Paramyxovirus pour tumeur ciblées Immunomodulation : conception et évaluation Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Ce protocole décrit un flux de travail détaillé pour la génération et ex vivo de caractérisation des virus oncolytiques pour l’expression des immunomodulateurs, en utilisant le codage bispécifiques lymphocytes T recruteurs comme un exemple de virus de la rougeole. Application et l’adaptation à d’autres plates-formes de vecteur et les transgènes vont accélérer le développement de nouveaux immunovirotherapeutics pour la traduction clinique.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Immunothérapie des cancers réussie a le potentiel pour obtenir un contrôle tumoral à long terme. Malgré des succès cliniques récentes, il reste un besoin urgent de traitements sûrs et efficaces adaptés aux profils immunitaire de chaque tumeur. Virus oncolytiques permettent l’induction de la réponse immunitaire anti-tumorale ainsi que l’expression des gènes de tumeur restreints. Ce protocole décrit l’analyse de génération et ex vivo des immunomodulateurs oncolytiques vecteurs. En se concentrant sur les virus de la rougeole vaccin encodage bispécifiques lymphocytes T recruteurs à titre d’exemple, la méthodologie générale peut être adaptée à d’autres espèces de virus et de transgènes. Le flux de travail présenté comprend la conception, clonage, sauvetage et la propagation des virus recombinants. Dosages pour analyser la cinétique de la réplication et l’activité lytique du vecteur, ainsi que des fonctionnalités de l’isolé immunomodulateur ex vivo sont inclus, ce qui facilite la génération de nouveaux agents de développement dans les modèles précliniques et finalement traduction clinique.

Introduction

Virus oncolytiques (OVs) sont développés comme des thérapies de lutte contre le cancer qui spécifiquement répliquer au sein et tuer les cellules de la tumeur tout en conservant les tissus sains intacts. Il est devenu commun de comprendre cette virothérapie oncolytiques (OVT), dans la plupart des cas, ne repose pas uniquement sur la lyse tumorale complète en réplication efficace et la diffusion du virus, mais exige des mécanismes supplémentaires d’action pour la réussite du traitement, y compris vasculaire et stromales ciblage et, surtout, la stimulation immunitaire1,2,3,4. Tandis que plusieurs des premières études OV utilisé virus non modifiées, les recherches actuelles a profité d’une biologique améliorée compréhension, virus biobanques qui contiennent potentiellement roman OVs et les possibilités offertes par génie génétique afin de créer des avancées OV plates-formes5,6,7.

Vu le succès récent de l’immunothérapie, immunomodulateurs transgènes sont particulièrement intéressantes concernant le génie génétique OVs. Expression ciblée de ces produits de gène par les cellules tumorales infectées par OV réduit la toxicité par rapport à l’administration systémique. Ciblage est obtenue en utilisant des virus avec oncoselectivity inhérent ou en modifiant le tropisme viral8. Immunomodulation locale améliore les mécanismes anti-tumorale multi-facettes de OVT. En outre, cette stratégie est instrumentale dans l’interrogation de l’interaction entre les virus, les cellules tumorales et le système immunitaire. À cette fin, ce protocole prévoit un flux de travail applicable et réglable afin de concevoir, clone, sauvetage, propager et valider des vecteurs de paramyxovirus (plus précisément les virus de la rougeole) oncolytiques codant ces transgènes.

Modulation de la réponse immunitaire peut être réalisée par une grande variété de produits de transgene ciblant les différentes étapes du cancer-immunité cycle9, y compris renforcer la reconnaissance de l’antigène tumoral [par exemple, les antigènes associés aux tumeurs (AVA) ou des inducteurs de complex majeur d’histocompatibilité (CMH) de classe I molécules] plus soutenir la maturation des cellules dendritiques pour la présentation des antigènes efficace (cytokines) ; recrutement et activation des cellules immunitaires désirés comme cytotoxiques et des cellules de helper T [chimiokines, bispécifiques recruteurs de lymphocytes T (TSEI)] ; cibler les cellules suppressives comme les lymphocytes T régulateurs, cellules myéloïdes dérivés suppressives, macrophages associées à la tumeur et cancer associés aux fibroblastes (TSEI, des anticorps, cytokines) ; et prévenir l’inhibition des cellules effectrices et épuisement (inhibiteurs de point de contrôle). Ainsi, il existe une pléthore d’agents biologiques. Évaluation de ces immunomodulateurs virus-encodé en ce qui concerne l’efficacité thérapeutique et les synergies possibles ainsi que la compréhension des mécanismes respectifs est nécessaire d’améliorer le traitement du cancer.

Virus à ARN simple brin sens négatif de la famille des Paramyxoviridae sont caractérisées par plusieurs caractéristiques propices à leur utilisation en tant que vecteurs oncolytiques. Il s’agit d’une oncotropism naturelle, grande capacité de génomique pour transgènes (plus de 5 Ko)10,11, efficace de diffusion dont la formation de syncytiums et forte immunogénicité12. Par conséquent, les plates-formes OV canine distemper virus13oreillons virus14, Newcastle disease virus15, virus Sendai16,17, Simien 518et de paramyxovirus Tupaia19 ont été développés. Plus en évidence, vivre de vaccin contre le virus rougeoleux atténué souches (MV) ont progressé dans le développement préclinique et clinique20,21. Ces souches de virus ont été utilisés pendant des décennies pour la vaccination systématique avec une excellente sécurité record22. En outre, il n’y a aucun risque pour la mutagénèse insertionnelle en raison de la réplication strictement cytosolique du paramyxovirus. Un système polyvalent de génétique inverse issu des ADNc anti-génomique qui permet l’insertion de transgènes dans unités de transcription supplémentaires (ATUs) est disponible de11,23,24. Vecteurs de MV symporteur de l’iodure de sodium (MV-NIS) d’encodage pour l’imagerie et de radiothérapie ou de l’antigène carcinoembryonnaire soluble (MV-ACE) comme marqueur de substitution pour l’expression des gènes viraux sont actuellement évalués dans des essais cliniques (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 et NCT00408590). Administration sécuritaire a été confirmée et efficacité antitumorale ont été signalés dans les précédentes études25,26,27,28,29, 30 (évaluée par Msaouel et Al.31), ouvrant la voie à des virus de la rougeole oncolytiques supplémentaires qui ont été développées et testées à l’intérêt. MV encodage immunomodulatrices molécules ciblant les diverses étapes du cycle du cancer-immunité auraient dû être divulgués de ralentir la croissance tumorale et/ou prolonger la survie chez les souris, avec la preuve de leur efficacité immunitaire et à long terme mémoire immunitaire protectrice en syngénique modèles de souris. Les transgènes vecteur codé comprennent stimulant factor (GM-CSF)32,33, H. pylori Activation des neutrophiles protéine34, point de contrôle immunitaire inhibiteurs35, des colonies de granulocytes et macrophages interleukine-12 (IL-12)36, Ava37et TSEI38, qui réticuler un antigène de surface de tumeur avec CD3 et ainsi induire une activité antitumorale par les cellules T polyclonales, quel que soit T cell receptor spécificité et co-stimulation ( La figure 1). Les résultats précliniques prometteurs obtient pour ces constructions de nouveaux efforts translationnelle demande.

Talimogene laherparepvec (T-VEC), un type j’ai le virus herpès simplex encodage GM-CSF, est le seul oncolytiques thérapeutiques approuvés par l’United States Food Drug Administration (FDA) et de l’Agence européenne des médicaments (EMA). L’étude de phase III menant aux homologations en fin 2015 n'a pas seulement montré une efficacité au site d’injection intra-tumorale, mais aussi des effets abscopal (c.-à-d., les remises des lésions non injectés) dans le mélanome avancé,39. T-VEC est entré depuis lors des essais supplémentaires pour application dans d’autres entités de la tumeur (par exemple cancer de la peau non-mélanome, , NCT03458117, cancer du pancréas, NCT03086642) ainsi que l’évaluation des thérapies de combinaison, surtout avec le point de contrôle immunitaire inhibiteurs (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 et Ribas et Al.40).

Cela montre non seulement le potentiel de l’immunothérapie oncolytiques, mais aussi la nécessité de poursuivre les recherches afin d’identifier les combinaisons supérieures de OVT et l’immunomodulation. Une conception rationnelle des vecteurs supplémentaires et leur développement pour les essais précliniques est essentielle pour cette entreprise. Cela fera avancer aussi la compréhension des mécanismes sous-jacents et a des implications pour la progression vers le traitement du cancer plus personnalisée. À cette fin, cette publication présente une méthodologie pour la modification et le développement du paramyxovirus pour immunothérapie ciblée contre le cancer et, plus particulièrement du virus de la rougeole oncolytiques encodage anticorps prise avec des lymphocytes T (Figure 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Remarque : [O], [P] et [M] indiquent les paragraphes applicables à : OVs en général, (la plupart) paramyxovirus ou MV, respectivement. [B] indique les sections spécifiques pour BTE transgènes.

1 clonage de transgènes codant immunomodulateur en vecteurs de Virus de la rougeole

  1. [O] conception insérez la séquence.
    1. [O] choisir un immunomodulateur d’intérêt basé sur la recherche dans la littérature ou sur exploratoire des données tels que les écrans génétiques41 et dérivent la séquence d’ADNc pertinents des bases de données appropriées telles que GenBank, l’European Archive de nucléotide, ou la système d’information international immunogénétique (IMGT).
    2. [O] ajouter des fonctionnalités supplémentaires à la séquence du transgène (Figure 3). Une séquence de Kozak précédent et d’optimisation de codons spécifiques à l’espèce peuvent amplifier l’expression. Sequences de signaux sont nécessaires à la sécrétion. Inclure les séquences codant les tags de protéine N - et C-terminal pour la détection et la purification42. Inclure les sites de restriction pour l’insertion dans le vecteur.
      Remarque : [M] des unités de transcription supplémentaires (ATUs) contenant MV polymérase gène se mettent et signaux d’arrêt sont nécessaires pour l’expression de transgènes de génomes MV recombinants. Vecteurs de cDNA anti-génomique adapté, contrôlées par les promoteurs du CMV et ATUs contenant avec des sites de restriction uniques pour l’introduction de transgènes de sens positif aux positions définies, ont été développées précédemment11. [P] adéquate de positionnement du transgène est crucial, car il affecte l’expression réplication et transgène virale en raison du gradient de l’expression typique des paramyxovirus43. Introduction dans une ATU près de l’extrémité 3' du anti-génome (i.e., dans le poste de chef ou en aval du gène P ) donne généralement lieu à l’expression TRANSGENIQUE élevé au détriment de la réplication virale réduite. Une augmentation de la réplication et des niveaux d’expression du transgène peuvent s’attendre lorsque vous utilisez l’ATU en aval du gène H . Emballage du génome de plusieurs paramyxovirus, y compris le virus de la rougeole, requiert la liaison de six nucléotides par chaque de protéines nucléocapside44. Pour insertion de transgènes dans tels virus, faire en sorte que le nombre de nucléotides du génome complet sera divisible par six. Ceci est également dénommé « règle de six »45,46. Si nécessaire, inclure des nucléotides supplémentaires dans la notice (en amont de la séquence de Kozak ou en aval du codon stop) sans introduire des changements de cadre ou de codons stop prématurés. [M] éviter des séquences particulières dans le transgène qui ressemblent aux début de gène MV (AGGRNCMARGW) et d’arrêt des signaux (RTTAWANAAAA) et l’ARN montage de séquences (AAAAAGGG). Ces séquences consensus ont été publiés (voir, par exemple, parcs et al.,47).
    3. [O] acheter des oligonucléotides de la séquence souhaitée ou assembler des séquences disponibles à l’aide de clonage moléculaire standard48.
      Remarque : [O] pour l’amplification PCR du transgène, concevoir une amorce vers l’avant, y compris le site de restriction en amont et les premiers nucléotides de 15-20 de l’insert et une amorce inverse, y compris les derniers 15-20 nucléotides de l’insert suivies de la restriction en aval site.
  2. [O] insert clone dans l’ADN codant le génome viral (anti-).
    1. [O] cloner l’insert dans les vecteurs d’ADN ou de anti-génomes ADN de virus à ARN en norme moléculaire clonage techniques48 (p. ex., enzymatique restriction suivie par ligature d’ADN).
      1. [O] empêcher la re-ligature du vecteur en utilisant des sites de restriction non compatible ou en dé-phosphorylation avant la ligature.
      2. [O] isoler le produit de la ligature par électrophorèse sur gel d’agarose et purification subséquente de gel à l’aide de kits disponibles dans le commerce. En général, l’efficacité optimale de la ligature est atteint à un ratio de 3:1 molaire de l’insert à vector.
    2. [O] transformer le produit de la ligature en bactéries compétentes adapté pour une récupération efficace des plasmides (p. ex., effectuer un choc thermique d’e. coli49) et d’identifier des clones bactériens contenant l’ADN correct par colonie PCR50 .
    3. [O] isoler l’ADN amplifié d’un seul clone bactérien à l’aide de trousses de préparation ADN disponibles dans le commerce. Vérifier l’intégrité génomique par digest de contrôle avec des enzymes de restriction appropriées (par exemple, HindIII pour génomes MV [M]). Confirmer une insertion correcte et intégrité du transgène par séquençage.
      Remarque : [M] pour effectuent des transgènes insérés dans le MV H- ATU, Sanger sequencing avec les amorces suivants : H-9018 [amorce vers l’avant, se lie à la position de génome de MV 9018 dans le H open reading frame (ORF)] : 5' GTGTGCTTGCGGACTCAGAATC 3' ; L-9249 + (reverse primer, se lie à la position de génome MV 9249 dans l’ORF L ) : 5' CAGATAGCGAGTCCATAACGG 3'.

2. sauver les particules de Virus de la rougeole Recombinant encodage immunomodulateurs

  1. [O] générer des particules virales recombinantes de (anti-) génomique ADN via la transfection de cellules producteur virus selon le protocole standard pour le virus respectif. Suivez les directives pour le travail dans des conditions stériles. Culture cellulaire sous capot, effectuer en particulier toutes les mesures impliquant des virus dans des enceintes de sécurité biologique de classe II.
    1. [M] pour le sauvetage de virus de la rougeole du cDNA23,24, plaque producteur MV (singe vert africain rein-dérivé Vero) uniformément sur une plaque de 6 puits 24h avant la transfection des cellules. Graine 2 x 105 cellules dans 2 mL moyen de (DMEM de l’aigle de la modification de Dulbecco) contenant 10 % de sérum bovin fœtal (SVF) / puits pour atteindre confluence de 65 à 75 % lors de la transfection.
      Remarque : [P] réduire le nombre de cellules si les cellules proliférer avant la formation de syncytiums Viro-induite.
    2. [P] transfecter les cellules avec l’ADN codant les plasmides virale helper anti-génome, nécessaire, et, si vous le souhaitez, un plasmide codant un journaliste fluorescent pour évaluer l’efficacité de transfection.
      1. [M] Mix 5 µg d’ADN recombinant codant la rougeole virus anti-génome, 500 ng de chacun des plasmides d’expression mammifère encodage des virus de la rougeole N et L protéines et 100 ng de chacun des plasmides codant la protéine P et un journaliste fluorescent dans un volume total de 200 µL DMEM.
      2. Ajouter 18,6 µL de réactif de transfection liposomale, mélanger immédiatement en effleurant le tube et incuber pendant 25 min à température ambiante (RT).
      3. [P] remplacer le support par 1,8 mL de DMEM, 2 % FBS, 50 µg/mL kanamycine (ou autres antibiotiques pour prévenir la contamination) par puits, puis ajouter le mélange de transfection goutte à goutte dans le puits et agiter soigneusement. Incuber les cellules pendant la nuit à 37 ° C, 5 % de CO2. Remplacer le support avec 2 mL de DMEM fraîche, 2 % FBS et kanamycine 50 µg/mL le lendemain ; Répétez cette procédure lorsque le milieu devient acide.
        Mise en garde : [O] gérer les cellules et les matériaux selon la réglementation sur la biosécurité, car le virus peut être présent de transfection par les étapes suivantes. Éliminer correctement les déchets (infectieux).
  2. [P] recueillir et propager des particules virales.
    1. [P] observer cellules quotidiennement par microscopie pour la formation d’expression et syncytiums gène rapporteur (Figure 4). Récolter les virus quand grands syncytiums, constituées de cellules de 20 ou plus, sont visibles, ou quand les cellules deviennent trop denses (i.e., quand ils commencent à se développer en plusieurs couches, généralement après 7 à 9 jours).
      Remarque : [P] si aucun syncytiums ne sont observés dans une construction de vecteur donné, cela ne signifie pas nécessairement que le sauvetage n’a pas réussi. Comme le virus infectieux peut néanmoins être présent dans l’échantillon, transférer aux cellules fraîches producteur pour passage.
    2. [P] la graine environ 1,5 x 106 cellules de producteur dans 12 mL de DMEM avec 10 % FBS, sur 10 cm plats 24h avant la récolte anticipée, ou 2,5 x 106 cellules / plaque 4 – 6 h avant le passage du virus à atteindre confluence de 65 à 75 % au moment de l’inoculat virus ion.
    3. [P] pour collecter les descendants du virus, délicatement racler les cellules de la plaque à l’aide d’un grattoir de cellules adhérentes producteur et transférer le surnageant contenant les cellules dans un tube à centrifuger. Enlever les débris de cellules par centrifugation pendant 5 min à 2 500 g et 4 ° C.
      Remarque : Raclée de cellules peuvent être transférés directement sans centrifugation afin d’optimiser le report de virus au détriment des conditions de culture sous-optimales et éventuels artefacts de microscopie.
      Attention: Evitez de [O] renverser les médias lorsque le raclage des cellules. Réduire au minimum la formation d’aérosols.
    4. [P] préparer l’inoculum en mélangeant le surnageant acellulaire de l’étape 2.2.3 avec un milieu sans sérum pour un volume final de 4 mL. Remplacer le support sur les cellules de producteur de l’inoculum et incuber les cellules pendant au moins 2 h à 37 ° C et 5 % de CO2. Ajouter 6 mL de DMEM avec 10 % FBS et incuber les cellules pendant la nuit avant de changer le support à 12 mL de frais DMEM avec 10 % FBS.
    5. [P] Observe les cellules au moins deux fois par jour et le virus de la récolte avant l’éclatement de syncytiums (p. ex., , lorsque la rupture de la membrane devient visible). Pour récolter le premier passage du virus, retirer le surnageant de la plaque, ajouter 600 µL de milieu sans sérum, gratter les cellules avec un releveur de cellule et transférer dans un tube propre.
      Remarque : [M] selon le virus souche51,52 et la progression de l’infection, plaques avec les cellules infectées de transfert à 32 ° C pour faciliter la propagation et la réplication virale. En général, les souches Schwarz MV propagent bien à 37 ° C, alors que le transfert de cellules infectées par le virus de souche Edmonston B aux résultats de 32 ° C dans la formation de syncytiums plus lente mais des titres plus élevés.
      Remarque : [P] ne laissez pas la couche de cellules de sécher pendant la récolte, car cela se traduira par une diminution de l’infectiosité des particules virales. Bien que certains virus est perdue lorsque vous jetez le liquide surnageant des cellules infectées, des titres plus élevés peuvent provenir de la couche de cellules.
    6. [P] immédiatement geler la suspension virale dans l’azote liquide. Conserver à-80 ° C pendant au moins 24 h assurer la profondeur de gel. S’étendre à plusieurs jours d’interrompre la procédure, si nécessaire.
    7. Libération des particules virales de décongélation à 37 ° C. Homogénéiser au vortex et centrifuger pendant 5 min à 2 500 g et 4 ° C. Transférer les surnageants cryotubes étiquetés et conserver à-80 ° C.
      Remarque : [O] stocker virus aliquote tailles adéquates à des expériences ultérieures, car elles sont préférentiellement décongelées qu’une seule fois et utilisés immédiatement. [P] en outre gel-dégel cycles ou stockage à 4 ° C pendant plusieurs jours entraîne une réduction significative des titres viraux.
    8. [P] un jour avant le passage plus loin pour atteindre le montant requis et titre, 4 x 106 cellules de producteur dans 12 mL de DMEM avec 10 % de graines FBS sur des plats de 15 cm. Inoculer le virus à une multiplicité d’infection (MOI) de 0,03. Infecter dans 8 mL de milieu sans sérum par plaque et modifier milieu DMEM avec 10 % FBS après incubation des cellules au moins 2 h. échelle vers le haut à l’aide de plusieurs plaques.
    9. Récolte tel que décrit dans étape 2.2.5, quand syncytiums sont répandues à travers la couche de cellules entières. Mettre en commun les suspensions obtenues en tubes de 50 mL et processus tel que décrit dans les étapes 2.2.6–2.2.7.
      Remarque : [O] il est essentiel de vérifier toutes les plaques visuellement pour contamination bactérienne et fongique avant la récolte. En général, de vérifier toutes les lignées cellulaires régulièrement pour contamination par mycoplasmes ou virus fortuits de PCR multiplex.
  3. [P] Evaluate titres viraux. Déterminer les titres des stocks de virus d’octuplicates par aliquote à l’aide de plaques de 96 puits. Effectuer le titrage des trois aliquotes individuels par sauvetage de virus et la valeur moyenne permet de calculer la quantité de suspension virale à être utilisés dans des expériences.
    1. [P] piscine le producteur de cellules, comte et ajuster à 1. 5 x 105 cellules / mL en DMEM avec 10 % FBS.
    2. [P] ajouter 90 µL de DMEM avec 10 % FBS dans chaque puits d’une plaque de 96 puits.
    3. [P] ajouter 10 µL d’une aliquote de l’encours de virus dans tous les puits de 8 dans la première colonne de la plaque et bien mélanger en pipettant également, haut en bas, au moins 10 fois.
    4. [P] effectuer des dilutions 10 fois du virus. Transférer 10 µL de chaque puits de la première à la deuxième colonne à l’aide d’une pipette multicanaux. Mélanger soigneusement par pipetage de haut en bas et utilisez des embouts frais pour chaque étape de dilution. Jetez 10 µL de chaque puits de la dernière colonne.
      Remarque : Chaque plaque à 96 puits permet 12 étapes de dilution en série. [M] pour des vecteurs de MV, 8 étapes de 10 fois les dilutions sont généralement suffisantes, comme les titres ci-dessus unités infectieuses de 1 x 109 cellules/ml (ciu) sont rarement obtenues par la méthode de propagation décrite à l’étape 2.2. [P] contrôle puits sans virus peuvent être utilisés aux fins de comparaison et de surveiller la contamination.
    5. [P] ajouter 100 µL de suspension cellulaire dans chaque puits et incuber à 37 ° C, 5 % CO2 pendant 48 h. s’assurer que l’absence d’amas de cellules dans la suspension d’atteindre une répartition homogène des cellules.
    6. [P] rechercher les syncytiums à l’aide d’un microscope optique. Compter les syncytiums dans chaque puits de la colonne avec le plus grand facteur de dilution contenant syncytiums visibles.
    7. [P] calcule le nombre moyen de syncytiums / puits dans cette colonne en divisant le nombre total de syncytiums par huit. Multiplier cette moyenne avec le facteur de dilution de la colonne respective, à partir de 102 SDI / mL pour la première colonne53 (voir la Figure 5 par exemple).

3. déterminer la capacité réplicative et cytotoxiques de vecteurs viraux codant immunomodulateurs

  1. [O] comparer les cinétiques de la réplication du virus recombinant généré et le vecteur non modifié avec des courbes de croissance en une seule étape ou à plusieurs étapes (GCs). One-step GCs, progénitures virales sont évalués suivant l’infection simultanée de toutes les cellules (théoriquement, 100 % d’infection). Début de GCs multi-étapes à un faible pourcentage de cellules infectées de suivre plusieurs cycles de réplication du virus.
    1. [M] pour l’analyse de la cinétique de la rougeole virus replication, 1 x 105 cellules de Vero dans 1 mL de DMEM avec 10 % de graines FBS / puits sur plaques de 12 puits un jour avant l’infection. Plaque d’au moins deux puits pour chaque validant d’intérêt comme les répétitions techniques.
    2. [O] infectent les cellules par le virus à faible MOI pour plusieurs étapes ou à un MOI élevé pour une étape GCs [M] (0,03 et 3 pour la réplication de MV sur Vero cellules, respectivement). Remplacer le moyen avec 300 µL de milieu sans sérum contenant la quantité respective de virus et incuber à 37 ° C et 5 % CO2 pendant au moins 2 h. retirer inoculum, ajouter 1 mL de DMEM avec 10 % FBS et continuer d’incubation.
    3. [P] à intervalles pertinents tels que 12, 24, 36, 48, 72 et 96 heures après l’infection, récoltent des progénitures virales en grattant directement les cellules dans le milieu. Transférer le contenu de chaque puits à un tube individuel, clin d’oeil-congélation dans l’azote liquide et stocker à-80 ° C jusqu’au titrage.
      Remarque : [P] échantillons peuvent être mises en commun à cette étape pour l’analyse des titres moyens.
    4. [P] collecte d’échantillons de tous les points. Décongelez simultanément à 37 ° C pendant l’évaluation de la progéniture virale. Vortex et pellet débris cellulaires par centrifugation pendant 5 min à 2 500 x g et 4 ° C.
    5. [P] calculer la moyennes titres de chaque construction et validant comme décrit ci-dessus. Tracer des titres au fil du temps. Comparer les courbes de croissance des vecteurs avec et sans les transgènes insérés, avec différents transgènes ou transgènes insérées à différentes positions (voir la Figure 6A).
  2. [O] comparez avec activités lytiques des virus immunomodulateur-codage et non modifiées.
    1. [O] sélection à partir des méthodes possibles, y compris les mesures d’impédance, lactate déshydrogénase (LDH) libérer dosage ou des analyses de viabilité cellulaire colorimétrique axée sur le métabolisme [p. ex., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) et 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) tests].
      1. [M] pour analyser la cytotoxicité de la rougeole, vecteurs de virus en utilisant XTT assay, cellules Vero de graines comme indiqué au point 3.1.1. Inclure les répétitions d’un contrôle non infectés pour chaque validant.
        Remarque : [O] réalisation XTT essai à des intervalles différents sur le même échantillon peut limiter les erreurs techniques, mais des lavages répétés et l’exposition au réactif XTT affecte un nombre de cellules viables. Impédance fournit une lecture alternative pour les mesures en continu.
    2. [M] infectent les cellules Vero à un MOI de 1 comme indiqué au point 3.1.2.
      Remarque : [M] pour l’infection des cellules de cible moins permissives telles que certaines lignées de cellules tumorales murines, un MOI supérieur de 3 ou 5 peut être nécessaire.
    3. [O] à points d’intérêt (p. ex.., 12, 24, 36, 48, 72 et 96 heures après l’infection) préparer la quantité requise de réactif XTT (i.e., 300 µL par puits plus 10 % excès). Éviter l’exposition à la lumière.
    4. [M] à chaque validant, retirez le moyen de puits respectifs. Remplacer par 300 µL de réactif XTT et incuber à 37 ° C dans l’obscurité. Recueillir les surnageants lorsque le réactif dans les puits de contrôle a tourné rouge-foncé, qui prend généralement entre 15 min et 2 h, et congeler à-20 ° C.
      Remarque : [O] temps d’incubation dépendent de la construction de virus, type de cellules, la densité et effet cytopathique.
    5. [O] après avoir recueilli tous les échantillons, décongeler en même temps. Transférer 100 µL de chaque échantillon dans une plaque à 96 puits et mesurer l’absorbance optique à 450 nm, avec 630 nm comme une longueur d’onde de référence.
    6. [O] reporter points (axe x) vs. absorbance optique des échantillons par rapport aux témoins, ce qui indique une activité métabolique comme substitut pour la viabilité cellulaire (axe y). Diminution de l’absorbance relative au fil du temps implique une cytotoxicité virale (voir la Figure 6B).

4. analyser l’activité des Virus-encodé immunomodulateurs sécrétée par les cellules infectées

  1. [O] isoler transgène sécrétées produits exprimé par les cellules infectées par le virus cible.
    1. [P] laisser producteur virus cellules se développent à la confluence de 70 % dans des flacons de T175.
    2. [P] supprimer moyen de cellules et laver deux fois avec 12 mL de PBS pour enlever le sérum. Ensemencer les cellules par le virus à un MOI de 0,03 à 12 mL de milieu sans sérum et incuber à 37 ° C et 5 % de CO2 pendant la nuit. Remplacer moyen avec 12 mL de milieu sans sérum frais.
      1. [M] pour virus Edmonston B, cellules de transfert de 37 à 32 ° C après 40 h pour un autre 24 h d’incubation pour faciliter l’infection et prévenir un éclatement prématuré de syncytiums. Selon la souche du virus progression de52 et syncytiums51,, températures d’incubation et temps peuvent être ajustés aux pureté et un rendement optimal de protéines.
    3. [P] soigneusement collecter des surnageants sans décollement des cellules avant l’éclatement de syncytiums. Idéalement, syncytiums ont essaimé à travers la couche de cellules entières. Réunir les fractions surnageantes en tubes de 50 mL.
      Remarque : [P] pour purification efficace du produit transgénique, éviter l’éclatement de syncytiums et minimiser les débris cellulaires lorsqu’ils pêchent les surnageants des cellules infectées.
    4. [P] retirer les débris cellulaires du surnageant par centrifugation pendant 5 min à 2 500 x g et 4 ° C et en passant à travers les filtres 0,22 µm. Selon le volume total du filtrat, ceci peut être effectué à l’aide d’une seringue ou une pompe à vide.
    5. [O] isoler transgène produit en utilisant une méthode de purification appropriées. Purifier les protéines avec une balise hexa-histidine (His) par chromatographie d’affinité échange sur Ni-NTA mini spin colonnes38 tel que décrit ici en bref (pas 4.1.5.1–4.1.5.4).
      Remarque : [O] exécutez toutes les étapes rapides et sur glace. Refroidir les tampons et pré cool centrifuger à 4 ° C.
      1. [O] préparer 100 mL de tampon PBS, chlorure de sodium 200 mM et imidazole à la concentration finale de 10 mM (tampon de lavage 1, WB1), 20 (lavage tampon 2, BB2) et 500 mM (tampon d’élution, EB). Ajuster le pH de WB1 et BB2 à 8.0 et de EB à 7.0. Fonction de la protéine à être purifié, concentrations en imidazol peuvent doivent être ajustés.
      2. [O] equilibrer les colonnes contenant 600 µL de WB1 et centrifuger à 800 x g pendant 2 min avec un couvercle ouvert.
      3. [O] charge 600 µL de surnageants filtrées sur colonnes. Autoriser la liaison des protéines His-étiquetées à la matrice colonne par centrifugation à 200 x g pendant 5 min avec un couvercle fermé. Chargement et la liaison peuvent être répétés jusqu'à un total de 300 µg protéine His-étiquetée par colonne.
      4. [O] laver trois fois avec WB1 et une fois avec BB2, ou jusqu'à ce que le cheminement est incolore. Ajouter 600 µL de tampon et un essorage à 800 x g pendant 2 min avec le couvercle ouvert.
      5. [O] éluer les protéines dans un nouveau tube en effectuant deux étapes d’élution avec 300 µL de EB et centrifugation pendant 2 min à 800 g.
      6. [O] desalt et concentrer le produit à l’aide de filtres centrifuges selon la taille du produit. Ajouter de PBS de 15 mL et filtre par centrifugation pendant 10 min à 4 000 x g. Répéter jusqu'à ce que la pureté désirée et la concentration est réalisée. Pour augmenter la concentration de protéines, réduisez le volume final à environ 200 µL par centrifugation pendant 40 min à 4 000 x g.
  2. [O] confirment l’identité du produit et la pureté.
    1. [O] quantifier la quantité de protéines totales dans les isolats à l’aide des tests colorimétriques standards comme l’acide bicinchoninic (BCA) ou Bradford dosage54,55. [M] des valeurs peuvent varier de 1 à 3 µg transgénique produit par surnageant mL des cellules infectées.
    2. [O] pour quantification relative des isolats de protéine, séparer via l’électrophorèse sur gel de polyacrylamide sodium dodecyl sulfate (SDS-PAGE) et exécution Coomassie coloration56.
    3. [O] confirment l’identité des produits purifiés par immunotransfert utilisant des anticorps spécifiques ciblant la protéine ou un peptide associé tag57.
    4. [O] analyser la spécificité de liaison des protéines à l’aide de techniques appropriées qui peuvent inclure le dosage immuno-enzymatique (ELISA) ou cytométrie en flux (voir Figure 7). Liaison de cellule peut être confirmée à l’aide d’un dosage de pulldown magnétiques récemment décrite38.
      Remarque : [O] utilisation des contrôles appropriés. Dans les essais de liaison cellulaire, incluent des contrôles négatifs avec cellules n’exprimant ne pas la molécule ciblée (comme dans la Figure 9) et les substituts de protéine ne pointeraient (Figure 8). Dans les expériences de cytométrie en flux, sont positifs, négatifs et isotype contrôles (Figure 7).
      1. [O] co incuber la cible des cellules et protéines isolat pour autoriser la liaison. [B] pour lier analyse des TSEI de sang périphérique des cellules mononucléaires (PBMC) isolées du sang humain58, incuber 2. 5 x 106 cellules avec 200 ng de BTE dans 100 µL de PBS 1 % FBS (tampon de liaison, BB) pendant 1 h sur la glace.
      2. [B] cellules de lavage avec 1 mL de BB pour éliminer les protéines non lié. Centrifuger à 300 x g pendant 5 min, jeter le surnageant et resuspendre le culot dans 100 µL de BB. Ajoutez l’anticorps biotinylé cible la protéine d’intérêt ou d’une balise de peptide associé et incuber sur glace pendant 30 min. Pour les TSEI avec étiquette d’hémagglutinine (HA) de grippe, utilisation 100 ng d’anti-HA-biotine (clone 3F10).
      3. [B] laver deux fois avec 1 mL de BB, les cellules et resuspendre dans 80 µL de BB. Ajouter 20 µL de microbilles magnétiques streptavidine couplé et incuber pendant 15 min à 4 ° C.
      4. [B] lavage une fois pour enlever les cordons excès et resuspendre le culot dans 500 µL de BB additionné de 2 mM EDTA (tampon de la colonne, CB).
      5. [B] isoler les cellules avec des colonnes et un support magnétique selon le manuel du fournisseur.
        1. [B] Equilibrer en permettant à 500 µL de CB pour passer à travers la colonne par écoulement gravitaire.
          Remarque : [B] la colonne ne doit jamais fonctionner à sec. Pipette avec soin et dégazer les mémoires tampons pour éviter les bulles.
        2. [B] placer un tube propre au titre de la colonne et d’appliquer la suspension cellulaire/perle à la colonne. Laver la colonne trois fois avec 500 µL de CB / cycle de lavage. Prélever des échantillons d’intermédiaires de la suspension et d’au moins la première étape de lavage dans le tube, puis stocker sur la glace.
        3. [B] éluer les cellules liées aux perles retenus par le champ magnétique. À cette fin, retirer la colonne du support magnétique, placez-le sur un tube propre, ajouter 1 mL de CB et rapidement pousser le tampon par le biais de la colonne dans le tube à l’aide d’un piston. Maintenir le tube sur la glace.
      6. [B] centrifugeuse tubes contenant les échantillons accréditives et élution pendant 20 min à 16 000 x g et 4 ° C pour granuler des cellules. Jeter le surnageant et lyser les cellules dans un tampon immunoprécipitation (RIPA) (suggéré : 75 µL). Effectuer le SDS-PAGE56.
      7. [B] exécuter immunoblotting utilisant un anticorps primaire approprié. Les anticorps peuvent cibler le produit transgénique ou une protéine cellulaire (par exemple., β-actine, Figure 8) pour évaluer la liaison BTE-cellule.
  3. [O] évaluer la fonctionnalité immunologique des immunomodulateurs isolés.
    1. [O] identifier les essais pertinents selon les caractéristiques de l’immunomodulateur codé. Concernant l’activité immunomodulatrice attendus, méthodes d’évaluation de la prolifération cellulaire, migration, maturation, activation ou cytotoxicité peut être appliquée.
      Remarque : [O] la prolifération cellulaire peut être analysée par CFSE59 étiquetage ou coloration de Ki6760. Expériences Transwell ou scratch sont disponibles pour l’analyse de migration cellulaire61. La maturation et l’activation des cellules peuvent être évaluées à l’aide des protocoles de coloration appropriées pour marqueurs respectifs. [B] parmi les techniques disponibles pour évaluer la cytotoxicité cellulaire médiée par BTE impédance mensurations et chrome communique de dosage. Si opter pour le test de libération Chrome, observer les mesures de sécurité appropriées lors de la manipulation de matières radioactives.
    2. [B] comme une alternative non radioactive, ce qui suit décrit en détail comment évaluer induite par l’ETA, cell-mediated cytotoxicity par test de libération LDH (décrit plus haut dans la brève38).
      1. [B] décider des conditions à être testés au cours de l’expérience (voir la Figure 9 par exemple). On les concentrations (heures et jours), de l’immunomodulateur (pg/mL à µg/mL) et effectrices aux rapports de cellule (E:T) de cible (entre 01:50 et 50 : 1, par exemple) peut être modifiée. Toujours préparer les échantillons en géométrie.
      2. [B] comportent des échantillons sans protéine et sans cellules effectrices, contrôles de LDH spontanée libérer des types de cellule unique (Tsp et Esp), un contrôle maximal de lyse cible cellulaire (Tmax) avec un détergent ajouté avant lecture, un milieu qu’un contrôle et un réglage du volume pour Tmax.
        Remarque : [B] requis nombre de cellules cibles et temps d’incubation peut varier. Effectuer des séries de tests initiaux sans cellules effectrices et immunomodulateurs pour identifier les paramètres optimaux. Inclure Tsp et échantillonsmax T et des contrôles correspondants afin d’évaluer les points et le nombre de cellules différentes.
      3. [B] isoler les cellules effectrices immunitaire par exemple, en (centrifugation en gradient de densité du sang humain pour obtenir les PBMC58 ) ou de la sélection négative des cellules de T murines de souris splénocytes62.
      4. [B] graine de cible les cellules selon étape 4.3.2 (p. ex., 5 x 10³ / puits) dans une plaque de fond U 96 puits.
      5. [B] ajouter la protéine isolée à des concentrations souhaitées pour les échantillons respectifs. Ajouter les cellules effectrices immunitaires à des rapports souhaités. Ajouter moyen pour un volume total de 100 µL / puits.
      6. [B] incuber pour le laps de temps déterminé dans l’étape 4.3.2, généralement entre 4 et 48 h (24h pour PBMC non stimulées et 48 h pour cellules de T murines fraîchement isolées ; plus courtes durées d’incubation peuvent s’appliquer pour les cellules immunitaires antagoniste), à 37 ° C et 5 % de CO2.
      7. [B] 45 minutes avant de prélever les échantillons, ajouter 10 µL de solution de lyse x 10 aux puits contenant des échantillons demax T et le moyen correspondant. Continuer d’incubation.
      8. [B] spin down cellules à 250 x g pendant 4 min. transférer 50 µL de chaque surnageant dans une plaque à 96 puits à fond plat. Ne transférez pas les cellules pour éviter la LDH liée à la cellule.
      9. [B] préparer la solution de substrat selon le fabricant. Ajouter 50 µL à chaque puits et incuber à RT dans l’obscurité pendant 30 min ou jusqu'à ce que les échantillons de Tmax virent au rouge profond.
      10. [B] ajouter 50 µL de solution d’arrêt dans chaque puits. Enlever les bulles d’air par centrifugation pendant 1 min à 4 000 x get manuellement avec une aiguille creuse. Mesurer l’absorbance optique à 490 nm.
      11. [B] calculer les valeurs spécifiques de la lyse % pour chaque échantillon.
        1. [B] calculer les moyennes pour les répétitions des commandes moyennes avec et sans solution de lyse. Soustraire des valeurs obtenues d’échantillons expérimentaux et de Tmax et contrôles de la libération spontanée, respectivement. Utilisez ces valeurs de référence-corrigée pour les autres calculs.
        2. [B] calculer les moyennes corrigées TmaxTspet Esp contrôles. L’utilisation de ces valeurs moyennes, l’équation suivante donne le pourcentage de lyse spécifique pour chaque échantillon :

          Equation 1
        3. [B] tracer % lyse spécifiques valeurs par rapport à la concentration de protéines ou de ratio E:T et comparer à des échantillons de contrôle ne pointeraient.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La figure 1 illustre le mécanisme d’action du virus de la rougeole oncolytiques encodage bispécifiques recruteurs de lymphocytes T. Un organigramme illustrant le flux de travail de ce protocole est présenté à la Figure 2. Figure 3 illustre un exemple d’un génome de virus de la rougeole oncolytiques modifiés. Cela fournit une représentation visuelle des changements spécifiques appliqués aux rougeole virus anti-génome particulier caractéristiques et de transgènes inséré. Syncytiums induite par le virus de la rougeole typiques sont représentés dans la Figure 4. Notez la densité cellulaire élevée à la validant de la récolte à la rescousse (A, B), ce qui indique que le nombre de cellules peut être réduit lorsque la répétition de l’expérience. Fois et - températures d’incubation peuvent être optimisés pour le passage sur cellules Vero (C, D) pour atteindre la meilleure propagation de syncytiums dans l’ensemble de la plaque. La figure 5 représente le résultat d’un test de titrage typique. Dans la Figure 6, les courbes de croissance en une seule étape (A) et la viabilité cellulaire relative (B) après l’inoculation avec non modifié (MV) et le codage de BTE oncolytiques virus de la rougeole (MV-H-mCD3xhCD20) sont affichées. Alors que les courbes de croissance des vecteurs par rapport sur cellules Vero paraissent semblables, l’activité lytique du virus transgène codant la traîne dans la lignée de cellules tumorales murines. Cytométrie en flux les données des cellules exprimant l’antigène cibles incubés avec TSEI à cinq différentes dilutions sont fournies dans la Figure 7, indiquant la liaison BTE de cellules d’une manière dose-dépendante. Figure 8 représente un immunoblot exemplaire après pulldown magnétique de cellules associées aux BTE. Menu déroulant avec les TSEI ne pointeraient (n1, n2) n’a donné des quantités décelables de cellules, tandis que les bandes dans la fraction d’élution, indicative de cellules liées, ont été observés pour le ciblage des échantillons BTE (t1, t2). BTE-médiation, cible spécifique de l’antigène et concentration-dépendante cytotoxicité des cellules de T murines est indiquée par un test représentatif de libération LDH à la Figure 9.

Figure 1
Figure 1 : Mécanisme d’action du virus de la rougeole oncolytiques codant un embaucheur de lymphocytes T bispécifiques (MV-BTE). Infection d’une cellule tumorale (infectés : gris, non infectées : bleu clair) avec MV-BTE est suivie de la réplication virale et la propagation dans l’ensemble de la tumeur, ce qui entraîne la stimulation lyse et immunitaire des cellules tumorales. Simultanément, les TSEI [comprenant deux chaînes unique dérivés des anticorps ciblant CD3 sur les lymphocytes T (jaunes) et un antigène de surface de tumeur (bleu)] est produits et sécrétée localement par les cellules infectées par le virus. BTE-mediated réticulation avec cellules tumorales induit l’activation des repos, polyclonal NKT, résultant en plus mort de cellulaire tumorale. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Organigramme décrivant le flux de travail de conception, en générant et évaluer de nouveaux vecteurs viraux codant des transgènes immunomodulatrices. Étapes 1 à 4 reflètent les sections respectives du protocole. Bullet points indiquent sous-étapes et considérations pertinentes. Vu le caractère empirique de la procédure, des ajustements ou des améliorations peuvent devenir nécessaires à chaque étape du flux de travail. En outre, les résultats expérimentaux peuvent conduire à nouvelles hypothèses et inspirer la mise au point de vecteurs supplémentaires ou des polythérapies. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Représentation schématique d’un génome de virus de la rougeole. La protéine fluorescente verte améliorée (eGFP) est codée dans une unité de transcription supplémentaires en aval de la séquence de tête (ld). N, P, M, F, H et L désignent des gènes codant la nucléoprotéine de protéines structurales virus rougeole, P protéine, protéine de la matrice, protéine de fusion, protéine hémagglutinine et grosse protéine (polymérase), respectivement, qui sont exprimés de façon aussi visualisées au-dessus. Un transgène de recruteurs (BTE) de lymphocytes T bispécifiques est inséré dans une unité de transcription supplémentaires (ATU) en aval de la trame de lecture ouverte H . Le transgène encode un peptide de tête Igκ de sécrétion efficace en plus d’hémagglutinine (HA) de la grippe et tags protéine hexa-histidine (His) pour la détection et la purification. Gènes codant pour la variable lourde (VH) et la chaîne légère domaines (VL) des anticorps ciblant CD3 et CD20, respectivement, sont connectés via peptide linker séquences contenant de glycine (G) et résidus sérine (S). La séquence du transgène est précédée d’une séquence de Kozak. En aval du codage région, nucléotides supplémentaires ont été incluses de façon exemplaire pour se conformer à la règle de six. La cassette insert est flanquée de deux sites de restriction permettant l’insertion dans l’ATU respectif. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Syncytiums induite par le virus de la rougeole. (A, B) Vero cellules ont été transfectées avec l’ADNc pour le sauvetage de virus de la rougeole recombinant codant pour une protéine fluorescente verte (eGFP) et un embaucheur de lymphocytes T bispécifiques (BTE) ciblant les CD3 murines et humaines CD20. Présence d’un syncytium fluorescent (flèches blanches) indique le sauvetage réussi de virus infectieux. (C, D) Virus de la rougeole ont été récoltés après le sauvetage et propagées sur cellules Vero (1 passage). Grands syncytiums ont formé et commencent déjà à rafale (flèches jaunes). Des images ont été acquises par contraste de phase (B, D) et la microscopie de fluorescence après excitation pour ms 80 (A) et 100 ms (C). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : Résultat représentatif d’un test de titrage. Titrage d’un lot de troisième-passage de MV-H-mCD3xhCD20, un virus de la rougeole BTE-encodage oncolytiques, sur cellules Vero. 10 fois une dilution en série a été réalisée sur une plaque à 96 puits, à partir de 10 µL de suspension virale dans chaque puits de colonne 1 aucun syncytiums étaient visibles dans la colonne 7, comme il est indiqué par des zéros. Pour la prochaine dilution la plus faible de suspension virale dans la colonne 6, a été observée en moyenne six syncytiums / puits, ayant pour résultat un titre final d’environ 6 x 107 unités infectieuses cellulaire (ciu) par la suspension virale mL. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : Cinétique de la réplication et l’activité lytique du virus de la rougeole recombinant. (A) en une seule étape, les courbes de croissance ont été générés après l’infection de cellules Vero non modifiées oncolytiques virus de la rougeole (MV) ou virus de la rougeole codant un embaucheur de lymphocytes T bispécifiques (MV-H-mCD3xhCD20) à un MOI de 1. Titres de progénitures virales ont été évalués à intervalles désigné après l’infection, en indiquant la même cinétique de réplication de virus. Moyennes et écarts de huit échantillons (quatre techniques réplique chacun de deux répétitions biologiques par validant) sont indiquées. Cellule (B) la viabilité a été évaluée sur carcinome colorectal murin MC38 cellules exprimant de manière stable antigène carcino-embryonnaire humaine et le récepteur MV CD46 (MC38-CEA-CD46) après l’inoculation avec le seul moyen (mock) ou virus indiqués à un MOI de 1. Analyse de viabilité de cellules XTT a été réalisée à intervalles indiqués. Réduction de la viabilité cellulaire a été observée à porté plus tôt pour le vecteur non modifié. On observe fréquemment des valeurs de plus de 100 %, calculée pour MV-H-mCD3xhCD20 à l’après 12 h, peu de temps après l’infection, qui peut être à cause du stress cellulaire ou facteurs dérivés des cellules présentent dans la suspension virale. Valeurs moyennes et écarts-types des trois répétitions techniques sont indiquées pour chaque validant. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 7
Figure 7 : Liaison de cellule cible par bispécifiques recruteurs de lymphocytes T (TSEI) exprimée par la rougeole cellules infectées par le virus. Lymphome du manteau humain cellules exprimant endogène CD20 (Granta-519) ont été incubées avec des immunoglobulines humaines G pour bloquer les récepteurs de Fc, suivies d’une incubation avec 2, 4, 6, 8 ou 10 µL (A) de la solution BTE mCD3xhCD20 purifiée, respectivement. BTE-lié aux cellules ont été détectés à l’aide de la phycoérythrine (PE)-conjugués anticorps ciblant la BTE-associated HA-tag. Pourcentages de cellules colorées en corrélation avec les concentrations BTE. (B) les contrôles pour la sélectivité et la spécificité de liaison. Montré ici sont des contrôles à partir d’une expérience indépendante, y compris un échantillon de chacun des cellules non incubés avec BTE mais avec le ciblage BTE anticorps seulement (contrôle pour la liaison non spécifique d’anticorps aux cellules) ou avec un contour d’oreille qui est connu pour se lier aux cellules d’intérêt , suivi par incubation avec l’anticorps ciblant BTE (contrôle positif) ou un anticorps d’isotypes. Si disponibles, isogéniques cellules n’expriment ne pas l’antigène cible de choix peuvent être utilisés pour vérifier plus à sélectivité de liaison. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 8
Figure 8 : Pulldown magnétique de périphériques humains de sang cellules mononucléaires (PBMC) liés par la rougeole virus-encodé TSEI. Les cellules sont incubées avec deux lots différents de humaine T cellule-cible (t1, t2) ou de contrôle ne pointeraient TSEI (n1, n2), respectivement. BTE-lié aux cellules ont été retenus sur les colonnes à l’aide de billes magnétiques, granulés et lysées. Β-actine dans les lysats fut détecté par immunoblotting. Intensités des bandes dans les échantillons d’élution indiquent liaison BTE-cellule relative. Accréditives échantillons confirment la présence de cellules dans tous les échantillons. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 9
Figure 9 : L’activité cytotoxique de la rougeole virus-encodé TSEI. Cible les cellules tumorales (5 x 10³ B16-CD20-CD46 cellules / puits) ont été incubées avec des cellules T à un ratio de 01:50. TSEI précédemment purifiée à partir du surnageant de cellules infectées MV-H-mCD3xhCD20 ont été ajoutés aux concentrations indiquées. La lyse des cellules cibles relative a été évaluée par test de libération LDH après que 48 h. cellules dépourvues du BTE ciblent l’antigène (B16-CD46) servi de référence pour évaluer la cytotoxicité spécifique de l’antigène. Des moyens plus écart de trois répétitions techniques par exemple sont indiqués. Les cellules exprimant l’antigène cible ont été lysées spécifiquement d’une manière dose-dépendante BTE. Les niveaux de pureté de l’expression de l’antigène produit et cible BTE mort cellulaire influence. Dans l’exemple présent, assassinat de cellule spécifique de 15 % a été atteint à une concentration relativement élevée de BTE de 1 µg/mL. Il s’agit d’une valeur typique pour un tel montage expérimental avec fois longue incubation co et les conditions de culture sous-optimales lymphocytes T. Dans d’autres contextes, vers le haut à 60 % spécifique mise à mort a été réalisé en utilisant TSEI purifiée à partir de surnageants infectés par MV, pour atteindre un plateau à des concentrations de BTE de 100 ng/mL et supérieure38. Cela indique que, contrairement à l’intuition, la limite de ce dosage est inférieur à 100 % spécifique mise à mort, qui peut s’expliquer par la cinétique de croissance différents contrôlesmax T par rapport aux échantillons de culture mixte. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolytique immunothérapie (i.e., OVT en combinaison avec l’immunomodulation) est très prometteur pour le traitement du cancer, exigeant davantage développement et optimisation de virus oncolytiques codant des protéines immunomodulatrices. Ce protocole décrit les méthodes pour générer et valider ces vecteurs pour contrôle ultérieur dans des modèles précliniques appropriés et potentielle future traduction clinique en nouveaux traitements contre le cancer.

Nombreuses plates-formes de virus oncolytiques différents avec des avantages distincts sont disponibles63. Outre la spécificité du cancer, vecteur sécurité, exigences pour la fabrication, l’efficacité dans la lyse des cellules tumorales et l’induction des réponses immunitaires, capacité de clonage est primordial pour la vectorisation réussie des immunomodulateurs en utilisant un oncolytiques spécifiques. Malheureusement, une comparaison directe de différents OVs manque actuellement et devrait être poursuivie afin d’identifier les options de traitement optimal pour chaque patient. Cela peut être facilité en promouvant le développement rationnel et en testant de nouveaux vecteurs de transgène codant, comme exemplifié ici pour MV-BTE. Étant donné les propriétés bénéfiques de MV (, oncotropism, sécurité, fusogénicité, immunogénicité, possibilité de modification génétique) ce protocole met l’accent sur ce vecteur oncolytiques, qui peut être généralisé pour les autre OV, surtout les paramyxovirus .

Pour un choix rationnel des immunomodulateurs potentiellement pertinents comme candidat transgènes (étape 1.1.1), une connaissance approfondie du cycle de l’immunité du cancer est essentielle, rendant la recherche systématique de la littérature indispensable. En outre, les écrans à grande échelle, bien que coûteuses, peuvent s’avérer précieux pour identifier de nouvelles cibles (p. ex., voir Patel et al.41).

Pour la conception de OVs recombinantes, on envisagera des profils d’expression souhaité. Dans le cas des virus à ARN, l’expression des gènes est contrôlée au niveau de la RNA par la polymérase respectif. Lors de la conception des cassettes de transgène pour être insérés dans les génomes de MV (étape 1.1.2), en évitant les séquences qui ressemblent à des MV amplification génique marche/arrêt signaux et ARN édition sites et suivant la règle des six est essentielle au développement de vecteur avec succès. En outre, les niveaux d’expression génique paramyxovirus correspondent à positionnement au sein du génome, résultant d’une expression gradient43. En général, le positionnement du transgène dans une position en amont augmente expression au détriment de la réplication réduite. Cependant, ces paramètres dépendent aussi de la taille, la structure et la séquence du transgène respectif. Par conséquent, une limitation de la méthodologie décrite dans le présent protocole est la nécessité d’essais empiriques des dessins vectoriels roman. Dans des cas spécifiques, des ajustements à la séquence de transgènes ou positionnement peut être nécessaire d’obtenir un vecteur désirée (Figure 2). Une comparaison systématique des positions différentes pour les anticorps du point de contrôle insère ont montré des résultats optimaux pour le H- ATU (données non publiées). BTE insertions ayant des propriétés comparables (domaines de la taille et l’immunoglobuline), vecteurs de MV-BTE ont été clonés par analogie38.

Sauvetage de particules infectieuses du virus cDNA (étape 2.1) peut nécessiter plusieurs tentatives pour certaines constructions. Ajuster le nombre de cellules peut optimiser la densité cellulaire pour la formation de syncytiums. Bien qu’une certaine densité soit nécessaire pour la diffusion efficace de cellule-cellule et la fusion des membranes cellulaires, l’inhibition de contact réduit la réplication virale. En outre, le nombre de particules infectieuses ne peut-être pas suffisant pour induire la fusion cellulaire visible. Cependant, comme le virus peuvent être présents en absence de syncytiums, échantillons de sauvetage peuvent néanmoins être récoltés et transférés aux cellules fraîches de producteur pour la propagation potentielle. Transfection inefficace en raison de la mauvaise qualité de l’ADN ou les réactifs pour la transfection inadaptés ou dégradés présentent des problèmes typiques qui sont relativement faciles à évaluer et remédier en générant de nouvelles préparations d’ADN et en testant différents réactifs, respectivement.

Propagation de virus avec succès (étape 2.2) dépend fondamentalement les conditions qui déterminent la réplication virale et à la lyse cellulaire. L’utilisation des numéros de passage bas de cellules de producteur est recommandée, et cellules infectées doivent être régulièrement vérifiés pour la progression de syncytiums. Ajuster le nombre de cellules, les températures et durées d’incubation peuvent être doit mettre en balance la prolifération cellulaire propagation virale vs. .

Une limitation essentielle de la méthode décrite de la production de virus est la préparation de suspensions de virus de lysats cellulaires brut. Les chercheurs doivent être conscients du fait que la suspension de virus contienne des facteurs cellulaires. Particules virales peuvent être concentrés par densité gradient/saccharose coussin ultracentrifugation au détriment du nombre total de particules infectieuses et aussi potentiellement augmentation des concentrations de débris cellulaires. Virus peut également être concentré de surnageants de la cellule infectée, augmentant la pureté, mais réduire le rendement global. BPF et à grande échelle production de paramyxovirus est généralement réalisée à l’aide de plusieurs couches de cellules de producteur graines sur un filament net dans des bioréacteurs pour titre accrue donnent63. Une surveillance précise, échange de milieux continus, sans sérum conditions et étapes de filtration subséquente assurent la grande pureté du produit virus.

Évaluation des titres viraux (étapes 2.3 et 3.1) via les syncytiums décrits méthode de comptage n’est pas précis, mais il est facile à réaliser et réplique suffisamment précises lors de l’utilisation d’un nombre suffisant de technique. Lors de l’évaluation de la cytotoxicité médiée par OV (étape 3.2), limitations des essais disponibles doivent être examinées. Tests métaboliques ne distinguent pas les effets cytostatiques et cytolytiques des traitements expérimentaux. Pour mesurer une cytolyse, peut effectuer un test de libération LDH. Toutefois, les deux types d’analyses peuvent être affectés par contenu de préparations de virus de lysats de cellules brut (Figure 6).

Isolement des protéines exprimées par les cellules infectées par des virus (étape 4.1) peut varier considérablement dans le rendement et la pureté, selon le transgène respectif et le virus utilisé, ainsi que sur la précision technique. Ainsi, contrôle de la qualité de la purification de la protéine est crucial pour l’évaluation des résultats expérimentaux liés.

Comme une description exhaustive des éventuels tests fonctionnels couvrant la grande variété des immunomodulateurs possible déborde le cadre de cette publication, le présent protocole se concentre sur ex vivo méthodologie pour mesurer la cytotoxicité cellulaire (étape 4.3). Cytotoxicité cellulaire, en particulier par les cellules T CD8 +, est un médiateur important du contrôle de la tumeur immunologiques en succès immunothérapies64. Ceci a des implications importantes pour les approches actuelles de l’immunothérapie utilisant des anticorps pour améliorer la réponse immunitaire anti-tumorale en général et bispécifiques recruteurs de lymphocytes T en particulier. Expression de BTE locale par des vecteurs oncolytiques a donné des résultats prometteurs dans plusieurs études précliniques, y compris les RNA38 et ADN virus65,66,,du6768.

En raison des interactions complexes de tumeur, virus, transgene produit et système immunitaire dans les organismes vivants, validation du codage immunomodulateur oncolytiques vecteurs en culture cellulaire, comme montré ici n’est pas suffisante pour prédire les résultats thérapeutiques. Ce qui est important, l’évaluation proposée isolée des fonctions vectorielles et immunomodulateur, respectivement, est essentielle à la preuve de concept mais ne parvient pas à décrire les synergies potentielles et des interactions complexes au sein du microenvironnement tumoral. Tests de toxicité et de l’efficacité dans des modèles in vivo pertinentes est crucial pour encore développement du vecteur recombinant roman construit mais n’est pas facile à faire. La sécurité immunologique est surveillée régulièrement chez les primates non humains tels que les macaques et modèles de souris sont utilisées pour la biodistribution et efficacité analyse20,69. Cependant, beaucoup de ces modèles ont des limitations concernant l’expression des récepteurs du virus dans les tissus de l’hôte et la permissivité de l’hôte, et certains qu’insuffisamment imitent l’interaction complexe entre OV, tumeur et le microenvironnement immunitaire. Ainsi, un examen attentif des modèles appropriés est obligatoire.

Traitement de MV-BTE a précédemment été évaluée dans les xénogreffes humaines et de modèles murins syngéniques. Aucun transgène BTE produits étaient détectables dans le sérum de souris traitées avec MV codage BTE38, indiquant une prévention réussie de l’exposition systémique même sans plus atténuation de la naturellement oncotropic virus de souche vaccin. Expression locale est cruciale pour les immunomodulateurs OV codées qui sont toxiques lorsqu’ils sont administrés de façon systématique. Si nécessaire, spécificité de la tumeur peut être renforcée en re-ciblage vers la cellule de marqueurs de surface des choix70,71,72 et axée sur les micro-ARN dépointage pour oncotropism améliorée (de74 73, revu par Ruiz et Russell75). Modifications supplémentaires peuvent être introduites afin d’optimiser les vecteurs pour des utilisations thérapeutiques spécifiques (évaluées par Miest et Cattaneo76), avec insertion de transgènes pour fins de diagnostic77,78 ou prodrogue conversion pour minimiser les effets secondaires de la chimiothérapie79,80, introduction de sécurité passe en81et le ciblage du stroma tumoral ou vasculaire (p. ex., par l’intermédiaire d’anticorps bispécifiques82).

En dehors de la modification génétique du vecteur viral, les schémas de combinaison avec chimérique de l’antigène des lymphocytes T récepteur (voiture) transfert83, chimiothérapie84,85,86ou radiothérapie87, 88 , 89 de plus augmenter le répertoire de l’OVT. Comme l’immunité MV est très répandue, stratégies de contourner la neutralisation des anticorps ont été développés, notamment échanger des glycoprotéines d’enveloppe pour ceux de paramyxovirus connexes90, revêtement polymère de particules, à l’aide de transporteurs de la cellule à livrer les virus et immunodépression transitoire (évaluée par Russell et al.6). Poursuite du développement de schémas d’immunothérapie OV avancées nécessite tests d’innocuité et d’efficacité thérapeutique dans des modèles animaux appropriés, avec le matériel de patient et, finalement, dans les essais cliniques contrôlés.

Face à la multitude de combinaisons possibles, test complet n’est pas possible. Modélisation mathématique peut aider à la priorisation des schémas de combinaison possibles ainsi que leur dosage respectif et ordonnancement en prédisant les résultats des traitements en silico (évaluée par Santiago et al.,91). Lors de l’essai d’efficacité du roman, vecteurs conçus rationnellement, sonore qui accompagne la recherche translationnelle joue un rôle important pour une compréhension plus profonde des processus sous-jacents de virologiques et immunologiques. Cela est crucial pour la génération de modèles appropriés, les informations sur d’autres cibles potentielles et l’avancement dans le domaine en général. En conclusion, première main aperçu aux méthodes de dessin vectoriel, génération et caractérisation dans ce secteur d’activité va accélérer le développement et soutenir l’exploration de nouvelles thérapeutiques pour la future traduction clinique.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.E. Engeland est répertorié comme co-inventeur d’un brevet en ce qui concerne les virus à ARN pour Cancer Immunovirotherapy appartenant à l’Université de Heidelberg. J.P.W. Heidbuechel n’a rien à divulguer.

Acknowledgments

Ces méthodes ont été établies dans le groupe virothérapie dirigé par Prof. Dr. Dr. Guy Ungerechts au Centre National pour les maladies tumorales à Heidelberg. Nous sommes reconnaissants envers lui et tous les membres de l’équipe du laboratoire, en particulier le Dr Tobias Speck, le Dr Rūta Veinalde, Judith Förster, les Birgit Hoyler et que les Jessica Albert. Ce travail a été soutenu par l’autre Kröner-Fresenius-Stiftung (Grant 2015_A78 à C.E. Engeland) et l’allemand National Science Foundation (DFG, accorder EN 1119/2-1 à Engeland C.E.). J.P.W. Heidbuechel reçoit une allocation de la Helmholtz International Graduate School for Cancer Research.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics