Paramyxovirus for Tumor-målrettet Immunomodulation: Design og evaluering Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokol beskriver en detaljeret arbejdsgang for generation og ex vivo karakterisering af oncolytic virus for udtryk for hæmmende, ved hjælp af mæslinger virus kodning bispecific T-celle ager som eksempel. Ansøgning og tilpasning til andre vektor platforme og transgener vil fremskynde udviklingen af nye immunovirotherapeutics for klinisk oversættelse.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vellykket cancer immunterapi har potentiale til at opnå langsigtet tumor kontrol. Trods nylige kliniske succeser stadig der et presserende behov for sikre og effektive behandlinger skræddersyet til individuelle tumor immun profiler. Oncolytic virus aktiverer induktion af anti-tumor immunrespons samt tumor-begrænset genekspression. Denne protokol beskriver generation og ex vivo analysen af immunmodulerende oncolytic vektorer. Med fokus på mæslinger vaccine virus kodning bispecific T-celle ager som eksempel, kan den generelle metode tilpasses til andre virus arter og transgener. Arbejdsprocessen præsenteres omfatter design, kloning, redning og formering af rekombinant vira. Assays til at analysere replikation kinetik og lytisk aktivitet af vektoren samt funktionalitet af den isolerede Immunmodulator ex vivo er inkluderet, således at lette generation af roman agenter for yderligere udvikling i prækliniske modeller og i sidste ende kliniske oversættelse.

Introduction

Oncolytic virus (OVs) er ved at blive udviklet som anti-cancer terapi, der specifikt replikere inden for og dræbe tumorceller mens forlader raske væv intakt. Det er nu blevet fælles forståelse at oncolytic virotherapy (OVT), i de fleste tilfælde, ikke stole udelukkende på komplet tumor lysering af effektiv replikering og spredning af virus, men kræver yderligere virkningsmekanismer for behandling succes, herunder vaskulære og stromale målretning og vigtigere, immunstimulering1,2,3,4. Mens mange snarlig OV undersøgelser anvendes uændret vira, Aktuel forskning har nydt godt af en bedre biologisk forståelse, virus biobanker, der potentielt indeholder roman OVs, og genteknologi muligheder for at skabe avancerede OV platforme5,6,7.

I betragtning af den seneste succes for immunterapi, er immunmodulerende transgener af særlig interesse med hensyn til genteknologi af OVs. Målrettet udtryk for sådanne genprodukter af OV-inficerede tumorceller reducerer toksicitet i forhold til systemisk administration. Målretning opnås enten ved hjælp af vira med iboende oncoselectivity eller ved at ændre virale tropisme8. Lokale immunomodulation forbedrer de mangesidede anti-tumor mekanismer af OVT. Denne strategi er desuden medvirkende til spørgekriterierne samspillet mellem vira, tumorceller og vært immunsystemet. Med henblik herpå giver denne protokol en gældende og justerbar workflow til at designe, klone, redde, udbrede og validere oncolytic paramyxovirus (specielt mæslingevirus) vektorer kodning sådan transgener.

Graduering af immunresponset kan opnås ved en bred vifte af transgene produkter rettet mod forskellige trin af kræft-immunitet cyklus9, herunder styrkelse af tumor antigen anerkendelse [fx tumor-associerede antigener (TAAs) eller induktorer af store histocompatibility complex (MHC) klasse i molekyler] over støtte dendritiske celle modning for effektiv antigen præsentation (cytokiner); rekruttering og aktivering ønskede immunceller som cytotoksiske og hjælper T-celler [kemokiner, bispecific T-celle ager (BTEs)]; målretning smittespredningshæmmende celler som regulerende T-celler, myeloid-afledte suppressor celler, tumor-associerede makrofager og kræft-associerede fibroblaster (antistoffer, BTEs, cytokiner); og forebyggelse af effektor celler hæmning og udmattelse (checkpoint hæmmere). Således, en overflod af biologiske agenser er tilgængelige. Evaluering af sådanne virus-kodet hæmmende vedrørende terapeutiske virkning og mulige synergier samt forståelse af respektive mekanismer er nødvendigt at forbedre kræftbehandling.

Negativ forstand enkeltstrenget RNA-vira af familien Paramyxoviridae er kendetegnet ved flere funktioner bidrager til deres anvendelse som oncolytic vektorer. Disse omfatter en naturlig oncotropism, stor genomisk kapacitet for transgener (mere end 5 kb)10,11, effektiv spredning, herunder syncytia dannelse og høj immunogenicitet12. Derfor, OV platforme baseret på canine distemper virus13, fåresyge virus14, Newcastle disease virus15, Sendai virus16,17, simian virus 518og Tupaia paramyxovirus19 er blevet udviklet. De mest fremtrædende, live svækkede mæslinger virus vaccine stammer (MV) er kommet i prækliniske og kliniske udvikling20,21. Disse virusstammer har været anvendt i årtier for rutinemæssig immunisering med en fremragende sikkerhed post22. Derudover er der ingen risiko for pattedyrsceller mutagenese på grund af den strengt cytosole replikering af paramyxovirus. En alsidig omvendt genetik system baseret på anti-genomisk cDNA, der giver mulighed for indsættelse af transgener i yderligere transskription enheder (ATUs) er tilgængelige11,23,24. MV vektorer kodning natrium-Iodid symporter (MV-NIS) til billedbehandling og strålebehandling eller opløselige carcioembryonisk antigen (MV-CEA) som en surrogat markør for viral genekspression evalueres i øjeblikket i kliniske forsøg (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 og NCT00408590). Sikker administration er blevet bekræftet og har indberettet tilfælde af anti-tumor effekt i tidligere undersøgelser25,26,27,28,29, 30 (gennemgået af Msaouel et al.31), baner vejen for yderligere oncolytic mæslinger vira, der er blevet udviklet og testet preclinically. MV kodning immunmodulerende molekyler rettet mod forskellige trin af kræft-immunitet cyklus har vist sig at forsinke tumorvækst og/eller forlænge overlevelsen i mus, med dokumentation for immun-medieret effekt og langsigtede beskyttende immun hukommelse i syngeneic musemodeller. Vektor-kodet transgener omfatter granulocyt-makrofag koloni stimulerende faktor (GM-CSF)32,33, H. pylori aktivering af neutrofile protein34, immun checkpoint hæmmere35, interleukin-12 (IL-12)36, TAAs37og BTEs38, som krydse-link en tumor overflade antigen med CD3 og dermed fremkalde anti-tumor aktivitet af polyklonale T celler, uanset T-celle receptoren specificitet og co stimulation ( Figur 1). De lovende prækliniske resultater opnået for disse konstruktioner efterspørgslen yderligere translationel indsats.

Talimogene laherparepvec (T-VEC), en type jeg herpes simplex virus kodning GM-CSF, er den eneste oncolytic terapeutiske godkendt af de Forenede Stater mad og Drug Administration (FDA) og det Europæiske Lægemiddelagentur (EMA). Fase III undersøgelse fører til godkendelser i slutningen 2015 har ikke kun vist effekt i stedet for samhandel tumorsygdomme injektion, men også abscopal effekter (dvs. remissioner af ikke-indsprøjtning læsioner) i avanceret melanom39. T-VEC har siden indgået yderligere forsøg for anvendelse i andre tumor enheder (f.eks., ikke-melanom hudkræft, NCT03458117, kræft i bugspytkirtlen, NCT03086642) og for evaluering af Kombinationsbehandlinger, især med immun checkpoint hæmmere (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 og Ribas et al.40).

Det viser ikke kun potentialet i oncolytic immunterapi, men også behovet for yderligere forskning for at identificere superior kombinationer af OVT og immunomodulation. Rationelt design af yderligere vektorer og deres udvikling til præklinisk afprøvning er nøglen til denne virksomhed. Dette vil også fremme forståelse af de underliggende mekanismer og har betydning for progression mod mere personlig kræftbehandling. Med henblik herpå præsenterer denne publikation metoden til ændring og udvikling af paramyxovirus for målrettede cancer immunterapi og mere specifikt af oncolytic mæslinger virus kodning T-celle-engagerende antistoffer (figur 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bemærk: [O], [P], og [M] angive underafsnit gælder: OVs i general, (de fleste) paramyxovirus eller MV kun, henholdsvis. [B] angiver sektioner specifikke for BTE transgener.

1 kloning af Immunmodulator-kodning transgener til mæslinger Virus vektorer

  1. [O] design indsætte sekvens.
    1. [O] træffe beslutning om en Immunmodulator af interesse baseret på litteratur forskning eller sonderende data såsom genetiske skærme41 og udlede den relevante cDNA sekvens fra relevante databaser såsom GenBank, den europæiske nukleotid arkiv, eller den internationale ImMunoGeneTics informationssystem (IMGT).
    2. [O] føje yderligere funktioner til transgen sekvens (figur 3). En foregående Kozak sekvens og artsspecifikke codon optimering kan forbedre udtryk. Signal sekvenser er nødvendige for sekretion. Omfatte sekvenser kodning N - og/eller C-terminale protein tags for påvisning og rensning42. Omfatte begrænsning websteder til indsættelse i vektoren.
      Bemærk: [M] yderligere transskription enheder (ATUs) husly MV polymerase gen start og stop signaler er nødvendige for transgen udtryk fra rekombinante MV genomer. Egnet anti-genomisk cDNA vektorer, kontrolleret af CMV initiativtagere og indeholdende ATUs med unikke begrænsning websteder for indførelsen af positiv forstand transgener på definerede positioner, er blevet udviklet tidligere11. [P] passende positionering af transgenet er afgørende, da det påvirker viral replikation og transgen udtryk på grund af udtryk gradient typisk for paramyxovirus43. Introduktion til en ATU tæt på 3' enden af anti-genomet (i.e., i leader placering eller neden for P -gen) generelt resulterer i høje transgen udtryk på bekostning af reduceret viral replikation. Øget replikation og lavere niveauer af transgenet udtryk kan forventes, når du bruger ATU nedstrøms af H -genet. Emballering af genomet i flere paramyxovirus, herunder mæslingevirus, kræver binding af seks nukleotider ved hver nucleocapsid protein44. Indsættelse af transgener i sådanne vira, sikre at antallet af nukleotider i den komplette genom vil være deleligt med seks. Dette omtales også som "regel seks"45,46. Om nødvendigt, omfatte ekstra nukleotider i Indsæt (opstrøms af Kozak-sekvensen eller neden for stop-codon) uden at indføre rammen skiftehold eller for tidligt stop kodon. [M] undgå bestemt sekvenser i transgen, der svarer til MV gen start (AGGRNCMARGW) og stoppe (RTTAWANAAAA) signaler og RNA redigering sekvenser (AAAAAGGG). Sådan konsensus sekvenser er blevet offentliggjort (f.eks. Se Parker et al.47).
    3. [O] køb oligonukleotid af den ønskede sekvens eller samle fra tilgængelige sekvenser ved hjælp af standard molekylære kloning48.
      Bemærk: [O] til PCR-amplifikation af transgenet, designe en forward primer herunder webstedet opstrøms begrænsning og de første 15-20 nukleotider af indsatsen og et omvendt primer, herunder de sidste 15-20 nukleotider insertets efterfulgt af downstream begrænsning site.
  2. [O] klon Indsæt i DNA kodning viral (anti-) genom.
    1. [O] klon insertet i DNA vektorer eller DNA anti-genomer af RNA-vira ved standard molekylære kloning teknikker48 (dvs., enzymatisk begrænsning efterfulgt af DNA ligatur).
      1. [O] forhindre re ligatur af vektoren, ved hjælp af ikke-kompatible begrænsning websteder eller nedtrapning fosforylering før ligatur.
      2. [O] isolere ligatur produkt ved agarosegelelektroforese gelelektroforese og efterfølgende gel rensning ved hjælp af kommercielt tilgængelige kits. Generelt opnås optimal ligatur effektivitet i forholdet 3:1 molar af Indsæt til vektor.
    2. [O] transform ligatur produkt til kompetente bakterier velegnet til effektiv inddrivelse af store plasmider (dvs., udføre varme chok af E. coli49) og identificere bakteriel kloner husly den korrekte DNA af kolonien PCR50 .
    3. [O] isolat amplificeret DNA fra en enkelt bakteriel klon ved hjælp af kommercielt tilgængelige DNA forberedelse kits. Bekræft genomisk integritet ved kontrol digest med passende restriktionsenzymer (fx, HindIII for MV genomer [M]). Bekræfte korrekte indføring og integritet af transgenet ved sekventering.
      Bemærk: [M] for transgener indsat i MV H- ATU, udføre Sanger sekventering med de følgende primere: H-9018 [fremad primer, bindes til MV genom holdning 9018 H åben læsning frame (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (reverse primer, bindes til MV genom position 9249 i L ORF): 5' CAGATAGCGAGTCCATAACGG 3'.

2. redning rekombinant mæslinger viruspartikler kodning hæmmende

  1. [O] generere rekombinant viruspartikler fra (anti-) genomisk DNA via Transfektion af virus producent celler efter standard protokol for de respektive virus. Følg retningslinjerne for arbejde under sterile forhold. Udføre cellekultur under emhætter, navnlig alle skridt involverer virus i klasse II biologiske sikkerhed kabinetter.
    1. [M] for redning af mæslinger vira fra cDNA23,24, plade MV producent (afrikansk green monkey nyre-afledt Vero) celler jævnt på en 6-godt plade 24 timer før Transfektion. Frø 2 x 105 celler i 2 mL Dulbeccos modificerede Eagle Medium (DMEM) som indeholder 10% føtal bovint serum (FBS) pr. brønd at nå 65 – 75% confluency på tidspunktet for Transfektion.
      Bemærk: [P] reducere celle numre, hvis cellerne vokse hen over før virus-induceret syncytia dannelse.
    2. [P] Transfect cellerne med DNA kodning viral anti-genom, kræves helper plasmider, og hvis det ønskes, et plasmid kodning en fluorescerende reporter at vurdere Transfektion effektivitet.
      1. [M] Mix 5 µg af rekombinant DNA kodning mæslinger virus anti-genom, 500 ng pattedyr udtryk plasmider kodning mæslingevirus N og L proteiner og 100 ng plasmider kodning P protein og en fluorescerende reporter i en samlet maengde paa 200 µL DMEM.
      2. Tilføje 18.6 µL liposomal Transfektion reagens, straks mix ved at bladre til røret, og Inkuber i 25 min. ved stuetemperatur (RT).
      3. [P] Udskift mediet med 1,8 mL af DMEM, 2% FBS, 50 µg/mL kanamycin (eller andre antibiotika til at forhindre forurening) pr. brønd, derefter tilføje Transfektion mix dråbevis til brønden og swirl omhyggeligt. Inkuber celler natten over ved 37 ° C, 5% CO2. Erstatte medium med 2 mL frisk DMEM, 2% FBS og 50 µg/mL kanamycin den næste dag; Gentag dette når mediet bliver sure.
        Forsigtighed: [O] håndtere celler og materialer efter biosikkerhed forordninger, som virus kan være til stede fra Transfektion gennem følgende trin. Bortskaffe (potentielt) smittefarligt affald korrekt.
  2. [P] indsamle og udbrede viruspartikler.
    1. [P] observere celler dagligt ved mikroskopi for reporter gen expression og syncytia dannelse (figur 4). Høste virus når store syncytia, bestående af 20 eller flere celler, der er synlige, eller når celler bliver alt for tæt (dvs.., når de begynder at vokse i flere lag, typisk efter 7-9 dage).
      Bemærk: [P] Hvis ingen syncytia er observeret for en given vektor konstruktion, betyder dette ikke nødvendigvis at undsætning mislykkedes. Da smitsomme virus kan alligevel være til stede i prøven, overføre til frisk producent celler til passaging.
    2. [P] frø ca 1.5 x 106 producent celler i 12 mL af DMEM med 10% FBS, på 10 cm retter 24 timer før den forventede høst eller 2,5 x 106 celler pr. plade 4 – 6 h før passaging af virus at nå 65-75% confluency på tidspunktet for virus inoculat ion.
    3. [P] for at indsamle virus afkom, forsigtigt skrabe vedhængende producent celler fra pladen ved hjælp af en celle skraber og overføre supernatanten der indeholder celler til et centrifugeglas. Fjern celle debris ved centrifugering i 5 min på 2.500 x g og 4 ° C.
      Bemærk: Skrabede celler kan overføres direkte uden centrifugering at maksimere virus fremførsel suboptimal dyrkningsbetingelserne og potentielle mikroskopi artefakter.
      Forsigtig: [O] undgå spilde media når skrabning celler. Minimere aerosoldannelse.
    4. [P] forberede inokulum ved at blande den celle-fri supernatanten fra trin 2.2.3 med serumfrit medium til et sidste bind af 4 mL. Erstatte medium på producent celler af inokulat og inkuberes celler i mindst 2 timer ved 37 ° C og 5% CO2. Tilføj 6 mL af DMEM med 10% FBS og inkuberes celler natten før du ændrer mediet til 12 mL frisk DMEM med 10% FBS.
    5. [P] observere celler mindst to gange dagligt og høst virus før syncytia burst (dvs., når membranen forstyrrelser bliver synlig). For at høste den første passage af virus, fjerne supernatanten fra pladen, tilføje 600 µL i serumfrit medium, skrabe celler med en celle løfteren og overføre til en ren rør.
      Bemærk: [M] afhængig af virus stamme51,52 og progression af infektion, skal du overføre plader med inficerede celler til 32 ° C til lette viral replikation og spredning. I almindelighed, udbrede MV Schwarz stammer godt ved 37 ° C, mens overførsel af celler inficeret med Edmonston B stamme vira til 32 ° C resulterer i langsommere syncytia dannelse, men højere titers.
      Bemærk: [P] Tillad ikke cellelag tørre under høsten, da dette vil resultere i reducerede smitteevne af virale partikler. Selv om nogle virus er tabt, når udsmid supernatanten af inficerede celler, kan højere titers fås fra cellelag.
    6. [P] straks fryse virussuspension i flydende kvælstof. Opbevares ved-80 ° C i mindst 24 timer til at sørge for grundig frysning. Udvide til flere dage at afbryde proceduren, hvis det er nødvendigt.
    7. Frigive viruspartikler ved optøning ved 37 ° C. Der homogeniseres ved vortexing, og der centrifugeres i 5 min på 2.500 x g og 4 ° C. Overføre analysere til mærket cryotubes og opbevares ved-80 ° C.
      Bemærk: [O] gemme virus i alikvot størrelser passende til senere forsøg, som de er fortrinsvis optøet kun én gang og bruges straks. [P] yderligere fryse-tø cykler eller opbevaring ved 4 ° C over flere dage resulterer i betydelig reduktion af viral titers.
    8. [P] en dag før yderligere passaging for at opnå nødvendige mængde og titer, frø 4 x 106 producent celler i 12 mL af DMEM med 10% FBS på 15 cm retter. Podes med virus på en mangfoldighed af infektion (MOI) af 0,03. Inficere i 8 mL i serumfrit medium pr. plade og ændre medium til DMEM med 10% FBS efter inkubation celler for mindst 2 h. skala op ved hjælp af flere plader.
    9. Høst som beskrevet i trin 2.2.5, når syncytia har spredt over det hele cellelag. Pool opnåede suspensioner i 50 mL rør og proces, som beskrevet i trin 2.2.6–2.2.7.
      Bemærk: [O] det er afgørende at kontrollere alle plader visuelt for bakterie- og svampeinfektioner forurening før høst. Generelt check alle cellelinjer regelmæssigt for kontamination med mycoplasma eller utilsigtet virus ved multiplex PCR.
  3. [P] Evaluer viral titers. Bestemme titers over viruslagrene i octuplicates pr. alikvot ved hjælp af 96-brønd plader. Udføre titrering af tre enkelte delprøver pr. virus rednings og bruge den gennemsnitlige værdi til at beregne mængden virussuspension anvendes i eksperimenter.
    1. [P] pool producenten celler, tælle, og Juster til 1.5 x 105 celler pr. mL i DMEM med 10% FBS.
    2. [P] afpipetteres 90 µL af DMEM med 10% FBS i hvert hul i en 96-brønd plade.
    3. [P] tilføje 10 µL fra en alikvot af virus materiel til alle 8 brønde i den første kolonne af pladen og blandes grundigt af pipettering op og ned på mindst 10 gange.
    4. [P] udføre seriel 10-fold fortyndinger af virus. Overfør 10 µL af hver brønd fra først til den anden kolonne ved hjælp af en multikanals pipette. Blandes grundigt ved pipettering op og ned og bruge friske pipette tips for hver fortynding trin. Kassér 10 µL fra hvert hul i den sidste kolonne.
      Bemærk: Hver 96-brønd plade giver mulighed for 12 seriel fortynding trin. [M] for MV vektorer, 8 trin af 10-fold fortyndinger er normalt tilstrækkeligt, som titers over 1 x 109 celle smitsomme enheder (ciu) /mL er sjældent fremstillet ved metoden til formering beskrevet taktfast 2.2. [P] kontrolhullerne uden virus kan anvendes til sammenligning og at overvåge forurening.
    5. [P] Tilsæt 100 µL af cellesuspension til hver brønd og inkuberes ved 37 ° C, 5% CO2 for 48 h. sikre fravær af celle klumper i suspension at opnå homogen fordeling af celler.
    6. [P] kontrol for syncytia bruger et lysmikroskop. Tælle syncytia i hvert hul i kolonnen med den højeste fortyndingsfaktoren som indeholder synlige syncytia.
    7. [P] beregne det gennemsnitlige antal syncytia pr. brønd i den pågældende kolonne ved at dividere det samlede antal syncytia med otte. Multiplicere gennemsnittet med fortyndingsfaktoren af den respektive kolonne, startende fra 102 ciu pr. mL til den første kolonne53 (Se figur 5 som eksempel).

3. bestemmelse af Replicative og cytotoksiske kapacitet af virale vektorer kodning hæmmende

  1. [O] sammenligne replikation kinetik af den genererede rekombinant virus og de uændrede vektor med et-trins eller Multi-trins vækstkurver (GCs). Et-trins GCs, er viral afkom vurderet efter samtidige infektion i alle celler (teoretisk, 100% infektion). Multi-trins GCs start på en lav procentdel af inficerede celler til at følge flere runder af virus replikering.
    1. [M] for analyse af mæslinger virus replikation kinetik, frø 1 x 105 Vero celler i 1 mL af DMEM med 10% FBS pr. brønd på 12-godt plader en dag før infektionen. Plade mindst to brønde for hvert tidspunkt af interesse som tekniske replikater.
    2. [O] inficere celler med virus på lav MOI til Multi-trins eller højt MOI for et-trins GCs [M] (0,03 og 3 MV replikering på Vero cellerne, henholdsvis). Erstatte medium med 300 µL af serumfrit medium indeholdende de respektive beløb af virus og inkuberes ved 37 ° C og 5% CO2 for mindst 2 h. Fjern inokulum, der tilsættes 1 mL af DMEM med 10% FBS, og fortsætte inkubation.
    3. [P] på relevante timepoints som 12 høste 24, 36, 48, 72 og 96 timer efter infektion, viral afkom af direkte skrabning celler i mediet. Overføre indholdet fra hver brønd til en individuel tube, snap-freeze i flydende nitrogen og opbevares ved-80 ° C indtil titrering.
      Bemærk: [P] Kontraprøverne, der udtages kan samles på dette trin til analyse af gennemsnitlige titers.
    4. [P] indsamle prøver fra alle timepoints. Tø samtidigt ved 37 ° C for vurdering af viral afkom. Vortex og pellet celle debris ved centrifugering i 5 min på 2.500 x g og 4 ° C.
    5. [P] beregne gennemsnitlige titers hver konstruktion og tidspunkt som beskrevet ovenfor. Plot titers over tid. Sammenlign vækstkurver af vektorer med og uden indsatte transgener, med forskellige transgener, eller transgener indsat på forskellige positioner (Se fig. 6A).
  2. [O] sammenligne lytisk aktiviteter af Immunmodulator-kodning og umodificeret virus.
    1. [O] Vælg fra mulige metoder herunder impedans målinger, laktat dehydrogenase (LDH) frigive assay, eller stofskifte-baserede kolorimetriske cellernes levedygtighed undersøgelser [f.eks., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) og 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT)-undersøgelser vedrørende].
      1. [M] for at analysere cytotoksicitet af mæslinger assay virus vektorer ved hjælp af XTT, frø Vero celler som beskrevet i trin 3.1.1. Omfatte replikater af en ikke-inficerede kontrol for hvert tidspunkt.
        Bemærk: [O] udfører XTT assay på forskellige timepoints på den samme prøve kan begrænse tekniske fejl, men gentagen vask og eksponering for XTT reagens påvirker antallet af levedygtige celler. Impedans giver en alternativ udlæsning til kontinuerlige målinger.
    2. [M] inficere Vero celler på et MOI 1 som beskrevet i trin 3.1.2.
      Bemærk: [M] for infektion af mindre eftergivende målceller nogle murine tumor celle linjerne, kan en højere MOI 3 eller 5 være nødvendigt.
    3. [O] på timepoints af interesse (e.g., 12, 24, 36, 48, 72 og 96 timer efter infektion) forberede det nødvendige antal XTT reagens (dvs.., 300 µL pr. brønd plus 10% overskydende). Undgå lys eksponering.
    4. [M] på hvert tidspunkt, skal du fjerne medium fra respektive brønde. Erstatte med 300 µL XTT reagens og inkuberes ved 37 ° C i mørke. Indsamle analysere når reagens i kontrolhullerne har vendt dyb rød, som typisk tager mellem 15 min og 2 timer, og fryse ved-20 ° C.
      Bemærk: [O] inkuberingstider afhænger virus konstruktion, celletype, tæthed og cytopatisk effekt.
    5. [O] efter indsamling af alle prøver, tø samtidigt. Overføre 100 µL af hver prøve til en 96-brønd plade og måle optisk absorbans ved 450 nm, med 630 nm som en reference bølgelængde.
    6. [O] plottet timepoints (x-aksen) vs. optisk absorbans af prøver i forhold til kontrol, med angivelse af metaboliske aktivitet som et surrogat for cellernes levedygtighed (y-aksen). Faldende relativ absorbans over tid antyder viral cytotoksicitet (Se figur 6B).

4. analysere aktiviteten af Virus-kodet hæmmende udskilles fra inficerede celler

  1. [O] isoleres udskilles transgene produkter udtrykt af virus-inficerede målceller.
    1. [P] Lad virus producent celler vokse til 70% confluency i T175 kolber.
    2. [P] fjerne medium fra celler og vaskes to gange med 12 mL PBS fjerne serum. Podes celler med virus på en MOI 0,03 i 12 ml i serumfrit medium og inkuberes ved 37 ° C og 5% CO2 natten over. Erstatte medium med 12 mL frisk serumfrit medium.
      1. [M] for Edmonston B virus, skal du overføre celler fra 37 til 32 ° C 40 h for en anden 24 h inkubation at lette infektion og forebygge for tidlig sprængningen af syncytia. Afhængigt af virusstamme kan51,52 og syncytia progression, inkubation temperaturer og gange justeres til optimal protein udbytte og renhed.
    3. [P] omhyggeligt indsamle analysere uden fjernelse celler før syncytia brast. Optimalt, har syncytia spredt over det hele cellelag. Pool supernatanter i 50 mL rør.
      Bemærk: [P] til effektiv rensning af transgenet produkt, undgå sprængning af syncytia og minimere celle debris, når hovedkød analysere af inficerede celler.
    4. [P] fjerne celle debris fra supernatanten ved centrifugering i 5 min på 2.500 x g og 4 ° C og passerer gennem 0,22 µm filtre. Afhængigt af den samlede mængde af filtratet, kan dette udføres ved hjælp af en sprøjte eller en vakuumpumpe.
    5. [O] isolere transgen produkt ved hjælp af en passende rensning metode. Rense proteiner med en hexa-histidin (hans) tag af affinitet exchange kromatografi ved hjælp af Ni-NTA mini spin kolonner38 , som beskrives her i korte træk (trin 4.1.5.1–4.1.5.4).
      Bemærk: [O] udføre alle trinene hurtigt og på is. Pre chill buffere og pre cool centrifuge til 4 ° C.
      1. [O] forberede 100 mL buffer med PBS, 200 mM natriumchlorid og imidazol i endelige koncentrationer på 10 mM (vask buffer 1, WB1), 20 mM (vaskemaskine buffer 2, WB2), og 500 mM (eluering buffer, EB). Justere pH WB1 og WB2 til 8,0 og EB 7.0. Afhængigt af protein skal renses, kan imidazol koncentrationer skal justeres.
      2. [O] reagensglasset kolonner med 600 µL af WB1 og centrifugeres ved 800 x g i 2 min. med en åben låget.
      3. [O] belastning 600 µL af filtrerede analysere på kolonner. Tillade binding af hans markeret proteiner til matrixen kolonne ved centrifugering ved 200 x g i 5 min. med en lukket låg. Lastning og bindende kan gentages op til i alt 300 µg hans-mærkede protein pr. kolonne.
      4. [O] vaskes tre gange med WB1 og gang med WB2, eller indtil gennemstrømnings-er farveløs. Tilføje 600 µL af buffer og spin på 800 x g i 2 min. med åbent låg.
      5. [O] elueres protein i en frisk rør ved at udføre to eluering trin med 300 µL af EB og centrifugering for 2 min på 800 x g.
      6. [O] desalt og koncentrere produktet ved hjælp af centrifugal filtre efter produktstørrelse. Tilføje PBS til et volumen på 15 mL og filter via centrifugering i 10 min på 4.000 x g. Gentag indtil den ønskede renhed og koncentration opnås. For at øge proteinkoncentration, reducere det endelige rumfang til ca. 200 µL af centrifugering i 40 min på 4.000 x g.
  2. [O] bekræfte renhedsgrad og identiteten af produktet.
    1. [O] kvantificere mængden af total protein i isolater ved hjælp af standard kolorimetriske assays som bicinchoninic syre (BCA) eller Bradford assay54,55. [M] typiske værdier kan variere fra 1-3 µg transgen produkt pr. mL supernatanten af inficerede celler.
    2. [O] til relative kvantificering af protein isolater, adskille via sodium dodecyl sulfat polyacrylamid gelelektroforese (SDS-PAGE) og udføre Coomassie farvning56.
    3. [O] bekræfte identiteten af de oprensede produkter af immunoblotting ved hjælp af specifikke antistoffer rettet mod proteinet eller en tilhørende peptid tag57.
    4. [O] analysere protein bindende specificitet ved hjælp af passende teknikker, der kan omfatte enzymmaerket assay (ELISA) eller flow flowcytometri (Se figur 7). Celle bindende kan bekræftes ved hjælp af en nylig beskrevet magnetiske pulldown assay38.
      Bemærk: [O] bruge passende kontrol. I celle bindende assays, omfatte negative kontroller med celler, der ikke udtrykker den målrettede molekyle (som i figur 9) og ikke-targeting protein surrogater (figur 8). I flow flowcytometri eksperimenter, omfatter positive, negative og isotype kontrolelementer (figur 7).
      1. [O] co Inkuber målet celler og protein isolere for at tillade bindende. [B] for bindende analyse af BTEs til perifert blod mononukleære celler (PBMC) isoleret fra humant blod58, inkuberes 2,5 x 106 celler med 200 ng af BTE i 100 µL af PBS med 1% FBS (binding buffer, BB) i 1 time på køl.
      2. [B] vask celler med 1 mL af BB at fjerne ubundet protein. Der centrifugeres ved 300 x g i 5 min og kassér supernatanten resuspend pellet i 100 µL af BB. Tilføj biotinylated antistof rettet mod enten protein af interesse eller en tilhørende peptid tag og inkuberes i isbad i 30 min. For BTEs med influenza hemagglutinin (HA) tag, brug 100 ng af anti-HA-Biotin (klon 3F10).
      3. [B] vaske cellerne to gange med 1 mL af BB og resuspend i 80 µL af BB. Tilføj 20 µL af streptavidin-kombineret magnetiske microbeads og Inkuber i 15 min. ved 4 ° C.
      4. [B] vask en gang til at fjerne overskydende perler og resuspend pellet i 500 µL af BB suppleret med 2 mM EDTA (kolonne buffer, CB).
      5. [B] isolere celler med kolonner og en magnetisk stå efter udbyderens manual.
        1. [B] reagensglasset ved at tillade 500 µL af CB at passere igennem kolonnen af tyngdekraften flow.
          Bemærk: [B] kolonnen skal aldrig løbe tør. Med pipette overfoeres omhyggeligt og degas buffere for at undgå boblerne.
        2. [B] placere en ren rør under kolonnen og anvende celle/perle suspension til kolonnen. Vaske kolonnen tre gange med 500 µL af CB pr. vask. Indsamle gennemstrømnings-prøver af suspension og i det mindste den første vask skridt i røret og derefter gemme på is.
        3. [B] elueres perle-bundet celler opbevares af det magnetiske felt. Med henblik herpå, fjerne kolonnen fra magnetiske standeren, placere den over en ren rør, tilsættes 1 mL af CB og hurtigt skubbe buffer gennem kolonnen ind i røret ved hjælp af et stempel. Hold røret på is.
      6. [B] centrifuge rør indeholdende gennemstrømning og eluering prøver i 20 min. på 16.000 x g og 4 ° C at sammenpresse cellerne. Kassér analysere og lyse celler i en radioimmunoprecipitation-analysebuffer (RIPA) (foreslået: 75 µL). Udføre SDS-PAGE56.
      7. [B] udføre immunoblotting ved hjælp af en velegnet primær antistof. Antistoffer kan målrette transgen produkt eller en cellulære proteiner (e.g., β-actin, figur 8) at vurdere BTE-celle bindende.
  3. [O] vurdere immunologiske funktioner af isolerede hæmmende.
    1. [O] identificere relevante assays efter forholdene i de kodede Immunmodulator. Med hensyn til den forventede immunmodulerende aktivitet, kan metoder vurdering af celleproliferation, migration, modning, aktivering eller cytotoksicitet anvendes.
      Bemærk: [O] celleproliferation kan analyseres ved CFSE59 mærkning eller Ki67 farvnings-60. Transwell eller ridse eksperimenter er tilgængelig til at analysere celle migration61. Modning og aktivering af celler kan vurderes ved hjælp af passende farvningsprotokoller for respektive markører. [B] tilgængelige teknikker til at vurdere BTE-medieret cellulære cytotoksicitet omfatter impedans målinger og chrom frigive assay. Hvis vælger chrom release assay, observere ordentlig sikkerhedsforanstaltninger ved håndtering af radioaktivt materiale.
    2. [B] som en ikke-radioaktive alternativ beskriver følgende i detaljer hvordan evaluere BTE-induceret, celle-medieret cytotoksicitet af LDH release assay (tidligere beskrevet i korte38).
      1. [B] beslutte på betingelser, der skal testes under eksperimentet (Se figur 9 som et eksempel). Timepoints (timer til dage), koncentrationer af Immunmodulator (pg/mL til µg/mL) og effektor til target celle (E:T) nøgletal (mellem 1:50 og 50: 1, for eksempel) kan varieres. Altid forberede prøverne i tre.
      2. [B] omfatter prøver uden protein og uden effektor celler, frigive styringer til spontan LDH typer enkelt celle (Tsp og Esp), en celle maksimale lysis destinationskontrolelementet (Tmax) med vaskemiddel tilføjet før udlæsning, en medium kun kontrol, og en volumenkontrol for Tmax.
        Bemærk: [B] krævede antal målceller og inkuberingstider kan variere. Udføre indledende test kører uden effektor celler og hæmmende at identificere optimale parametre. Omfatte Tsp og Tmax prøver og tilsvarende kontrolelementer til at vurdere forskellige celle numre og timepoints.
      3. [B] isolere immun effektor celler fx ved (tæthed gradient centrifugering af humant blod at opnå PBMC58 ) eller negativ udvalg af murine T celler fra mus splenocytes62.
      4. [B] frø målrette celler efter trin 4.3.2 (f.eks., 5 x 10³ pr. brønd) i en U-bunden 96-brønd plade.
      5. [B] Tilføj den isolerede protein på ønskede koncentrationer til de respektive prøver. Tilføje immun effektor celler på ønskede nøgletal. Tilføje medium til et samlet volumen på 100 µL pr. brønd.
      6. [B] Incubate for tidsrammen bestemmes i trin 4.3.2, typisk mellem 4 og 48 h (24 timer for unstimulated PBMC og 48 h for frisk isolerede murine T celler; kortere inkuberingstider kan ansøge om prestimulated immunceller), ved 37 ° C og 5% CO2.
      7. [B] 45 minutter før indsamling af prøver, tilføje 10 µL af 10 x lysis løsning til brønde, der indeholder Tmax prøver samt de tilsvarende medium. Fortsætte inkubation.
      8. [B] spin ned celler ved 250 x g i 4 min. overføre 50 µL af hver supernatanten til en flad bund 96-brønd plade. Overfør ikke celler for at undgå celle-bundet LDH.
      9. [B] forberede substratopløsning ifølge producenten. Tilsæt 50 µL til hver brønd og Inkuber i RT i mørke i 30 min, eller indtil Tmax prøver igen dyb rød.
      10. [B] Tilsæt 50 µL stopopløsning til hver brønd. Fjerne luftbobler ved centrifugering i 1 min på 4.000 x g, og manuelt med en hule nål. Måle optisk absorbans på 490 nm.
      11. [B] beregne % specifikke lysis værdier for hver prøve.
        1. [B] beregne gennemsnit for replikater af medium kontrol med og uden lysis løsning. Subtrahere opnåede værdier fra eksperimentelle prøver og Tmax og spontane slippe kontrollen, henholdsvis. Brug disse baggrundskorrigeret værdier for yderligere beregninger.
        2. [B] beregne gennemsnit for baggrundskorrigeret Tmax, Tspog Esp kontrolelementer. Bruger disse gennemsnitsværdier, giver følgende ligning procentdelen af specifikke lysis for hver prøve:

          Equation 1
        3. [B] plot % specifikke lysis værdier vs proteinkoncentration eller E:T forhold og sammenligne med de ikke-targeting kontrolprøver.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 illustrerer virkningsmekanisme af oncolytic mæslinger virus kodning bispecific T-celle ager. Et flowchart viser arbejdsprocesser af denne protokol er præsenteret i figur 2. Figur 3 viser et eksempel på en modificeret oncolytic mæslinger virus genomet. Dette giver en visuel repræsentation af de specifikke ændringer anvendes på mæslinger virus anti-genom og særlige funktioner i indsatte transgener. Typiske mæslinger virus-induceret syncytia er afbildet i figur 4. Bemærk høje celle tæthed på tidspunkt for høst rescue (A, B), der angiver, at celle antallet kan nedsættes, når gentage eksperimentet. Inkubation temperaturer og -tider kan være optimeret til passaging på Vero celler (C, D) at opnå bedre spredning af syncytia hele pladen. Figur 5 repræsenterer resultatet af en typisk titrering assay. I figur 6, one-step vækstkurver (A) og relative cellernes levedygtighed (B) efter podning med uændrede (MV) og BTE-kodning er oncolytic mæslinger virus (MV-H-mCD3xhCD20) vist. Mens vækstkurver for de sammenlignede vektorer på Vero celler vises lignende, halter lytisk aktivitet af virussen transgen-kodning bagefter i murine tumor cellelinje. Flow flowcytometri data af antigen-udtrykker target-cellerne inkuberes med BTEs ved fem forskellige fortyndinger er fastsat i figur 7, der angiver BTE binding af celler i en koncentration-afhængige måde. Figur 8 repræsenterer en eksemplarisk immunblot efter magnetiske pulldown BTE-associerede celleområde. Pulldown med ikke-targeting BTEs (n1, n2) ikke give påviselige mængder af celler, mens bands i eluering brøkdel, vejledende af bundne celler, blev observeret for målretning BTE prøver (t1, t2). BTE-medieret, target antigen-specifikke og koncentration-afhængige cytotoksicitet af murine T celler er angivet med en repræsentativ LDH release assay i figur 9.

Figure 1
Figur 1 : Virkningsmekanisme af oncolytic mæslinger virus kodning en bispecific T-celle engager (MV-BTE). Infektion af en tumor celle (inficeret: grå, ikke-inficerede: lys blå) med MV-BTE efterfølges af virusreplikation og spredning i hele tumor, hvilket resulterer i tumor celle lysis og immun stimulation. Samtidig BTEs [bestående af to enkelt kæder afledt af antistoffer rettet mod CD3 på T-celler (gul) og en tumor overflade antigen (blå)] produceres og udskilles lokalt af virus-inficerede celler. BTE-medieret cross-linking med tumorceller inducerer aktivering af hvile, polyklonale T celler, hvilket resulterer i yderligere tumor celle drab. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Rutediagram beskriver arbejdsgangen designe, skabe og vurdere nye virale vektorer kodning immunmodulerende transgener. Trin 1 til 4 afspejler de respektive sektioner af protokollen. Punkttegn angive relevante overvejelser og undertrin. På grund af proceduren for empirisk karakter kan justeringer eller justeringer blive nødvendige på ethvert trin i arbejdsprocessen. Derudover kan eksperimentelle resultater føre til nye hypoteser og inspirere udviklingen af yderligere vektorer eller kombination behandlinger. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Skematisk fremstilling af en mæslinger virusgenom. Øget grøn fluorescerende proteiner (eGFP) er kodet i en yderligere transskription enhed nedstrøms for rækkefølgen, leder (ld). N, Pedersen, M, F, H og L udpege gener kodning mæslinger virus strukturelle proteiner nucleoprotein, P protein, matrix proteiner, fusion protein, hemagglutinin protein, og stort protein (polymerase), henholdsvis som varierende udtrykt som visualiseret ovenfor. En bispecific T-celle engager (BTE) transgen indsættes en yderligere transskription enhed (ATU) nedstrøms H åben behandling ramme. Transgenet koder en Igκ leder peptid for effektiv sekretion samt influenza hemagglutinin (HA) og hexa-histidin (hans) protein tags til påvisning og rensning. Gener, der koder for variable heavy (VH) og lys kæde (VL) domæner af antistoffer rettet mod CD3 og CD20, henholdsvis er forbundet via peptid linker sekvenser der indeholder glycin (G) og serin (S) restkoncentrationer. Transgenets sekvens er indledes med en Kozak-sekvensen. Neden for den kodende region, yderligere nukleotider har medtaget eksemplarisk at overholde reglen om seks. Insert kassette er flankeret af to begrænsning websteder muliggør indsættelse i de respektive ATU. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Mæslinger virus-induceret syncytia. (A, B) Vero celler blev transfekteret med cDNA for redning af rekombinant mæslinger virus kodning forbedret grøn fluorescerende proteiner (eGFP) og en bispecific T-celle engager (BTE) rettet mod murine CD3 og menneskelige CD20. Tilstedeværelsen af en fluorescerende syncytium (hvide pile) angiver vellykket redning af smitsomme virus. (C, D) Mæslinger virus blev høstet efter redning og formeres på Vero celler (passage 1). Store syncytia har dannet og er allerede begyndt at briste (gule pile). Billeder blev erhvervet af fasekontrast (B, D) og Fluorescens mikroskopi efter excitation til 80 ms (A) og 100 ms (C). Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5 : Repræsentant resultat af en titrering assay. Titrering af en tredje-passage batch af MV-H-mCD3xhCD20, en BTE-kodning oncolytic mæslingevirus, på Vero celler. En 10-fold seriel fortynding blev udført på en 96-brønd plade, begyndende med 10 µL virussuspension i hvert hul i kolonne 1. ingen syncytia var synlige i kolonne 7, som angivet af nuller. For den næste laveste fortynding virussuspension i kolonne 6, blev gennemsnitligt seks syncytia pr. brønd observeret, hvilket resulterer i en endelig titer på ca. 6 x 107 celle smitsomme enheder (ciu) pr. mL virussuspension. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6 : Replikation kinetik og lytisk aktivitet af rekombinant mæslinger vira. (A) One-step vækstkurver blev genereret efter infektion af Vero celler med uændrede oncolytic mæslingevirus (MV) eller mæslingevirus kodning en bispecific T-celle engager (MV-H-mCD3xhCD20) på et MOI af 1. Titers viral afkom blev evalueret på udpegede timepoints efter infektion, der viser lignende virus replikation kinetik. Betyder, og standardafvigelser af otte prøver (fire tekniske replikater hver af to biologiske replikater pr. tidspunkt) er vist. (B) celle levedygtighed blev vurderet på MC38 murine colorectal karcinom celler stabilt udtrykker menneskelige carcioembryonisk antigen og MV receptor CD46 (MC38-CEA-CD46) efter podning med medium eneste (mock) eller angivne virus ved et MOI af 1. XTT celle levedygtighed analyse blev udført på angivne timepoints. Reduktion i cellernes levedygtighed blev observeret på tidligere timepoints for den umodificerede vektor. Værdier på over 100%, beregnet for MV-H-mCD3xhCD20 på 12 timer tidspunkt, overholdes ofte kort tid efter infektion, som kan skyldes cellulært stress eller celle-afledte faktorer til stede i virussuspension. Middelværdier samt standardafvigelser i tre tekniske replikater er vist for hvert tidspunkt. Venligst klik her for at se en større version af dette tal.

Figure 7
Figur 7 : Target cell binding af bispecific T-celle ager (BTEs) udtrykt fra mæslinger virus-inficerede celler. Menneskelige mantle celle lymfom celler endogent udtrykker CD20 (Granta-519) var rugede med Humant immunglobulin G at blokere Fc receptorer, efterfulgt af inkubation med 2, 4, 6, 8 eller 10 µL (A) af renset mCD3xhCD20 BTE løsning, henholdsvis. BTE-bundet celler blev registreret bruger phycoerythrin (PE)-konjugeret antistof rettet mod den BTE-associerede HA-tag. Procenter af farvede celler korreleret med BTE koncentrationer. (B) kontrolelementer for selektivitet og specificitet af bindende. Vist her er kontrol fra en uafhængig eksperiment, herunder et udsnit af celler ikke inkuberes med BTE men BTE-targeting antistoffet kun (kontrol for uspecifik bindende antistof til celler) eller en BTE, der er kendt for at binde sig til celler af interesse , efterfulgt af inkubation med enten BTE-targeting antistof (positiv kontrol) eller en isotype antistof. Hvis tilgængelige, isogene celler ikke udtrykker target-antigen af valg kan bruges til at kontrollere yderligere bindende selektivitet. Venligst klik her for at se en større version af dette tal.

Figure 8
Figur 8 : Magnetisk pulldown af menneskelige perifere blod mononukleære celler (PBMC) bundet af mæslinger virus-kodet BTEs. Celler var inkuberes med to forskellige batches af human T-celle-målretning (t1, t2) eller ikke-målrettet kontrol BTEs (n1, n2), henholdsvis. BTE-bundet celler blev bevaret på kolonner ved hjælp af magnetiske perler, pelleted og mængden. Β-actin i lysates blev opdaget af immunoblotting. Intensiteter af bands i eluering prøver indikere relative BTE-celle bindende. Gennemstrømnings-prøver bekræfter tilstedeværelsen af celler i alle prøver. Venligst klik her for at se en større version af dette tal.

Figure 9
Figur 9 : Cytotoksisk aktivitet af mæslinger virus-kodet BTEs. Mål tumorceller (5 x 10³ B16-CD20-CD46 celler pr. brønd) blev inkuberet med murine T celler i forholdet 1:50. BTEs tidligere renset fra supernatanten MV-H-mCD3xhCD20-inficerede celler blev tilføjet på angivne koncentrationer. Relative lysering af target-cellerne blev vurderet af LDH release assay efter 48 h. celler mangler BTE målrette antigen (B16-CD46) fungerede som reference til at vurdere antigen-specifikke cytotoksicitet. Midler plus standardafvigelser i tre tekniske replikater pr. sample er vist. Antigen-udtrykker målceller var specifikt mængden i en BTE koncentration-afhængige måde. Renhed af BTE produkt og target antigen udtrykket niveauer indflydelse celle drab. I det foreliggende eksempel, blev 15% specifikke celle drab opnået ved en relativt høj BTE koncentration på 1 µg/mL. Dette er en typisk værdi for sådan en eksperimentel opsætning med lang Co inkuberingstider og suboptimal T celle kultur betingelser. I andre indstillinger, blev op til 60% specifikke drab opnået ved hjælp af BTEs renset fra MV-inficerede analysere, at nå et plateau på BTE koncentrationer af 100 ng/mL og højere38. Dette indikerer, at counter-intuitively, grænsen for denne analyse er mindre end 100% specifikke drab, som kan forklares med forskellige vækst kinetik i Tmax kontrol i forhold til co kultur prøver. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolytic immunterapi (dvs.., OVT i kombination med immunomodulation) holder meget lovende til behandling af cancer, kræver yderligere udvikling og optimering af oncolytic virus kodning immunmodulerende proteiner. Denne protokol beskriver metoder til at generere og validere sådanne vektorer til efterfølgende test i relevante prækliniske modeller og potentielle fremtidige kliniske oversættelse til nye anti-cancer terapi.

Mange forskellige oncolytic virus platforme med forskellige fordele er tilgængelige63. Ud over kræft specificitet, vektor sikkerhed, krav til fremstilling, effektivitet i tumor celle lysis og induktion af immunrespons er kloning kapacitet nøglen til vellykket vectorization af hæmmende ved hjælp af en specifik oncolytic. Desværre, direkte sammenligninger af forskellige OVs mangler i øjeblikket og bør forfølges for at identificere optimale behandlingsmuligheder for enkelte patienter. Dette kan fremmes ved at fremme en rationel udvikling og afprøvning af nye transgen-kodning vektorer, som eksemplificeret her for MV-BTE. I betragtning af de gavnlige egenskaber af MV (dvs., oncotropism, sikkerhed, fusogenicity, immunogenicitet, gennemførligheden af genetisk modifikation) fokuserer denne protokol på denne oncolytic vektor, der kan generaliseres til andre OV, især paramyxovirus .

For et rationelt valg af potentielt relevante hæmmende som kandidat transgener (trin 1.1.1) er en grundig forståelse af kræft-immunitet cyklus væsentlige, hvilket gør systematisk litteratur forskning uundværlige. Derudover omfattende skærme, selv dyrt, kan vise sig værdifulde til at identificere nye mål (f.eks. Se Patel et al.41).

Design af rekombinant OVs betragtes ønskede udtryk profiler. I tilfælde af RNA-vira styres Gen-ekspression på RNA niveau af de respektive polymerase. Når du udformer transgen kassetter til indsættelse i MV genomer (trin 1.1.2), er undgå sekvenser, der ligner MV polymerase gen start/stop signaler og RNA redigering websteder og følgende regel seks afgørende for vellykket vektor udvikling. Derudover svarer paramyxovirus gen expression niveauer til positionering inden for genom, der er resultatet af et udtryk gradient43. I almindelighed, øger positionering af transgenet i en upstream holdning udtryk på bekostning af reduceret replikering. Men disse parametre afhænger også størrelse, struktur og rækkefølge af de respektive transgenet. En begrænsning af den metode, der beskrives i denne protokol er derfor behovet for empirisk afprøvning af nye vektor design. I specifikke tilfælde, justeringer af transgenet sekvens eller positionering kan være nødvendigt at opnå ønskede vektor karakteristika (figur 2). Systematisk sammenligning af forskellige holdninger til checkpoint antistof indsætter viste optimale resultater for H- ATU (ikke-offentliggjorte data). BTE skær har tilsvarende egenskaber (størrelse og immunoglobulin domæner), MV-BTE vektorer blev klonet analogt38.

Redning af smitsomme partikler fra virus cDNA (trin 2.1) kan kræve adskillige forsøg for nogle konstruktioner. Justere celle numre kan optimere celle tæthed for syncytia dannelse. Mens en bestemt tæthed er nødvendig for effektiv celle til celle spredning og fusion af cellemembraner, reducerer kontakt hæmning viral replikation. Yderligere, kan antallet af smitsomme partikler ikke være tilstrækkelig til at fremkalde synlige cellefusion. Men som virus kan være til stede i mangel af syncytia, rescue prøver kan alligevel høstes og overført til frisk producent celler til potentielle formering. Ineffektiv Transfektion på grund af dårlig DNA kvalitet eller uegnet eller forringet Transfektion reagenser repræsenterer typiske problemer, der er relativt let at vurdere og afhjælpe ved at generere nye DNA præparater og afprøve forskellige reagenser, henholdsvis.

Vellykket virus formering (trin 2.2) er afgørende afhængig af betingelserne bestemmelse af virusreplikation og celle lysering. Anbefales at bruge lav passage tal i producent celler, og inficerede celler skal jævnligt kontrolleres for syncytia progression. Justere celle numre, kan temperaturer og inkuberingstider være påkrævet at afbalancere viral spredning vs. celledelingen.

En afgørende begrænsning af metoden beskrevet af virus produktion er forberedelsen af virus suspensioner fra rå cellelysater. Forskere skal være opmærksom på, at virussuspension indeholder cellulære faktorer. Viruspartikler kan være koncentreret via tæthed farveforløb/saccharose pude ultracentrifugering på bekostning af samlede antal smitsomme partikler og også potentielt stigende koncentrationer af cellulære rester. Virus kan også være koncentreret fra inficerede celle analysere, øge renhed, men at reducere samlede udbytte. GMP og stor skala produktion af paramyxovirus udføres typisk ved hjælp af flere lag af producent celler seedede på en glødetråd netto i bioreaktorer for øget titer udbytte63. Nøjagtig overvågning, kontinuerlig medier udveksling, serumfrit betingelser og efterfølgende filtrering trin sikrer høj renhed af producerede virus.

Evaluering af viral titers (trin 2.3 og 3.1) via de beskrevne syncytia tælle metode er ikke præcis, men det er let at udføre og tilstrækkeligt præcise, når ved hjælp af passende antal tekniske replikater. Når de evaluerer OV-medieret cytotoksicitet (trin 3.2), skal begrænsninger af rådighed assays overvejes. Metaboliske assays skelner ikke mellem cytostatiske og cytolytisk effekt af eksperimentelle behandlinger. For at måle cytolysis, kan en LDH release assay udføres. Begge typer af assays kan dog påvirkes af indholdet af virus præparater fra rå cellelysater (figur 6).

Isolering af proteiner udtrykt af virus-inficerede celler (trin 4.1) kan variere meget i udbytte og renhed, afhængigt af de respektive transgenet og virus, som benyttes såvel som tekniske nøjagtighed. Kvalitetskontrol af protein oprensning er således afgørende for vurderingen af relaterede eksperimentelle resultater.

Som en udtømmende beskrivelse af potentielle funktionelle assays dækker den brede vifte af mulige hæmmende ligger uden for rammerne af denne publikation, fokuserer denne protokol på ex vivo metode til at måle cellulære cytotoksicitet (trin 4.3). Cellulære cytotoksicitet, især af CD8 + T celler, er en vigtig mediator af immunologiske tumor kontrol i vellykket immunoterapi64. Dette har stor betydning for aktuelle immunterapi tilgange ved hjælp af antistoffer til at forbedre anti-tumor immunrespons i almindelighed og bispecific T-celle ager i særdeleshed. Lokale BTE udtryk af oncolytic vektorer har givet lovende resultater i flere prækliniske undersøgelser, herunder RNA38 og DNA virus65,66,67,68.

På grund af de komplekse vekselvirkninger mellem tumor, virus, transgen produkt og vært immunsystemet i levende organismer, validering af Immunmodulator-kodning oncolytic vektorer i cellekultur som vist her ikke er tilstrækkelige til at forudsige terapeutiske resultater. Vigtigere, den foreslåede isolerede vurdering af vektor- og Immunmodulator funktioner henholdsvis, er afgørende for påvisning i id men undlader at beskrive potentielle synergieffekter og komplekse samspil i tumor mikromiljø. Test for toksicitet og effektivitet i relevante in vivo modeller er afgørende for yderligere udvikling af roman rekombinant vektor konstruktioner men opnås ikke nemt. Immunologiske sikkerhed overvåges regelmæssigt i ikke-menneskelige primater såsom makakaber, og musemodeller bruges til biodistribution og effekten analyserer20,69. Men mange af disse modeller har begrænsninger vedrørende udtryk for virus receptorer i værten væv og vært eftergivenhed, og nogle kun utilstrækkeligt efterligner det komplekse samspil mellem OV, tumor, og den immun mikromiljø. Således er nøje overvejelse af passende modeller obligatorisk.

MV-BTE behandling er tidligere blevet evalueret i menneskelige xenograft og syngeneic musemodeller. Ingen BTE transgene produkter var påviselige i serum i mus behandlet med BTE-kodning MV38, der angiver vellykket forebyggelse af systemisk eksponering selv uden yderligere dæmpning af den naturligt oncotropic vaccine stamme virus. Lokale udtryk er afgørende for OV-kodet hæmmende, som er giftige når de gives systemisk. Hvis det er nødvendigt, kan tumor specificitet forbedres ved fornyet målretning til celle celleoverflademarkører valg70,71,72 og de-mikroRNA-baseret målretning for forbedret oncotropism73,74 ( Anmeldt af Ruiz og Russell75). Yderligere ændringer kan indføres for at optimere vektorer for specifikke terapeutiske anvendelser (revision af Miest og Cattaneo76), herunder indsættelse af transgener til diagnosticeringsformål77,78 eller prodrug konvertering til at minimere bivirkninger af kemoterapi79,80, indførelsen af sikkerhed skifter81, og målretning af tumor stroma eller Vaskulaturen (f.eks. via bispecific antistoffer82).

Bortset fra genetiske modifikation af den virale vektor, kombination regimer med kimære antigen receptor (bil) T celle overføre83, kemoterapi84,85,86eller strålebehandling87, 88 , 89 yderligere udvide repertoiret af OVT. Som MV immunitet er meget udbredt, strategier til at omgå antistof neutralisering har udviklet, herunder udveksle kuvert glykoproteiner for dem af relaterede paramyxovirus90, polymer belægning af partikler, ved hjælp af celle luftfartsselskaber til levere virus og forbigående immunosuppression (anmeldt af Russell et al.6). Videreudvikling af avancerede OV immunterapi regimer kræver test af sikkerhed og terapeutiske effekt i passende dyremodeller med patient materiale, og i sidste ende, i kontrollerede kliniske forsøg.

I betragtning af overfloden af mulige kombinationer, er omfattende test ikke mulig. Matematisk modellering kan støtte i prioriteringen af potentielle kombination regimer samt deres respektive dosering og planlægning ved at forudsige behandlingsresultater i siliciummangan (anmeldt af Santiago et al.91). Når du tester efficacies af roman, rationelt designet vektorer, lyd ledsager Translationel forskning er medvirkende til en dybere forståelse af underliggende virologiske og immunologiske processer. Dette er afgørende for generation af passende modeller, oplysninger om yderligere potentielle mål og avancement i feltet i almindelighed. Afslutningsvis vil førstehånds indsigt i relevante metoder til vektor design, produktion og karakterisering i denne linje af arbejdet fremskynde udvikling og støtte udforskning af roman therapeutics for fremtidige kliniske oversættelse.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.E. Engeland er opført som medopfinderen af en patent angående RNA-vira til kræft Immunovirotherapy ejes af Heidelberg Universitet. J.P.W. Heidbuechel har intet at videregive.

Acknowledgments

Disse metoder blev etableret i gruppen Virotherapy, ledet af Prof. Dr. Dr. Guy Ungerechts på det nationale Center for Tumor sygdomme i Heidelberg. Vi står i gæld til ham og alle medlemmer af teamet laboratorium især Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler og Jessica Albert. Dette arbejde blev støttet af andet Kröner-Fresenius-Stiftung (Grant 2015_A78 til C.E. Engeland) og tysk National Science Foundation (DFG, give C.E. Engeland da 1119/2-1). J.P.W. Heidbuechel modtager et stipendium af Helmholtz International Graduate School for kræftforskning.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics