 2) 인코딩 oncolytic 홍 역 바이러스의 개발에 대 한 방법론을 제공 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

참고: [O], [P], [m]를 해당 하위 섹션을 나타냅니다: OVs 일반, (대부분) paramyxoviruses, 또는 MV만, 각각. [B] BTE transgenes 관련을 섹션을 나타냅니다.

Immunomodulator 인코딩 Transgenes의 1 홍 역 바이러스 벡터에 클로닝

  1. [O] 디자인 시퀀스를 삽입 합니다.
    1. [O] 문학 연구 또는 유전 스크린41 탐색적 데이터 기반으로 관심의 immunomodulator에 결정 하 고 은행, 유럽 뉴클레오티드 보관 등 적절 한 데이터베이스에서 관련 된 cDNA 순서 파생 또는 국제 ImMunoGeneTics 정보 시스템 (IMGT)입니다.
    2. [O] transgene 시퀀스 (그림 3)에 추가 기능을 추가 합니다. 이전 Kozak 시퀀스 및 종의 코 돈 최적화 식을 강화할 수 있다. 신호 순서는 분 비에 대 한 필요 합니다. 시퀀스 검출 및 정화42N-또는 C 터미널 단백질 태그 인코딩을 포함 합니다. 벡터에 삽입에 대 한 제한 사이트를 포함 합니다.
      참고: [M] 추가 전사 단위 (ATUs) MV 중 합 효소 유전자를 품고 시작 하 고 정지 신호는 transgene 식 MV 유전자 재조합에 필요한. 적합 한 안티 게놈 cDNA 벡터, CMV 발기인과 긍정적인 의미 transgenes 정의 된 위치에서의 도입에 대 한 고유한 제한 사이트와 포함 ATUs에 의해 제어 개발 되었습니다 이전11. [는 transgene의 P] 적절 한 위치으로 그것은 바이러스 성 복제 및 transgene 식 paramyxoviruses43에 대 한 일반적인 식 그라데이션 때문에 영향을 미치는 결정적, 이다. 3' 안티 게놈의 끝 가까이 ATU에 소개 (즉,., 지도자 위치에서 또는 P 유전자의 하류) 일반적으로 감소 된 바이러스 성 복제 비용 높은 transgene 식에서 결과. 증가 복제 및 transgene 식의 저수준 H 유전자의 하류 ATU를 사용 하는 경우 예상 될 수 있습니다. 홍 역 바이러스를 포함 한 여러 paramyxoviruses의 게놈의 포장 각 nucleocapsid 단백질44의 6 개의 뉴클레오티드 바인딩을 해야 합니다. 같은 바이러스로 transgenes의 삽입에 대 한 완전 한 게놈의 뉴클레오티드의 수 6로 나눌 수 있을 것입니다 확인 합니다. 이것은 또한 "6의 규칙"45,46라고 합니다. 필요한 경우 프레임 교대 또는 조 정지 codons를 소개 하지 않고 삽입 (Kozak 시퀀스의 업스트림 또는 정지 codon의 하류)에 추가 뉴클레오티드를 포함 합니다. [M]는 transgene에서 특정 시퀀스를 비슷한 MV 진 시작 (AGGRNCMARGW)와 RNA 편집 시퀀스 (AAAAAGGG) (RTTAWANAAAA) 신호를 중지 하지 마십시오. 이러한 합의 시퀀스 출판 되었습니다 (예: 공원 외47참조).
    3. [O] 구매 원하는 시퀀스의 oligonucleotide 또는 표준 분자 클로닝48을 사용 하 여 사용 가능한 시퀀스에서 조립.
      참고: [O]는 transgene의 PCR 증폭, 업스트림 제한 사이트와 삽입 하 고 마지막 삽입의 15-20 뉴클레오티드 다운스트림 제한에 의해 다음을 포함 하 여 반전 뇌관의 첫 번째 15-20 뉴클레오티드를 포함 하 여 앞으로 뇌관 디자인 사이트입니다.
  2. [O] 클론 인코딩 바이러스 (안티-) 게놈 DNA에 삽입 합니다.
    1. [O] 의해 표준 분자 클로닝 기술48 (즉,, 효소 제한 뒤에 DNA 결 찰) 벡터 DNA 또는 RNA 바이러스의 DNA 백신 유전자에 삽입 복제.
      1. [O] 결 찰 전에 탈 인 산화 또는 비 호환 제한 사이트를 사용 하 여 벡터의 재 결 찰을 방지 합니다.
      2. [O] 결 찰 제품 agarose 젤 전기 이동 법 및 후속 젤 정화 상용 키트를 사용 하 여 격리 합니다. 일반적으로, 최적의 결 찰 효율의 삽입 벡터을 3:1 어 금 니 비율에서 이루어집니다.
    2. [O] 변환 큰 플라스 미드의 효율적인 복구에 적합 한 유능한 박테리아에 결 찰 제품 (예:, 대장균49의 열 충격을 수행) 세균성 클론 식민지 PCR50 여 올바른 DNA를 품고 식별 .
    3. [O] 분리 상용 DNA 준비 키트를 사용 하 여 단일 박테리아 복제에서 DNA를 증폭. 적절 한 제한 효소로 제어 다이제스트 게놈 무결성 확인 (예:, MV 게놈 [M]에 대 한 HindIII). 시퀀싱에 의해 올바른 삽입과는 transgene의 무결성을 확인 합니다.
      참고: [M]에 대 한 MV HATU에 삽입 transgenes 수행 생어 시퀀싱 다음 뇌관으로: H-9018 [앞으로 뇌관, MV 게놈 위치 9018 H 오픈 프레임 (ORF) 읽기에 바인딩]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (뇌관, MV 게놈 위치에 묶는 L ORF에 9249 역): 5' 3' CAGATAGCGAGTCCATAACGG.

2. 재조합 홍 역 바이러스 입자 Immunomodulators 인코딩 구조

  1. [O] (안티-) 게놈 DNA 통해 transfection 해당 바이러스에 대 한 표준 프로토콜에 따라 바이러스 프로듀서 셀에서 재조합 바이러스 입자를 생성 합니다. 무 균 조건 하에서 작업에 대 한 지침을 따릅니다. 특히 세포 배양 후드, 아래 클래스 II 생물 안전 캐비닛에 바이러스와 관련 된 모든 단계를 수행.
    1. [M] 대 한 cDNA23,24에서 홍 역 바이러스의 구조, 접시 MV 프로듀서 (아프리카 녹색 원숭이 신장에서 파생 된 Vero) 세포 transfection 전에 24 h 6 잘 플레이트에 균등 하 게. 시드 2 x 105 2 ml에서 transfection에의 때에 65-75 %confluency 달성 하기 위해 잘 당 Dulbecco의 수정이 글의 중간 (DMEM) 10% 태아 둔감 한 혈 청 (FBS)를 포함 하 세포.
      참고: [P] 셀 바이러스 유도 syncytia 형성 하기 전에 자라 다 하는 경우 셀 숫자를 줄일 수 있습니다.
    2. [P] Transfect 세포 dna 바이러스 방지 게놈, 필요한 도우미 플라스 미드를 인코딩 및, 필요한 경우는 플라스 미드 인코딩 transfection 효율을 평가 하기 위해 형광 기자.
      1. [홍 역 바이러스 방지 게놈, 500를 인코딩 하는 재조합 DNA의 M] 믹스 5 µ g 각 포유류 식 플라스 미드 인코딩 홍 역 바이러스 N 그리고 L 단백질, 및 100의 ng ng 각 플라스 미드 P 단백질 및 200 µ L DMEM의 전체 볼륨에 형광 기자 인코딩.
      2. 자주 transfection 시 약의 18.6 µ L을 추가 하 고 즉시 튜브를 터치 하 여 섞어 실 온 (RT)에 25 분 동안 품 어.
      3. [P] 대체 매체 DMEM, 2 %FBS, 50 µ g/mL 대 (또는 다른 항생제 오염을 방지 하기 위해)의 1.8 mL 당 잘, 다음 우물에 dropwise transfection 믹스를 추가 하 고 신중 하 게 소용돌이. 37 ° C, 5% CO2에서 하룻밤 셀을 품 어. 대체 매체 2 mL 신선한 DMEM, 2 %FBS, 및 50 µ g/mL 대 다음 날; 매체는 된다 산 성 때이 반복 합니다.
        주의: [O] 셀 및 처리할 biosafety 규정 자료로 바이러스 transfection 다음 단계에서 존재할 수 있습니다. 적절 하 게 (잠재적) 전염 성 폐기물의 처분.
  2. [P] 수집 하 고 바이러스 입자를 전파.
    1. [P] 리포터 유전자 표현과 syncytia 형성 (그림 4)에 대 한 현미경으로 세포를 매일 관찰. 20 이상의 셀으로 구성 된 큰 syncytia 표시, 또는 세포 너무 밀도가 될 때 바이러스를 수확 (즉,., 그들은 일반적으로 7-9 일 후 여러 계층에서 성장 시작 하는 때).
      참고: [P] 만약 아무 syncytia 주어진된 벡터 구문에 대 한 관찰 된다, 이것은 반드시 아닙니다 구조 실패 했습니다. 전염 성 바이러스 역시 샘플에 존재 있을 수 있습니다, 뿌리고 신선한 프로듀서 셀을 전송 합니다.
    2. [P] 씨 약 1.5 x 106 프로듀서 셀 12 mL DMEM의 10 %FBS, 10 cm에서 요리 전에 예상된 수확 또는 2.5 x 106 세포 당 24 시간에에서 접시의 바이러스 inoculat의 때에 65-75 %confluency 달성 하기 위해 바이러스 뿌리고 이전 4-6 h 이온입니다.
    3. [P] 바이러스 자손을 수집, 신중 하 게 부착 프로듀서 셀 셀 스 크레이 퍼를 사용 하 여 접시에서 긁 고 원심 분리기 튜브에 세포를 포함 하는 상쾌한 전송. 2500 x g 5 분 및 4 ° c.에 대 한 원심 분리에 의해 세포 파편을 제거
      참고: 긁힌 것된 세포 바이러스 carryover 차선 문화 조건 고 잠재적인 현미경 아티팩트를 극대화 하기 위해 원심 분리 하지 않고 직접 전송 될 수 있습니다.
      주의: [O] 피하 세포를 근 근이 살아가고 때 미디어를 흘리 고. 연 무질 형성을 최소화 한다.
    4. [P] inoculum 단계의 2.2.3 셀 무료 상쾌한 4 mL의 최종 볼륨을 혈 청 자유로운 매체와 혼합 하 여 준비 합니다. inoculum으로 프로듀서 셀에 매체를 장착 하 고 37 ° C, 5% CO2에서 적어도 2 시간에 대 한 셀을 품 어. 추가 10 %DMEM 6 mL FBS와 하룻밤 10% 신선한 DMEM의 12 ml 매체를 변경 하기 전에 셀을 품 어 FBS.
    5. [P]는 셀 적어도 두 번 매일 syncytia 버스트 전에 수확 바이러스 관찰 (예:, 때 막 장애 표시 됩니다). 바이러스의 첫 대목을 수확, 접시에서 상쾌한을 제거 하 고, 혈 청 자유로운 매체의 600 µ L을 추가 하 고, 셀 기중 기, 세포를 긁어 한 깨끗 한 관을 전송.
      참고: [M]에 따라 바이러스 스트레인51,52 와 감염의 진행, 바이러스 성 복제 및 확산을 촉진 하기 위하여 32 ° C에 감염 된 세포와 플레이트를 전송 합니다. 일반적으로 MV 슈왈츠 긴장 37 ° C, 32 ° C에 느린 syncytia 형성 하지만 높은 titers Edmonston B 변형 바이러스에 감염 된 세포의 전송 동안에 잘 전파 합니다.
      참고: [P] 허용 하지 동안 수확, 건조 셀 계층으로이 바이러스 성 입자의 감소 infectivity 귀 착될 것 이다. 일부 바이러스는 감염 된 세포의 상쾌한 삭제 때 손실, 높은 titers 셀 계층에서 얻어질 수 있다.
    6. [P] 즉시 액체 질소에 바이러스 정지를 고정 합니다. 철저 한 보장 하기 위해 적어도 24 h-80 ° C에서 저장소 동결. 필요한 경우는 프로시저를 중단 하는 몇 일 연장.
    7. 37 ° c.에 녹고에 의해 바이러스 성 입자를 출시 Vortexing, 그리고 2500 x g 5 분 및 4 ° c.에 대 한 원심 분리기에 의해 균질 레이블이 지정 된 cryotubes를-80 ° c.에 게는 supernatants 전송
      참고: [O]를 저장할 바이러스 나중에 실험에 대 한 적절 한 aliquot 크기에 그들은 우선으로 한 번만 해 동 하 고 즉시 사용. [P] 추가 동결-해 동 주기 또는 몇 일 결과 바이러스 titers의 상당한 감소에 4 ° C에서 저장.
    8. [P] 1 일 이전에 더 필요한 금액 및 titer, 뿌리고 씨앗 10 %DMEM 12 ml에서 4 x 106 프로듀서 셀 FBS 15 cm 요리에. 0.03의 감염 (MOI)의 다양성에 바이러스 예방. 혈 청 무료 중간 접시 당 8 mL에 감염 하 고 10 %DMEM 매체 변경 여러 접시를 사용 하 여 적어도 2 h. 규모에 대 한 셀을 배양 한 후 FBS.
    9. 수확에 설명 된 대로 때 syncytia 전체 셀 계층에 걸쳐 확산 2.2.5, 단계. 2.2.6–2.2.7 단계에에서 설명 된 대로 50 mL 튜브 및 프로세스에서 얻은 정지를 풀.
      참고: [O] 수확 전에 박테리아와 곰 팡이 오염에 대 한 시각적으로 모든 접시를 확인 하기 결정적 이다. 일반적으로, 모든 셀 라인 mycoplasma 또는 다중 PCR에 의해 우발적인 바이러스 오염에 대 한 정기적으로 확인 합니다.
  3. [P] 평가 바이러스 titers. 약 수 96 잘 접시를 사용 하 여 당 octuplicates에 바이러스 주식의 titers를 확인 합니다. 바이러스 구조 당 3 개의 개별 aliquots의 적정을 수행 하 고 평균 값을 사용 하 여 실험에 사용 될 바이러스 서 스 펜 션의 양을 계산.
    1. [P] 수영장 생산과 세포, 수, 1.5 10 %DMEM mL 당 105 셀 x 조정 FBS.
    2. [P] 피펫으로 90 DMEM의 µ L 10% FBS 96 잘 접시의 각 음에.
    3. [P] 접시의 첫 번째 열에 있는 모든 8 우물에 바이러스의 한 약 수에서 10 µ L 추가 하 고 아래로 10 번 이상 pipetting으로 철저 하 게 혼합.
    4. [P] 바이러스의 직렬 10 희석을 수행 합니다. 10 µ L의 각 음에서 전송 다채널 피펫으로 사용 하 여 두 번째 열을 첫 번째. 아래로 pipetting으로 철저 하 게 혼합 하 고 각 희석 단계에 대 한 신선한 피펫으로 팁을 사용 합니다. 마지막 열의 각 우물에서 10 µ L를 삭제 합니다.
      참고: 각 96 잘 접시 12 직렬 희석 단계 수 있습니다. [M] MV 벡터 10 희석의 8 단계는 일반적으로 충분 한, titers 1 x 109 셀 감염 단위 이상으로 (ciu) /mL 거의 전파 단계 2.2에서에서 설명의 방법에 의해 얻어진 다. [비교 및 오염 모니터링에 바이러스 없이 웰 스 P] 컨트롤을 사용할 수 있습니다.
    5. [P] 각 우물에 세포 현 탁 액의 100 µ L을 추가 하 고 37 ° C, 5% CO2 48 헤 셀의 균일 분배를 달성 하기 위해 현 탁 액에서 세포 덩어리의 부재 확인에서 품 어.
    6. [P]를 syncytia 가벼운 현미경을 사용 하 여 확인 합니다. 열의 각 우물에 syncytia syncytia 표시를 포함 하는 가장 높은 희석 비율 계산.
    7. [P] 8 syncytia의 총 수를 분할 하 여 해당 열에 잘 당 syncytia의 평균 수를 계산 합니다. 각 열의 첫 번째 열53 mL 당 102 ciu에 시작 희석 계수와 평균 곱하기 (예를 들어 그림 5 참조).

3. 인코딩 Immunomodulators 바이러스 성 벡터의 일차 및 세포 독성 용량 결정

  1. [O]를 비교 하 여 생성 된 재조합 형 바이러스와 한 단계 또는 다단계 성장 곡선 (Gc)와 수정 되지 않은 벡터의 복제 속도 론. 원스텝 Gc에 대 한 바이러스 성 자손 모든 셀 (이론적으로, 100% 감염)의 동시 감염에 따라 평가 됩니다. 몇 가지에 따라 감염 된 세포의 낮은 비율에 다단계 Gc 시작 바이러스 복제의 라운드.
    1. [M]의 홍 역 바이러스 복제 속도 론 분석을 위해 씨앗 10 %DMEM 1 mL에 1 x 105 Vero 세포 FBS 12-잘 접시 한 전날 감염에 잘 당. 기술 복제로 관심의 각 timepoint에 적어도 두 개의 우물을 플레이트.
    2. [O] 감염 바이러스 다단계에 대 한 낮은 나 또는 원스텝 Gc [M]에 대 한 높은 나 셀 (0.03, Vero에 MV 복제 3 셀, 각각). 바이러스의 해당 금액을 포함 하는 혈 청 자유로운 매체의 300 µ L 매체를 바꿉니다 및 37 ° C, 5% CO2 이상 2 h. 제거 inoculum에서 품 어, 추가 10 %DMEM 1 mL FBS, 부 화를 계속 하 고.
    3. [P]에서 12, 24, 36, 48, 72, 및 감염 후 96 h 등 관련 timepoints, 바이러스 자손 직접 셀 매체에 된다고 하 여 수확. 전송 내용을 각 우물에서 개별 튜브, 스냅인-동결에 액체 질소 및 적정까지-80 ° C에서 저장.
      참고: [P] 복제 샘플 평균 titers의 분석을 위해이 단계에서 풀링된 수 있습니다.
    4. [P] 모든 timepoints에서 샘플을 수집 합니다. 동시에 바이러스 자손의 평가 대 한 37 ° C에서 녹여. 2500 x g 와 4 ° C에서 5 분 동안 원심 분리에 의해 소용돌이 및 펠 릿 세포 파편
    5. [P] 각 구문 및 위에서 설명한 대로 timepoint 평균 titers를 계산 합니다. 시간이 지남에 titers을 플롯 합니다. 벡터와 삽입된 transgenes, 다른 transgenes, 또는 다른 위치에 삽입 transgenes 없이 성장 곡선을 비교 하 여 ( 그림 6A참조).
  2. [O]를 비교 하 여 immunomodulator 인코딩 및 수정 되지 않은 바이러스의 용균성 활동.
    1. [O] 임피던스 측정, 젖 산 효소 (LDH)를 포함 한 가능한 방법론에서 선택 해제 분석 결과, 또는 신진 대사 기반 색도계 세포 생존 능력 분석 실험 [예:, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT )와 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) 분석 실험].
      1. [M] 홍 역의 세포 독성 분석 하 바이러스 벡터 XTT 분석 결과, 씨앗 Vero 세포 단계 3.1.1에서에서 설명한 대로. 각 timepoint에 감염 되지 않은 컨트롤의 복제를 포함 합니다.
        참고: [기술적인 오류 제한할 수 O] 같은 샘플에 다른 timepoints에서 XTT assay를 수행 하지만 반복된 세척 및 XTT 시 약에 노출 가능한 셀의 숫자에 영향을 줍니다. 임피던스는 연속 측정에 대 한 대체 판독을 제공합니다.
    2. [M] 1 단계 3.1.2에에서 설명 된 대로 나에 Vero 세포를 감염.
      참고: [M] 일부 murine 종양 세포 라인 같은 덜 허용 대상 세포의 감염에 대 한 3 또는 5의 더 높은 MOI는 필요할 수 있습니다.
    3. [O]의 timepoints에서 (예를 들어., 12, 24, 36, 48, 72, 및 감염 후 96 h) XTT 시 약 (즉., 잘 플러스 10% 초과 당 300 µ L)의 필요한 금액을 준비. 빛의 노출을 피하십시오.
    4. [M]에서 각 timepoint 각 우물에서 매체를 제거 합니다. XTT 시 약의 300 µ L로 대체 하 고 어둠 속에서 37 ° C에서 품 어. 때 컨트롤 스에서 시 약은 일반적으로 15 분 2 시간 정도 걸립니다, 깊은 레드 supernatants를 수집 하 고-20 ° c.에 동결
      참고: [O] 보육 시간 바이러스 구조, 세포 유형, 밀도, 그리고 cytopathic 효과에 따라 다릅니다.
    5. [O] 모든 샘플 수집 후 동시에 녹여. 각 샘플의 100 µ L 96 잘 접시에 전송 하 고 450에서 광 흡수도 측정, 630 nm 기준 파장으로 nm.
    6. [O] timepoints (x 축) vs. 세포 생존 능력 (y 축)에 대 한 대리로 서 신진 대사 활동을 나타내는 컨트롤을 기준으로 샘플의 광 흡수도 플롯 합니다. 바이러스 성 세포 독성을 의미 시간이 지남에 상대적 흡 광도 감소 ( 그림 6B참조).

4. 감염 된 세포에서 분 비 하는 바이러스로 인코딩된 Immunomodulators의 활동 분석

  1. [O] 격리 분 비 transgene 제품 바이러스에 감염 된 대상 세포에 의해 표현.
    1. [P] 바이러스 프로듀서 70% confluency T175 플라스 크에 세포 성장 하자.
    2. [P] 세포에서 매체를 제거 하 고 혈 청을 제거 하는 PBS의 12 mL로 두 번 세척. 0.03에서 12 mL 혈 청 자유로운 매체의의 한 나에 바이러스 세포를 접종 하 고 하룻밤 37 ° C, 5% CO2 에서 품 어. 신선한 혈 청 자유로운 매체의 12 mL에 매체를 바꿉니다.
      1. [M] Edmonston B 바이러스에 대 한 전송 셀 37에서 32 ° C에 40 h 감염을 촉진 하기 위하여 syncytia의 조 숙한 파열 방지 외피의 다른 24 h에 대 한 후. 바이러스 변종에 따라51,52 와 syncytia 진행, 부 화 온도 및 시간 최적의 단백질 수율 및 순도 대 한 조정할 수 있다.
    3. [P] 신중 하 게 supernatants syncytia 버스트 전에 파견 셀 없이 수집 합니다. 최적으로, syncytia 전체 셀 계층에 걸쳐 확산 있다. 50 mL 튜브에 supernatants 풀.
      참고: [P] transgene 제품의 효율적인 정화 syncytia의 파열을 방지 하 고 감염 된 세포의 supernatants 수확 때 세포 파편을 최소화 합니다.
    4. [P] 셀 파편에서에서 제거는 상쾌한 2500 x g 와 4 ° C와 전달에 5 분 동안 원심 분리 하 여 0.22 μ m 필터를 통해 합니다. 여과 액의 전체 볼륨에 따라이 주사기 나 진공 펌프를 사용 하 여 수행할 수 있습니다.
    5. [O] transgene 제품 적절 한 정화 방법을 사용 하 여 격리 합니다. Hexa-히스티딘 (그의) 태그와 단백질 친화성 교환 크로마토그래피 여기에 간단히 설명 된 대로 Ni NTA 미니 스핀 열38 을 사용 하 여 (단계 4.1.5.1–4.1.5.4)에 의해 정화.
      참고: [O] 빠르고 얼음에 모든 단계를 수행 합니다. 미리 버퍼 및 4 ° c.에 미리 멋진 원심 분리기를 진정
      1. [O] 20 m m (버퍼 2, WB2 세척), 및 500 mM (차입 버퍼, EB) 100 mL PBS, 염화 나트륨 200 m m와 10mm (세척 버퍼 1, WB1)의 최종 농도에 이미 버퍼의 각을 준비 합니다. WB1 및 8.0 WB2와 EB의 pH 7.0을 조정 합니다. 단백질 정화을 따라 이미 농도 조정 할 수 있습니다.
      2. [O] 600 µ L WB1 오픈 뚜껑으로 2 분 동안 800 x g 에서 원심 분리기의 열 평형.
      3. [O] 열에 필터링 된 supernatants의 600 µ L 로드 합니다. 닫힌된 뚜껑으로 5 분 동안 200 x g 에서 원심 분리 하 여 열 매트릭스를 그의 태그 단백질의 바인딩을 허용. 로드 및 바인딩 300 µ g 열 당 그의 태그 단백질의 총 반복 수 있습니다.
      4. [O] WB1와 WB2, 또는 흐름 통해 무색이 될 때까지 한 번에 몇 번이 고 씻어. 열린 뚜껑으로 2 분 동안 800 x g 에서 버퍼와 스핀의 600 µ L를 추가 합니다.
      5. [O] 800 x g에서 2 분 동안 EB과 원심 분리의 300 µ L로 두 차입 단계를 수행 하 여 신선한 튜브로 단백질을 elute.
      6. [O] desalt 그리고 제품 크기에 따라 원심 필터를 사용 하 여 제품을 집중. 15 mL와 필터 원심 분리를 통해 4000 x g에서 10 분의 볼륨 PBS를 추가 합니다. 원하는 순도까지 반복 하 고 농도 달성. 단백질 농도 증가 하려면 4000 x g에서 40 분 동안 원심 분리 하 여 사용 약 200 µ L를 최종 볼륨을 줄입니다.
  2. [O] 순도 제품의 id를 확인 합니다.
    1. [O] bicinchoninic 산 (BCA) 등 Bradford 분석 결과54,55표준 색도계 분석 실험을 사용 하 여 격리에서 총 단백질의 양을 계량. [M] 전형적인 값은 감염 된 세포의 mL 상쾌한 당 1-3 µ g transgene 제품에서 배열할 수 있다.
    2. [O] 단백질 분리의 상대 정량화, 분리 를 통해 나트륨 라우릴 황산 polyacrylamide 젤 전기 이동 법 (SDS 페이지) 및56얼룩 Coomassie 수행.
    3. [O] immunoblotting 특정 항 체는 단백질 또는 펩타이드 관련된 태그57타겟팅을 사용 하 여 정제 제품의 id를 확인 합니다.
    4. [O] 단백질 바인딩 특이성 효소 연결 된 immunosorbent 분석 결과 (ELISA)을 포함 하거나 flow cytometry 적절 한 기술을 사용 하 여 분석 ( 그림 7참조). 셀 바인딩 최근 설명된 자석 풀 다운 분석 결과38을 사용 하 여 확인할 수 있습니다.
      참고: [O]를 사용 하 여 적절 한 제어. 셀 바인딩 분석 실험에서 하지 (에 그림 9) 대상된 분자를 표현 하는 세포와 비 대상 단백질 대리 모 알선 (그림 8) 부정적인 컨트롤을 포함 합니다. 교류 cytometry 실험에서 긍정적인, 포함 부정과 isotype 컨트롤 (그림 7).
      1. [O] 공동 품 어 대상 세포와 단백질 바인딩 수 있도록 분리. [B] 주변 혈액 분석 BTEs 바인딩하기 위한 인간의 혈액58에서 고립 된 단 세포 (PBMCs) 106 셀 200 x 2.5를 품 어 ng BTE의 1%와 PBS의 100 µ L에서 FBS (바인딩 버퍼, BB) 얼음에 1 h.
      2. [B] 워시 바인딩되지 않은 단백질을 제거 하는 BB의 1 mL로 세포. 5 분에 대 한 300 x g 에서 centrifuge, 상쾌한, 삭제 하 고 BB의 100 µ L에 펠 릿을 resuspend. Biotinylated 항 체는 관심사의 단백질 또는 펩타이드 관련된 태그를 대상으로 추가 하 고 30 분 동안 얼음에 품 어. 독감 조류 (HA) 태그, 안티-하-비타민 b 복합체 (클론 3F10)의 사용 100 ng BTEs에 대 한.
      3. [B] 셀 BB의 1 mL로 두 번 세척 하 고 BB의 80 µ L에서 resuspend. 마그네틱 microbeads streptavidin 결합의 20 µ L을 추가 하 고 4 ° c.에 15 분 동안 품 어
      4. [B] 초과 비즈를 제거 하 고 BB 2 mM EDTA (열 버퍼, CB)와 보완의 500 µ L에 펠 릿을 resuspend를 한 번 세척.
      5. [B] 셀 열 및 공급자의 설명서에 따라 마그네틱 스탠드를 격리 합니다.
        1. [B] 중력 흐름에 의해 열을 통과 하는 CB의 500 µ L를 함으로써 평형.
          참고: [B 열 건조 실행 하지 해야 합니다. 피펫으로 신중 하 게 거품을 피하기 위해 버퍼 드 고.
        2. [B] 열 아래 깨끗 한 튜브를 놓고 열에 셀/구슬 정지를 적용 합니다. 열 세 번 세척 당 CB의 500 µ L 씻어. 정지 및 적어도 첫 번째 세척 단계는 튜브의 흐름을 통해 샘플을 수집 다음 얼음에 저장 합니다.
        3. [B] elute 구슬 바인딩된 셀 자기장에 의해 유지. 이 위해, 마그네틱 스탠드에서 열을 제거 하 깨끗 한 튜브 위에 그것을 배치, CB의 1 mL를 추가 하 고 신속 하 게 열을 통해 버퍼는 플런저를 사용 하 여 튜브에 밀어. 얼음에 튜브를 유지.
      6. [B] 원심 분리기 튜브 포함 된 흐름을 통해 차입 샘플 16000 x g 와 작은 셀을 4 ° C에서 20 분 합니다. Supernatants 취소 및 radioimmunoprecipitation 분석 결과 (RIPA) 버퍼에 세포를 lyse (제안: 75 µ L). SDS 페이지56를 수행 합니다.
      7. [B] immunoblotting 적당 한 1 차적인 항 체를 사용 하 여 수행 합니다. Transgene 제품 또는 세포질 단백질 항 체 타겟팅 수 있습니다 (예:., β-말라, 그림 8) BTE 셀 바인딩 평가 하.
  3. [O] 고립 된 immunomodulators의 면역 기능을 평가 합니다.
    1. [O] 인코딩된 immunomodulator의 특성에 따라 관련 분석을 식별 합니다. 예상된 immunomodulatory 활동에 대 한 세포 증식을 평가 하는 방법을 마이그레이션, 성숙, 활성화, 또는 세포 독성 적용할 수 있습니다.
      참고: [O] 셀 확산 CFSE59 라벨 또는 Ki67 얼룩60분석할 수 있습니다. Transwell 또는 처음 실험 셀 마이그레이션61를 분석할 수 있습니다. 성숙 및 세포의 활성화는 각 표식에 대 한 적절 한 얼룩 프로토콜을 사용 하 여 평가 될 수 있다. [BTE 중재 세포질 세포 독성을 평가 하기 위해 b 조] 사용할 수 있는 기술을 포함 임피던스 측정 및 크롬 릴리스 분석 결과. 크롬 방출 분석 결과 대 한 선택, 방사성 물질을 처리 하는 경우 적절 한 안전 조치를 관찰 합니다.
    2. [B] 비 방사능 대 안으로 서 다음 자세하게에서 설명 합니다 LDH 자료 분석 결과 (위에서 설명한 간단한38) 의해 BTE 유도, 세포 매개 세포 독성을 평가 하는 방법을.
      1. [B] 실험 기간 동안 테스트할 조건에 결정 (예를 들어 그림 9 참조). Timepoints (일 시간), 농도 (pg/mL µ g/mL) immunomodulator의 대상 셀 (E:T) 비율 (1시 50분 사이 50: 1, 예를 들면)에 이펙터를 다양 한 수 있습니다. 항상 샘플 triplicates에서 준비 합니다.
      2. [B] 단백질 없이 샘플 등 효과 기 세포 없이 자발적인 LDH 컨트롤 출시 (Tsp 및 전자sp), 단일 셀 형식의 대상 셀 최대 세포 컨트롤 (T최대) 판독, 매체 앞에 추가 하는 세제로 만 컨트롤 하 고 T최대에 대 한 볼륨 컨트롤.
        참고: [B] 필요한 수의 대상 셀 및 보육 시간 달라질 수 있습니다. 효과 기 세포 및 최적의 매개 변수를 식별 하는 immunomodulators 없이 초기 테스트 실행을 수행 합니다. Tsp 와 T최대 샘플 및 다른 세포 숫자와 timepoints를 평가 하기 위해 해당 컨트롤을 포함 합니다.
      3. [B] (PBMCs58 를 인간의 혈액의 밀도 그라데이션 원심) 또는 마우스 splenocytes62에서 murine T 세포의 부정적인 선택에 의해 예를 들어, 면역 효과 기 세포를 분리.
      4. [B] 씨 대상 단계 4.3.2에 따르면 셀 (예:, 잘 당 5 x 10³)는 U-하단 96 잘 접시에서.
      5. [B] 각각 샘플을 원하는 농도에서 고립 된 단백질을 추가 합니다. 원하는 비율에 면역 효과 기 세포를 추가 합니다. 잘 당 100 µ L의 총 볼륨에 미디어를 추가 합니다.
      6. [B] 품 시간 프레임에서 결정 단계 4.3.2, 4 및 48 h 사이 일반적으로 (부 화 시간 단축 prestimulated 면역 세포에 대 한 적용할 수 있는 unstimulated PBMCs와 갓 격리 murine T 세포; 48 h h 24), 37 ° C, 5% CO2.
      7. [B] 45 분 샘플을 수집 하기 전에 T최대 샘플 및 해당 중간 컨트롤을 포함 하는 우물을 10 배 세포 솔루션의 10 µ L를 추가 합니다. 부 화를 계속 합니다.
      8. [B] 250 x g 평면 바닥 96 잘 접시에 각 상쾌한의 4 분 전송 50 µ L에서 셀 아래로 회전 합니다. 셀을 셀 바인딩된 LDH를 피하기 위해 전송 하지 않습니다.
      9. [B] 기판 솔루션 제조 업체에 따라 준비 합니다. 각 잘 하 50 µ L을 추가 하 고 30 분 동안 또는 T최대 샘플 깊은 빨강을 돌 때까지 어둠 속에서 RT에서 품 어.
      10. [B] 각 음을 정지 솔루션의 50 µ L를 추가 합니다. 4000 x g에 그리고 수동으로 빈 바늘으로 1 분 동안 원심 분리 하 여 기포를 제거 합니다. 490에서 광 흡수도 측정 nm.
      11. [B] 각 샘플에 대 한 % 특정 세포 값을 계산 합니다.
        1. [B]와 세포 솔루션 없이 중간 컨트롤의 복제에 대 한 평균을 계산 합니다. 각각 T최대 및 자발적인 릴리스 컨트롤, 실험 샘플에서 얻은 값을 뺍니다. 이러한 배경 수정 값을 사용 하 여 추가 계산에 대 한.
        2. [B] 배경 수정 T최대, Tsp, 그리고 Esp 컨트롤에 대 한 평균을 계산 합니다. 이 평균 값을 사용 하 여 다음 식을 각 샘플에 대 한 특정 세포의 비율 생성:

          Equation 1
        3. [B] 플롯 % 특정 세포 값 단백질 농도 또는 E:T 비율 및 비 대상 지정 컨트롤 샘플을 비교 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

그림 1 에서는 bispecific T 세포 engagers를 인코딩 하는 oncolytic 홍 역 바이러스의 행동의 메커니즘을 보여 줍니다. 이 프로토콜의 워크플로 묘사 하는 순서도 그림 2에 표시 됩니다. 그림 3 수정된 oncolytic 홍 역 바이러스 게놈의 예가 나와 있습니다. 이 삽입된 transgenes의 홍 역 바이러스 방지 게놈과 특정 기능에 적용 되는 특정 변경의 시각적 표현을 제공 합니다. 전형적인 홍 역 바이러스 유도 syncytia 그림 4에 묘사 된다. 실험을 반복 하는 경우 참고 높은 세포 밀도 나타내는 구조 (A, B), 수확의 timepoint에 셀 수를 줄일 수 있습니다. 부 화 온도 및-번 뿌리고 Vero 세포 (C, D) 접시에 걸쳐 syncytia의 향상 된 확산을 달성 하기 위해 최적화 될 수 있습니다. 그림 5 는 전형적인 적정 분석 결과의 결과를 나타냅니다. 그림 6, 한 단계 성장 곡선 (A) 및 (B) 수정 되지 않은 (MV)와 BTE 인코딩 접종 후 상대 셀 생존 oncolytic 홍 역 바이러스 (MV-H-mCD3xhCD20) 표시 됩니다. Vero 세포에 비해 벡터의 성장 곡선 유사 하 게 나타납니다 동안 transgene 인코딩 바이러스의 용균성 활동 murine 종양 세포 라인에서 뒤에 lags. 5 다른 희석에 BTEs와 인 큐베이 팅 대상 항 원 표현 세포의 흐름 cytometry 데이터 농도 의존 방식으로 셀에 의해 BTE 바인딩을 나타내는 그림 7에서 제공 됩니다. 그림 8 BTE 관련 된 세포의 자기 풀 다운 후 모범 immunoblot를 나타냅니다. 차입 분수, 바인딩된 셀을 나타내는 밴드 BTE 샘플 (t1, t2) 대상에 대 한 관찰 된 반면 (n1, n2) 비 대상 BTEs와 풀 다운 감지 양의 셀을 생성 하지 않았다. BTE 중재 대상 항 원 특정 및 농도 의존 세포 독성 murine T 세포의 대표 LDH 릴리스 분석 결과 그림 9에 표시 됩니다.

Figure 1
그림 1 : Bispecific T 세포 engager (MV-BTE) 인코딩 oncolytic 홍 역 바이러스의 행동의 메커니즘. 종양 세포의 감염 (감염: 회색, 감염 되지 않은: 라이트 블루) MV-BTE와 뒤에 바이러스 성 복제 및 확산 종양, 종양 세포 세포의 용 해 및 면역 자극에 결과 통해. 동시에, BTEs [CD3 T 세포 (노란색)에 종양 표면 항 원 (파란색)을 대상으로 하는 항 체에서 파생 하는 두 단일 체인의 구성] 생산 되며 로컬 바이러스에 감염 된 세포에 의해 분 비. 종양 세포와 cross-linking BTE 중재 휴식, 더 종양 세포 살해 결과로 polyclonal T 세포의 활성화를 유도 합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 설계, 생성, 및 새로운 바이러스 성 벡터 immunomodulatory transgenes 인코딩 평가의 워크플로 설명 하는 순서도. 1-4 단계 프로토콜의 각 부분을 반영합니다. 총알 포인트 관련 고려 사항 및 하위 단계를 표시합니다. 절차의 경험적 특성상 조정 또는 수정 워크플로우의 모든 단계에서 필요한 될 수 있습니다. 또한, 실험 결과 새로운 가설을 이어질 하 고 추가 벡터 또는 조합 치료의 개발에 영감 수 있습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : 홍 역 바이러스 게놈의 도식 대표. 향상 된 녹색 형광 단백질 (eGFP) 리더 (ld) 시퀀스의 하류는 추가 전사 단위에 인코딩됩니다. N, P, M, F, H, L 차동 시각으로 표현 하는 유전자 홍 역 바이러스 구조 단백질 nucleoprotein, P 단백질, 매트릭스 단백질, 융해 단백질, 조류 단백질, 및 큰 단백질 (중 합 효소), 각각, 인코딩 지정 위의. Bispecific T 세포 engager (BTE) transgene는 추가 전사 단위 (ATU) 하류 H 열려있는 독서 프레임에 삽입 됩니다. transgene 인플루엔자 조류 (HA) 뿐만 아니라 효율적인 분 비 Igκ 지도자 펩 티 드와 hexa-히스티딘 (그의) 단백질 태그 검색 및 정화를 인코딩합니다. CD3, CD20, 각각 대상으로 하는 항 체의 (VL) 도메인 변수 중 (VH)와 빛에 대 한 코딩 하는 유전자는 포함 하는 글리신 (G)와 떠들고 (S) 잔류물 펩 티 드 링커 시퀀스 연결 을 통해 . Transgene 시퀀스 Kozak 시퀀스에 의해 앞에 있습니다. 코딩의 하류 지역, 추가 뉴클레오티드 exemplarily 6의 규칙을 준수 하기 위해 포함 되었습니다. 삽입 카세트 두 제한 사이트 각각 ATU에 삽입을 사용 하 여 측면 이다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4 : 홍 역 바이러스 유도 syncytia. (A, B) Vero 세포 인코딩 향상 된 녹색 형광 단백질 (eGFP) 및 bispecific T 세포 engager (BTE) murine CD3, CD20 인간을 대상으로 하는 재조합 형 홍 역 바이러스의 구조에 대 한 cDNA와 페 했다. 형광 syncytium (흰색 화살표)의 존재는 전염 성 바이러스의 성공적인 구조를 나타냅니다. (C, D) 홍 역 바이러스는 구조 후 수확 하 고 Vero 세포 (통로 1)에 전파 했다. 큰 syncytia 형성 하 고 이미 버스트 (노란색 화살표) 시작. 이미지는 여기 80 ms (A) 및 100 ms (C) 후 단계 대조 (B, D) 및 형광 현미경 검사 법에 의해 인수 되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5 : 적정 분석 결과의 대표적인 결과. MV-H-mCD3xhCD20, BTE 인코딩 oncolytic 홍 역 바이러스, Vero 세포에서의 제 3 통로 배치의 적정. 10 직렬 희석 96 잘 접시에 수행 되었다, 열 1의 각 우물에서 바이러스의 서 스 펜 션의 10 µ L로 시작 없음 syncytia 열 7에에서 표시에 0으로 표시. 바이러스 열 6에서에서 서 스 펜 션의 다음 가장 낮은 희석에 대 한 잘 당 6 syncytia의 평균 약 6 x 107 셀 전염 성 (ciu) 당 단위 mL 바이러스 서 스 펜 션의 최종 titer의 결과로 관찰 되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6 : 복제 속도 론 및 재조합 홍 역 바이러스의 용균성 활동. (A) 한 단계 성장 곡선 Vero 세포 수정된 oncolytic 홍 역 바이러스 (MV) 또는 인코딩 bispecific T 세포 engager (MV-H-mCD3xhCD20) 1의 나에서 홍 역 바이러스의 감염 후 생성 된. 자손 바이러스 titers 유사한 바이러스 복제 속도 론을 나타내는 감염 후 지정 된 timepoints에서 평가 했다. 의미와 8 개의 샘플 (4 개의 기술 복제의 두 생물 학적 복제 timepoint 당 각)의 표준 편차 표시 됩니다. (B) 세포 생존 MC38 murine colorectal 암에 평가 되었다 세포 인간의 carcinoembryonic 항 원 및 MV 수용 체 CD46 안정적으로 표현 (MC38-CEA-CD46) 중간만 (모의) 또는 1의 나에 나타난된 바이러스 접종 후. XTT 세포 생존 능력 분석 결과 지정 된 timepoints에서 수행 되었다. 세포 생존 능력에 있는 감소는 수정 되지 않은 벡터에 대 한 이전 timepoints에서 관찰 되었다. 12 h timepoint에 MV-H-mCD3xhCD20에 대 한 계산으로 100% 이상의 값은 세포 스트레스 때문일 수 있습니다 감염 후 자주 관찰 또는 셀에서 파생 된 요소는 바이러스에에서 제시. 평균 값 플러스 3 개의 기술 복제의 표준 편차는 각 timepoint에 대 한 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 7
그림 7 : Bispecific T 셀 engagers (BTEs) 하 여 대상 셀 바인딩 표현에서 홍 역 바이러스에 감염 된 세포. 인간의 맨 틀 세포 림프 종 세포 endogenously CD20 표현 (Granta-519) 각각 2, 4, 6, 8, 또는 순화 mCD3xhCD20 BTE 솔루션의 10 µ L (A)를 가진 외피 뒤 Fc 수용 체를 차단 하 인간 면역 글로불린 G와 알을 품을 했다. BTE 바인딩된 셀 phycoerythrin (PE)를 사용 하 여 검색 된-BTE 관련 하-태그를 대상으로 활용 된 항 체. 얼룩진된 세포의 백분율 BTE 농도와 상관 된다. (B) 선택 하 고 바인딩의 특이성에 대 한 제어 합니다. BTE 하지만 BTE를 대상으로 항 체만 (세포에 항 체의 불특정 바인딩을 위해 컨트롤) 또는 관심사의 세포에 바인딩할 알려져 BTE 하지 incubated 각 셀의 하나의 샘플을 포함 하 여 여기는 독립적인 실험에서 컨트롤 표시 BTE를 대상으로 항 체 (긍정적인 컨트롤) 또는 isotype 항 체를 가진 외피에 의해 따라. 가능한 경우, 바인딩 선택도 추가로 확인 하지 선택의 대상 항을 표현 하는 isogenic 세포를 사용할 수 있습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 8
그림 8 : 인간의 주변의 자석 풀 다운 혈액 단 세포 (PBMCs) 홍 역 바이러스 인코딩 BTEs 구속. 세포는 인간 T 세포-타겟팅 (t1, t2) 또는 비 대상 컨트롤 BTEs (n1, n2)의 두 개의 다른 배치와 함께 각각 incubated 했다. BTE 바인딩된 셀 자기 비즈를 사용 하 여 열에, 수송과, 되었고 lysed. Β-말라 lysates에 immunoblotting에 의해 발견 되었다. 차입 샘플에 밴드의 강도 상대 BTE 셀 바인딩을 나타냅니다. 흐름을 통해 표본 모든 샘플에서 세포의 존재를 확인합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 9
그림 9 : 홍 역의 세포 독성 활동 바이러스 인코딩 BTEs. 대상 종양 세포 (5 x 10³ B16-CD20-CD46 잘 당) 1시 50분의 비율로 murine T 세포와 알을 품을 했다. 이전 뮤직 비디오-H-mCD3xhCD20-감염 된 세포의 상쾌한에서 정화 BTEs 표시 된 농도에서 추가 되었다. 대상 셀의 상대 세포는 BTE 부족 48 헤 셀 대상 항 원 특정 세포 독성 평가에 참고로 제공 하는 항 원 (B16-CD46) 후 LDH 자료 분석 결과 의해 평가 되었다. 방법 플러스 샘플 당 3 개의 기술 복제의 표준 편차 표시 됩니다. 대상 항 원 표출 세포 BTE 농도 의존 방식에서 lysed 구체적으로 했다. BTE 제품 및 대상 항 식 수준 영향 세포 살해의 순도. 현재 예제에서는 15% 특정 셀 죽이 1 µ g/mL의 상대적으로 높은 BTE 농도에서 달성 되었다. 이것은 긴 공동 보육 시간 및 차선 T 세포 문화 조건 같은 실험적인 체제에 대 한 일반적인 값 이다. 다른 설정에서 최대 60% 특정 살인 달성 했다 100 ng/mL 및 높은38BTE 농도에서 고원 도달 BTEs supernatants MV 감염에서 정화를 사용 하 여. 카운터-직관적으로,이 분석 결과의 제한 임을 나타냅니다 100% 보다 작은 T최대 컨트롤 공동 문화 샘플에 비해 다른 성장 속도 의해 설명 될 수 있는 특정 살해. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolytic immunotherapy (즉,., 함께 immunomodulation OVT) 암 치료, 개발 및 최적화 인코딩 immunomodulatory 단백질 oncolytic 바이러스의 추가 요구에 대 한 위대한 약속을 보유 하고있다. 이 프로토콜에는 생성 하 고 같은 벡터를 관련 전 임상 모델에 새로운 항 암 치료제로 잠재적인 미래 임상 번역 이후 테스트에 대 한 유효성을 검사 하는 방법을 설명 합니다.

뚜렷한 장점 가진 수많은 다른 oncolytic 바이러스 플랫폼63사용할 수 있습니다. 이외에 암 특이성, 벡터 안전, 제조에 대 한 요구 사항, 종양 세포 세포의 용 해, 및 면역 반응의 유도 효능, 용량을 복제 특정 oncolytic를 사용 하 여 immunomodulators의 성공적인 벡터화에 대 한 키입니다. 불행히도, 다른 OVs의 직접 비교는 현재 부족 한 하 고 개별 환자에 대 한 최적의 치료 옵션을 식별 하기 위해 추구 되어야. MV BTE에 대 한 여기 exemplified이 합리적인 개발을 추진 하 고 소설 transgene 인코딩 벡터의 테스트에 의해 촉진 수 있습니다. MV (즉,, oncotropism, fusogenicity, immunogenicity, 유전자 조작의 타당성)의 유익한 속성을 감안할 때이 프로토콜 다른 OV, 특히 paramyxoviruses에 일반화 될 수 있다이 oncolytic 벡터에 초점을 맞추고합니다 .

후보 transgenes (1.1.1 단계)으로 잠재적으로 관련 immunomodulators의 합리적인 선택, 대 한 암 면역 사이클에 대 한 철저 한 이해, 필수적 이다 체계적인 문학 연구를 필수 만들기. 또한, 대형 스크린, 하지만 비용이 많이 드는 소설 대상을 식별 하는 중요 한 증명할 수 있다 (예를 들어, 파 텔 외41참조).

재조합 OVs의 디자인에 대 한 원하는 식 프로필을 고려해 야 합니다. RNA 바이러스의 경우 유전자 발현은 RNA 수준에 각각 중 합 효소에 의해 제어 됩니다. MV 게놈 (1.1.2 단계)으로 삽입을 위한 transgene 카세트를 설계할 때 성공적인 벡터 개발 결정적 이다 MV 중 합 효소 유전자 시작/정지 신호 및 RNA 편집 사이트 및 6의 규칙에 따라 유사한 시퀀스를 피하. 또한, 바이러스인 유전자 표현 레벨 식 그라데이션43에서 발생 하는 게놈 내의 위치에 해당 합니다. 일반적으로, 상류 위치에 transgene의 위치 식 감소 복제 비용 증가. 그러나, 이러한 매개 변수는 또한 크기, 구조, 및 각각 transgene의 시퀀스에 따라 다릅니다. 결과적으로,이 프로토콜에서 설명 하는 방법론의 한계 소설 벡터 디자인의 경험적 테스트에 대 한 필요는. 특정 경우, transgene 시퀀스 조정 또는 위치 원하는 벡터 특성 (그림 2)를 달성 하는 데 필요한 있을 수 있습니다. 검사점 항 체에 대 한 다른 위치의 체계적인 비교는 H-ATU (되지 않은 데이터)에 대 한 보였다 최적의 결과 삽입합니다. MV BTE 벡터 비슷하게 복제 된 BTE 삽입 비교 속성 (크기 및 면역 글로불린 영역)으로,38.

바이러스 cDNA (2.1 단계)에서 전염 성 입자의 구조는 일부 구문에 대 한 여러 가지 시도 필요할 수 있습니다. 핸드폰 번호를 조정 syncytia 형성을 위한 세포 밀도 최적화할 수 있습니다. 특정 밀도 효율적인 셀 확산 및 세포 막의 융합에 필요한, 접촉 금지 바이러스 성 복제를 감소 시킨다. 또한, 전염 성 입자의 수 표시 세포 융합을 유도 하기에 충분 하지 않을 수 있습니다. 그러나, 바이러스 syncytia의 부재에 수, 구조 샘플 수 있습니다 그럼에도 불구 하 고 수확 되며 잠재적인 전파에 대 한 신선한 프로듀서 셀으로 전송. DNA 품질 또는 부적 절 한 또는 저하 transfection 시 약 비효율적인 transfection 상대적으로 쉽게 평가 하 고 새로운 DNA 준비를 생성 하 고 각각 다른 시 약을 테스트 하 여 해결 하는 일반적인 문제를 나타냅니다.

성공적인 바이러스 전파 (단계 2.2) 결정적으로 바이러스의 복제와 세포 세포의 용 해를 결정 하는 조건에 따라 달라 집니다. 프로듀서 셀의 낮은 통로 번호를 사용 하는 것이 좋습니다, 그리고 감염 된 세포 syncytia 진행을 정기적으로 검사 해야 합니다. 핸드폰 번호를 조정, 온도, 그리고 보육 시간 바이러스 확산 대. 셀 확산을 균형 필요할 수 있습니다.

바이러스 생산의 설명된 방법의 중요 한 제한 바이러스 정지에서 원유 세포 lysates의 준비 이다. 연구팀은 바이러스 정지 세포 요소를 포함 하는 사실의 알고 있어야 합니다. 바이러스 입자는 전염 성 입자 및 세포 잔해의 농도가 또한 잠재적으로 증가 총 수 비용 밀도 그라데이션/자당 쿠션 ultracentrifugation 집중 을 통해 하실 수 있습니다. 바이러스 감염된 세포 supernatants, 순도 증가 하지만 전반적인 수확량 감소에서 집중 될 수 있습니다. GMP 및 대규모 paramyxoviruses의 생산은 일반적으로 프로듀서 셀 bioreactors에서 필 순에 시드 증가 titer 항복63대의 여러 레이어를 사용 하 여 수행. 정확한 모니터링, 연속 미디어 교환, 혈 청 무료 조건 및 이후의 여과 단계 생산된 바이러스의 순도 보장합니다.

평가 통해 바이러스 titers (2.3-3.1 단계)의 설명된 syncytia 메서드를 계산 하는 것은 정확 하 게, 하지만 그것은 실행 하기 쉬운 그리고 기술의 적절 한 숫자를 사용 하 여 때 충분히 정확 하 게 복제. OV 중재 된 세포 독성 (3.2 단계)를 평가할 때 사용 가능한 분석 실험의 한계 고려 될 필요가 있다. 변화 분석 실험 cytostatic 및 cytolytic 실험적인 치료의 효과 구분 하지 않습니다. Cytolysis 측정, LDH 방출 시험을 수행할 수 있습니다. 그러나, 분석의 두 종류 원유 세포 lysates (그림 6)에서 바이러스 준비의 내용을 영향을 받을 수 있습니다.

바이러스에 감염 된 세포 (4.1 단계)에 의해 표현 하는 단백질의 분리 수율 및 순도, 기술적인 정확도에 뿐만 아니라 각각 transgene 및 사용 하는 바이러스에 따라 크게 달라질 수 있습니다. 따라서, 단백질 정화의 품질 관리 관련된 실험 결과의 평가 위해 결정적 이다.

이 간행물의 범위를 넘어 잠재적인 기능 분석 가능한 immunomodulators의 광범위 한 취재에 대 한 완전 한 설명으로,이 프로토콜 ex vivo 방법론 세포질 세포 독성 (4.3 단계) 측정을 집중 한다. 특히 CD8 + T 세포에 의해 세포 세포 독성 면역 종양 제어 성공적인 immunotherapies64에서 중요 한 중재자 이다. 이 특히 일반적으로 항 종양 면역 반응 향상을 항 체를 사용 하 여 현재 immunotherapy 접근 및 bispecific T 셀 engagers에 대 한 중요 한 의미를 갖는다. Oncolytic 벡터에 의해 로컬 BTE 식은38 RNA DNA 바이러스65,66,,6768를 포함 한 여러 전 임상 연구에서 유망한 결과 얻지 못했다.

종양, 바이러스, transgene 제품 및 살아있는 유기 체에 숙주 면역 체계의 복잡 한 상호 작용으로 인해 유효성 검사 immunomodulator 인코딩 oncolytic의 세포 배양에 같이 여기 치료 결과 예측 하기에 충분 하지는 벡터 스 중요 한 것은, 벡터 및 immunomodulator 기능의 제안 된 격리 된 평가 각각, 개념의 증거를 위해 필수적입니다 하지만 잠재적인 시너지 효과 및 종양 microenvironment 내에서 복잡 한 상호 작용을 설명 하기 위해 실패 합니다. 독성과 효능 관련 vivo에서 모델에 대 한 테스트 결정적 이다 더 새로운 재조합 벡터의 개발 생성 하지만 쉽게 달성 하지. 면역학 안전은 비 인간 영장류 원숭이, 등에서 정기적으로 모니터링 및 마우스 모델 biodistribution 사용 됩니다 효능 분석20,69. 그러나,이 모델의 많은 호스트 조직 및 호스트 허용함에 바이러스 수용 체의 표현에 관한 제한이 있고 일부만 충분히 OV, 종양, 면역 microenvironment의 복잡 한 상호 작용 하지 모방. 따라서, 적절 한 모델의 신중은 필수입니다.

MV BTE 치료 이전 인간의 종이 식 및 syngeneic 마우스 모델에서 평가 했다. 제품 BTE 인코딩 MV38로 치료 하는 쥐의 혈 청에서 감지 했다 아니 BTE transgene의 감쇠를 추가 없이 조직의 노출의 성공적인 예방을 나타내는 자연스럽 게 oncotropic 백신 변형 바이러스. 지역 식을 체계적으로 관리 될 때 독성이 있는 OV 인코딩된 immunomodulators 위해 결정적 이다. 필요한 경우, 종양 특이성 다시 세포 표면 마커 선택70,,7172 와 향상 된 oncotropism,7374 (타겟팅 드 예측에 관한 기반을 대상으로 강화 될 수 있다 루이즈와 러셀75에 의해 검토). 추가 수정 최적화 사용에 대 한 구체적인 치료 (페이지 및 네오76의 검토), 진단 목적77,78 또는 prodrug transgenes의 삽입을 포함 하 여 벡터를 도입 될 수 있습니다. 화학 요법79,80, 안전의 도입의 부작용을 최소화 하기 위해 변환81, 그리고 종양 기질 또는 맥 관 구조 (예를 들어,를 통해 bispecific 항 체82)의 대상으로 전환 합니다.

바이러스 성 벡터의 유전 수정, 제쳐두고 공상 항 원 수용 체 (자동차) T 세포와 조합 regimens 전송83, 화학요법84,,8586또는 방사선 치료87, 88 , 89 추가 OVT의 레 퍼 토리를 증가. MV 면역은 매우 유행, 항 체 중립화 회피 전략 개발 되었습니다, 그 관련된 paramyxoviruses90, 봉투 glycoproteins를 교환 하는 포함 한 셀 캐리어를 사용 하 여 입자의 폴리머 코팅 바이러스, 과도 면역 억제 (러셀 외.6의 검토)을 제공 합니다. 고급 OV immunotherapy regimens의 추가 개발 안전 및 환자 자료와 적절 한 동물 모델에서 그리고, 궁극적으로, 통제 된 임상 시험에서 치료 효능의 테스트 필요 합니다.

가능한 조합의 과다 한 주어, 하는 것은 가능입니다 포괄적인 테스트. 수학적 모델링은 잠재적인 조합 식이요법의 우선 순위와 그들의 각각 주입 및 철 (산티아고 외.91의 검토)에 치료 결과 예측 하 여 일정에 도움이 있습니다. 소설의 신진대사를 테스트할 때는 합리적으로 설계 된 벡터, 사운드 변환 연구 동반 기본 virological 및 면역학 과정의 깊은 이해에 대 한 수단 이다. 이것은 일반적으로 적절 한 모델, 잠재적인 대상 추가 및 발전 분야에 대 한 정보의 세대에 대 한 중요 한 이다. 결론적으로, 벡터 디자인, 생성 및 작업의이 라인에 특성의 관련 메서드로 직접 통찰력 개발을 가속화 하 고 미래 임상 번역에 대 한 새로운 치료제의 탐사를 지원.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

서 기 Engeland 암 Immunovirotherapy 하이델베르크 대학에 의해 소유에 대 한 특허에 관한 RNA 바이러스의 공동 발명자로 나열 됩니다. J.P.W. Heidbuechel 공개 상관이 있다.

Acknowledgments

이러한 메서드는 하이델베르크에서 종양 질환에 대 한 국립 센터에서 교수 박사 닥터 가 Ungerechts에 의해 주도 Virotherapy 그룹에서 설립 되었다. 우리는 그와 특히 박사 토 비아 스 스펙, 박사 Rūta Veinalde, 주 디스 포스터, Birgit Hoyler, 그리고 제시카 알 버트 실험실 팀의 모든 구성원에 게 빚을. 이 작업으로는 다른 Kröner-Fresenius-재단 지원 (서 기 Engeland에 그랜트 2015_A78)와 독일 국립 과학 재단 (DFG, EN 1119/2-1 기 Engeland 부여). J.P.W. Heidbuechel 암 연구에 대 한 헬름홀츠 국제 대학원에 의해 봉급을 받습니다.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics