Paramyxoviruses for svulst målrettede Immunomodulation: Design og evaluering Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Denne protokollen beskriver en detaljert arbeidsflyt for generering og ex vivo karakterisering av kan virus for uttrykk for immunomodulators, ved hjelp av meslinger virus koding bispecific T celle engagers som et eksempel. Programmet og tilpasning til andre vektor plattformer og effekter av transgener vil akselerere utviklingen av romanen immunovirotherapeutics for klinisk oversettelse.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vellykket kreft immunterapi har potensial til å oppnå langsiktig svulst kontroll. Til tross for siste klinisk suksess, er det fortsatt et presserende behov for sikker og effektiv terapi skreddersydd til individuelle svulst immun profiler. Kan virus aktiverer induksjon av anti-tumor immunreaksjoner samt svulst-begrenset genuttrykk. Denne protokollen beskriver generasjon og ex vivo analyse av immunmodulerende kan vektorer. Fokusere på meslinger vaksine virus koding bispecific T celle engagers som et eksempel, kan generelle metodikken tilpasses til andre virus arter og effekter av transgener. Presentert arbeidsflyten inkluderer design, kloning, redning og overføring av rekombinant virus. Analyser analysere replikasjon kinetikk og lytisk aktivitet av vektoren og funksjonaliteten til den isolerte immunomodulator ex vivo er inkludert, dermed tilrettelegge generering av romanen agenter for videre utvikling i preklinisk modeller og til slutt klinisk oversettelse.

Introduction

Kan virus (OVs) utvikles som anti-kreft legemiddelselskap som spesielt replikere innen og drepe kreftceller mens røres sunt vev. Det har nå blitt vanlig forstå at det kan virotherapy (overtid), i de fleste tilfeller, ikke stole utelukkende på komplett svulst lysis av effektiv replikering og spredning av viruset, men krever flere virkningsmekanismer for suksess, inkludert vaskulær og stromal målretting og, viktigst, immune stimulering1,2,3,4. Mens mange OV studier brukt uforandret virus, har nåværende forskning profittert fra en forbedret biologiske forståelse, virus biobanker som inneholde romanen OVs og mulighetene som tilbys av genteknologi for å lage avanserte OV plattformer5,6,7.

Gitt den nylige suksessen immunterapi, er immunmodulerende effekter av transgener av spesiell interesse om genteknologi av OVs. Målrettet uttrykk for slike genet produkter av OV-infiserte kreftceller reduserer toksisitet sammenlignet med systemisk administrasjon. Målretting oppnås ved å bruke virus med iboende oncoselectivity eller ved å endre viral tropism8. Lokale immunomodulation forbedrer mangesidig anti-tumor mekanismer for overtid. Videre, denne strategien er instrumental i avhør samspillet mellom virus, tumorceller og immun vertssystemet. Dette gir denne protokollen en anvendelig og justerbar arbeidsflyt for å utforme, klone, redde, overføre og validere kan paramyxovirus (spesielt meslinger viruset) vektorer koding slike effekter av transgener.

Modulering av immun respons oppnås ved en rekke forskjellige trinn av kreft-immunitet syklus9, inkludert styrke svulst antigen anerkjennelse [f.eks svulst-assosiert antigener (TAAs) eller indusere av transgene spesialprodukter store histocompatibility kompleks (MHC) klasse I molekyler] over støtter dendrittiske celle modning for effektiv antigen presentasjon (cytokiner); rekruttering og aktivere ønsket immunceller som cytotoksiske og hjelper T celler [chemokines, bispecific T celle engagers (BTEs)]; målretting undertrykkende celler som regulatoriske T-celler, myelogen-avledet suppressor cellene, tumor-assosiert makrofager og kreft-assosiert fibroblaster (antistoffer, BTEs, cytokiner); og hindre effektor celle hemming og utmattelse (checkpoint hemmere). Således, en overflod av biologiske midler er tilgjengelige. Evaluering av slike virus-kodede immunomodulators terapeutiske effekten og synergimuligheter samt forståelse av respektive mekanismer er nødvendig å forbedre kreft terapi.

Negativ forstand single-strandet RNA virus av Paramyxoviridae familie er preget av flere funksjoner til deres bruk som kan vektorer. Disse inkluderer en naturlig oncotropism, stor genomisk kapasitet for effekter av transgener (mer enn 5 kb)10,11, effektiv spre inkludert syncytia formasjon og høy immunogenisitet12. Derfor OV plattformer basert på Hjørnetann distemper virus13, kusma virus14, Newcastle sykdom virus15, Sendai virus16,17, simian virus 518og Tupaia paramyxovirus19 har blitt utviklet. Mest fremtredende, live dempes meslinger viruset vaksine stammer (MV) har kommet i preklinisk og klinisk utvikling20,21. Disse viruset stammer har blitt brukt i flere tiår for rutinen immunisering med en utmerket sikkerhet posten22. Dessuten, det er ingen risiko for insertional mutagenese på grunn av strengt cytosolic replikering av paramyxoviruses. Et allsidig omvendt genetikk system basert på anti-genomic cDNA som tillater innsetting av effekter av transgener i flere transkripsjon enheter (ATUs) er tilgjengelig11,23,24. MV vektorer koding natrium-iodide symporter (MV-NIS) for bildebehandling og strålebehandling eller løselig carcinoembryonic antigen (MV-CEA) som et surrogat markør for viral genuttrykk er som blir evaluert i kliniske forsøk (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 og NCT00408590). Sikker administrasjon har blitt bekreftet og tilfeller av anti-tumor effekten har blitt rapportert i forrige studier25,26,27,28,29, 30 (anmeldt av Msaouel et al.31), banet veien for ytterligere kan meslinger virus som er utviklet og testet preklinisk. MV koding immunmodulerende molekyler målretting ulike trinn av kreft-immunitet syklusen har vist seg å forsinke tumor vekst eller forlenge overlevelse i mus, med bevis for immun-mediert effekt og langsiktig beskyttende immun minne i syngeneic musen modeller. Vektor-kodet effekter av transgener inkluderer granulocytt-macrophage koloni stimulerende faktor (GM-CSF)32,33, H. pylori nøytrofile-aktivere protein34, immun checkpoint hemmere35, interleukin-12 (IL-12)36, TAAs37og BTEs38, som en svulst-link overflateantigen med CD3 og dermed indusere anti-svulst aktivitet av polyklonale T-celler, uavhengig av T celle reseptor spesifisitet og co-stimulering ( Figur 1). Lovende prekliniske resultatene for disse konstruksjoner etterspørsel ytterligere translasjonsforskning innsats.

Talimogene laherparepvec (T-VEC), en type jeg herpes simplex virus koding GM-CSF, er den eneste kan terapeutiske godkjent av USA Food, Drug Administration (FDA) og europeiske Legemidler Agency (EMA). Fase III studien fører til godkjenninger i slutten 2015 har ikke bare vist effekt på stedet av intra-tumoral injeksjon, men også abscopal effekter (dvs. forbedringer av ikke-injisert lesjoner) i avansert melanom39. T-VEC har siden kommet ytterligere forsøk for programmet i andre svulst enheter (f.eks, ikke-melanom hudkreft, NCT03458117, bukspyttkjertelkreft, NCT03086642) og evaluering av kombinasjon terapier, spesielt med immun checkpoint hemmere (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 og Ribas et al.40).

Dette viser ikke bare potensialet i kan immunterapi, men også behov for videre forskning åidentifisere overlegen kombinasjoner av overtid og immunomodulation. Rasjonell utformingen av flere vektorer og deres utvikling for prekliniske tester er nøkkelen til dette prosjektet. Dette vil også fremme forståelse av underliggende mekanismene har implikasjoner for utviklingen mot mer personlig kreftbehandling. Dette presenterer denne publikasjonen metodikken for endring og utvikling av paramyxoviruses for målrettet kreft immunterapi og, mer spesifikt, kan meslinger virus koding T celle engasjerende antistoffer (figur 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Merk: [O], [P], og [M] angir ledd gjelder: OVs i generelt, (de fleste) paramyxoviruses eller MV, henholdsvis. [B] angir inndelinger bestemt BTE effekter av transgener.

1 kloning av Immunomodulator-koding effekter av transgener i meslinger viruset vektorer

  1. [O] design sett inn sekvens.
    1. [O] bestemme en immunomodulator rundt basert på forskning i literatur eller utforskende data som genetiske skjermer41 og utlede relevante cDNA sekvensen fra aktuelle databaser som GenBank, europeiske Nucleotide arkivet, eller internasjonale ImMunoGeneTics informasjonssystem (IMGT).
    2. [O] legge til tilleggsfunksjoner transgene sekvensen (Figur 3). En foregående Kozak sekvensen og artsspesifikke codon optimalisering kan forbedre uttrykk. Signalet sekvenser kreves for sekret. Inkluder sekvenser koding N - og/eller C-terminalen protein koder for deteksjon og rensing42. Inkludere begrensning nettsteder for innsetting vektoren.
      Merk: [M] ytterligere transkripsjon enheter (ATUs) skjuler MV polymerase genet starte og stoppe signaler er nødvendige for transgene uttrykk fra rekombinant MV genomer. Egnet anti-genomic cDNA vektorer, kontrollert av CMV arrangører og inneholder ATUs med unik begrensning nettsteder for innføring av positiv forstand effekter av transgener til definerte posisjoner, har blitt utviklet tidligere11. [P] tilstrekkelig plassering av av transgene er avgjørende, påvirker viral replikasjon og transgene uttrykket på grunn av uttrykket graderingen typisk for paramyxoviruses43. Innføring i en ATU nær 3 slutten av anti-genomet (i.e., i ledende stilling eller nedstrøms P genet) vanligvis resulterer i høy transgene uttrykk på bekostning av redusert viral replikasjon. Økt replikering og lavere nivåer av transgene uttrykk kan forventes ved ATU nedstrøms av H genet. Emballasjen i genomet for flere paramyxoviruses, inkludert meslinger viruset, krever binding av seks nukleotider ved hver nucleocapsid protein44. For innsetting av effekter av transgener slike virus, sikrer du at antall nukleotider i fullstendig genomet blir delelig med seks. Dette er også referert til som "regel av seks"45,46. Eventuelt inkludere flere nukleotider i sette inn (oppstrøms av Kozak sekvensen eller nedstrøms stopp codon) uten å innføre ramme SKIFT eller tidlig stopp kodon. [M] unngå bestemt sekvenser i transgene som ligner på MV genet start (AGGRNCMARGW) og stoppe (RTTAWANAAAA) signaler og RNA redigering sekvenser (AAAAAGGG). Slik konsensus sekvenser har blitt publisert (f.eks se parker et al.47).
    3. [O] kjøpe oligonucleotide av ønsket sekvensen eller samle fra tilgjengelige sekvenser ved hjelp av standard molekylær kloning48.
      Merk: [O] for PCR forsterkning av transgene, designe en frem primer inkludert oppstrøms begrensning området og de første 15-20 nukleotider innsatsen og en omvendt primer inkludert sist 15-20 nukleotider av sette etterfulgt av nedstrøms begrensning området.
  2. [O] klone satt inn i DNA koding genomet viral (anti-).
    1. [O] klone innsatsen i DNA vektorer eller DNA anti-genomer RNA-virus av standard molekylær kloning teknikker48 (dvs., enzymatisk begrensning etterfulgt av DNA ligation).
      1. [O] forhindre re ligation av vektoren ved hjelp av ikke-kompatible begrensning nettsteder eller de fosforylering før hemorroider.
      2. [O] isolere ligation produktet av agarose gel gelelektroforese og påfølgende gel rensing bruke kommersielt tilgjengelige kits. Generelt, oppnås optimal ligation effektivitet i 3:1 molar forholdet sett inn til vektor.
    2. [O] transform ligation produktet i kompetent bakterier egnet for effektiv utvinning av store plasmider (dvs., utføre varme støt av E. coli49) og identifisere bakteriell kloner skjuler riktig DNA av kolonien PCR50 .
    3. [O] isolere forsterket DNA fra en enkelt bakteriell klone bruke kommersielt tilgjengelige DNA forberedelse kits. Bekrefte genomisk integritet av kontroll digest med passende begrensning enzymer (f.eks, HindIII for MV genomer [M]). Kontrollere riktig innsetting og integriteten av transgene ved sekvensering.
      Merk: [M] for effekter av transgener i MV H- ATU, utføre Sanger sekvensering med følgende primerne: H-9018 [frem primer, binder seg til MV genomet posisjon 9018 i H åpne lesing frame (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (omvendt primer, binder seg til MV genomet posisjon 9249 i L ORF): 5' CAGATAGCGAGTCCATAACGG 3.

2. redde rekombinant meslinger viruspartikler koding Immunomodulators

  1. [O] generere rekombinant viruspartikler fra (anti-) genomisk DNA via transfection virus produsent celler etter standardprotokollen for respektive viruset. Følge retningslinjene for arbeider under sterile forhold. Utføre cellekultur under hetter, spesielt alle foranstaltningene innvolvere virus i klasse II biologiske sikkerhetskabinett skap.
    1. [M] for redning av meslinger virus fra cDNA23,24, plate MV produsent (afrikanske grønn ape nyre-avledet Vero) celler jevnt i en 6-vel plate 24 timer før transfection. Frø 2 x 105 celler i 2 mL Dulbeccos endret Eagle's Medium (DMEM) som inneholder 10% fosterets bovin serum (FBS) per brønn å oppnå 65-75% confluency ved transfection.
      Merk: [P] redusere cellen tallene hvis cellene overgrow før forårsaket av virus syncytia formasjon.
    2. [P] Transfect cellene med DNA koding viral anti-Genova, kreves hjelperen plasmider, og, hvis ønskelig, en plasmider koding fluorescerende reporter å vurdere hva effektivitet.
      1. [M] blanding 5 µg rekombinant DNA koding meslinger viruset anti-genomet, 500 ng av pattedyr uttrykk plasmider koding meslinger viruset N og L proteiner og 100 ng av plasmider koding P protein og fluorescerende reporter i et totalt volum på 200 µL DMEM.
      2. Legge 18.6 µL av liposomal transfection reagens, bland umiddelbart ved å sveipe røret og ruge for 25 min ved romtemperatur (RT).
      3. [P] Erstatt medium med 1,8 mL DMEM, 2% FBS, 50 µg/mL kanamycin (eller andre antibiotika å hindre forurensning) per brønn, deretter legge transfection mix dropwise til brønnen og swirl nøye. Inkuber celler overnatting på 37 ° C, 5% CO2. Erstatt medium med 2 mL frisk DMEM, 2% FBS og 50 µg/mL kanamycin dagen; Gjenta dette når mediet blir surt.
        Forsiktig: [O] håndtere celler og materialer i henhold til biosafety regelverk, som virus kan finnes fra transfection gjennom følgende trinn. Kast (potensielt) smittsomme avfallet riktig.
  2. [P] samle og overføre viruspartikler.
    1. [P] observere celler daglig av mikroskopi for reporter gene expression og syncytia dannelse (Figur 4). Høste virus når store syncytia, bestående av 20 eller flere celler, er synlig, eller celler blir for tette (i.e., når de begynner å vokse i flere lag, vanligvis etter 7-9 dager).
      Merk: [P] hvis ingen syncytia observeres for en gitt vektor konstruksjon, betyr dette ikke nødvendigvis at redning mislyktes. Som smittsomme virus kan likevel være tilstede i utvalget, overføre til frisk produsent celler for passaging.
    2. [P] frø ca 1,5 x 106 produsent celler i 12 mL av DMEM med 10% FBS, på 10 cm retter 24 timer før forventet innhøstingen, eller 2,5 ganger 106 celler per plate 4-6 h før passaging av viruset å oppnå 65-75% confluency på tidspunktet for virus inoculat ion.
    3. [P] for å samle virus avkom, forsiktig skrape tilhenger produsent celler fra platen med en celle skraper og overføre nedbryting som inneholder celler i en sentrifuge rør. Fjerne celle rusk ved sentrifugering for 5 min på 2500 x g og 4 ° C.
      Merk: Skrapte celler kan overføres direkte uten sentrifugering å maksimere virus carryover på bekostning av suboptimal oppdrettsforholdene og potensielle mikroskopi gjenstander.
      Forsiktig: [O] unngå søl media når skraping celler. Minimere aerosol formasjon.
    4. [P] klargjør inoculum ved å blande cellen uten nedbryting fra trinn 2.2.3 med serum-free medium til et endelig antall 4 mL. Erstatt medium på produsent celler av inoculum og ruge celler for minst 2 h på 37 ° C og 5% CO2. Legge til 6 mL av DMEM med 10% FBS og Inkuber celler over natten før du endrer mediet til 12 mL av ferske DMEM med 10% FBS.
    5. [P] observere celler minst to ganger daglig og harvest viruset før syncytia burst (dvs., når membranen avbrudd blir synlig). For å høste første passering av virus, fjerne nedbryting fra platen, legge til 600 µL av serum-free medium, skrape celler med en celle lifter og overføre til en ren rør.
      Merk: [M] avhengig av hva slags viruset belastning51,52 og progresjon av infeksjon, overføre plater med infiserte celler til 32 ° C til viral replikasjon og spredning. Generelt, overføres MV Schwarz stammer i 37 ° C, mens overføring av celler som er infisert med Edmonston B belastning virus til 32 ° C fører til lavere syncytia formasjon men høyere titers.
      Merk: [P] ikke la celle laget tørke under innhøstingen, da dette vil resultere i redusert infectivity virus partikler. Selv om noen virus er tapt når forkaster nedbryting av infiserte celler, kan høyere titers skaffes fra celle laget.
    6. [P] umiddelbart fryse virus suspensjon i flytende nitrogen. Butikken på-80 ° C i minst 24 timer å sikre grundig frysing. Utvide til flere dager å avbryte prosedyren, hvis nødvendig.
    7. Utgivelsen virus partikler av tining på 37 ° C. Homogenize ved vortexing og sentrifuge for 5 min på 2500 x g og 4 ° C. Overføring av supernatants til merket cryotubes og butikk på-80 ° C.
      Merk: [O] lagre virus i aliquot størrelser tilstrekkelig for senere eksperimenter, som de fortrinnsvis tint bare én gang og brukes umiddelbart. [P] ytterligere fryse-Tin sykluser eller lagring på 4 ° C over flere dager føre til betydelig reduksjon av viral titers.
    8. [P] én dag før ytterligere passaging for å oppnå nødvendig mengde og titer, frø 4 x 106 produsent celler i 12 mL DMEM med 10% FBS 15 cm retter. Vaksinere med virus på et mangfold av infeksjon (MOI) av 0,03. Infisere i 8 mL av serum-free medium per plate og endre medium til DMEM med 10% FBS etter rugende celler for minst 2 h. skalaen opp ved hjelp av flere plater.
    9. Harvest som beskrevet i trinn 2.2.5, når syncytia har spredt over hele cellen laget. Basseng av innhentet suspensjon i 50 mL rør og prosess som beskrevet i trinn 2.2.6–2.2.7.
      Merk: [O] det er avgjørende å sjekk alle plater visuelt for bakterier og sopp forurensning før høstingen. Generelt, når alle cellelinjer regelmessig for forurensning med mycoplasma eller adventivskudd virus ved multiplex PCR.
  3. [P] Evaluer viral titers. Bestemme titers virus aksjer i octuplicates per aliquot bruker 96-brønns plater. Utfør titrering av tre individuelle dele per virus redning og bruker gjennomsnittsverdien til å beregne mengden av virus suspensjon i eksperimenter.
    1. [P] bassenget produsent celler, teller, og Juster 1,5 x 105 celler per mL i DMEM med 10% FBS.
    2. [P] Pipetter 90 µL av DMEM med 10% FBS i hver brønn av en 96-brønns plate.
    3. [P] legge 10 µL fra en aliquot på virus lager alle 8 brønner i den første kolonnen av platen og bland godt av pipettering opp og ned minst 10 ganger.
    4. [P] utføre føljetong 10 ganger fortynninger av viruset. Overføre 10 µL av hver brønn fra først til den andre kolonnen bruker en flerkanals pipetter. Bland godt av pipettering opp og ned og bruker ferske Pipetter tips for steg fortynning. Kast 10 µL fra hver brønn for den siste kolonnen.
      Merk: Hver 96-brønns plate gir 12 føljetong fortynning skritt. [M] for MV vektorer, 8 av 10 ganger fortynninger er vanligvis tilstrekkelig, som titers over 1 x 109 celle smittsomme enheter (ciu) /mL er sjelden oppnådd av metoden for overføring som er beskrevet i trinn 2.2. [P] kontroll brønner uten virus kan brukes til sammenligning og for å overvåke forurensing.
    5. [P] legge 100 µL av cellen suspensjon i hver brønn og ruge på 37 ° C, 5% CO2 for 48 h. Kontroller at celle klumper i suspensjon å oppnå homogene distribusjon av celler.
    6. [P] sjekk for syncytia med lys mikroskop. Telle syncytia i hver brønn i kolonnen med den høyeste fortynningsfaktoren inneholder synlige syncytia.
    7. [P] beregne gjennomsnittlig antall syncytia per brønn i kolonnen ved å dele antall syncytia åtte. Multipliser at gjennomsnitt med fortynningsfaktoren for den respektive kolonnen, fra 102 ciu per mL for den første kolonnen53 (se figur 5 som et eksempel).

3. bestemme Replicative og cytotoksiske kapasitet på Viral vektorer koding Immunomodulators

  1. [O] sammenligne replikasjon kinetikk genererte rekombinant viruset og uforandret vektoren med ett trinn eller flere trinn vekst kurver (GCs). For ettrinns GCs, er viral avkom vurdert etter samtidige infeksjon av alle celler (teoretisk 100% infeksjon). Flere trinn GCs starter på en lav prosentandel av infiserte celler å følge flere runder med virus replikering.
    1. [M] for analyse av meslinger viruset replikasjon kinetikk, frø 1 x 105 Vero celler i 1 mL av DMEM med 10% FBS per brønn på 12-vel plater én dag før infeksjon. Plate minst to brønner for hver timepoint rundt som teknisk gjentak.
    2. [O] infisere cellene med virus på lav MOI for flere trinn eller høy MOI for ettrinns GCs [M] (0,03 og 3 MV replikering på Vero cellene, henholdsvis). Erstatt medium med 300 µL av serum-fri medium som inneholder den respektive mengden virus og ruge på 37 ° C og 5% CO2 for minst 2 h. Fjern inoculum, legge til 1 mL av DMEM med 10% FBS, og fortsette inkubasjon.
    3. [P] på relevante timepoints som 12 høste 24, 36, 48, 72 og 96 h etter infeksjon, viral avkom ved direkte skraping celler til medium. Overføre innholdet i hver brønn til en individuell rør, snapin-fryse i flytende nitrogen og lagre-80 ° c til titrering.
      Merk: [P] Repliker eksempler kan være samlet på dette trinnet for analyse av gjennomsnitt titers.
    4. [P] samle eksempler fra alle timepoints. Tine samtidig på 37 ° C for vurdering av viral avkom. Vortex og pellets celle rusk med sentrifugering i 5 min på 2500 x g og 4 ° C.
    5. [P] beregne gjennomsnittlig titers hver konstruksjon og timepoint som beskrevet ovenfor. Tegne titers over tid. Sammenligne vekst kurver av vektorer med og uten innsatte effekter av transgener, med ulike effekter av transgener eller effekter av transgener satt til forskjellige posisjoner (se figur 6en).
  2. [O] sammenligne lytisk aktivitetene til immunomodulator-koding og uforandret.
    1. [O] Velg fra mulige metodikker inkludert impedans målinger, laktat dehydrogenase (LDH) løslate analysen, eller stoffskifte-baserte kolorimetrisk celle levedyktighet søk [f.eks, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) og 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) Søk].
      1. [M] for å analysere cytotoksisitet av meslinger analysen viruset vektorer ved hjelp av XTT, frø Vero celler som beskrevet i trinn 3.1.1. Ta av en ikke-infisert kontroll for hver timepoint.
        Merk: [O] utfører XTT analysen på forskjellige timepoints på samme prøven kan begrense tekniske feil, men gjentatte vask og eksponering XTT reagens påvirker antall levedyktige cellers. Impedans gir en alternativ avlesning for kontinuerlig målinger.
    2. [M] infisere Vero cellene på en MOI 1 som beskrevet i trinn 3.1.2.
      Merk: [M] for infeksjon av mindre ettergivende målcellene som noen murine svulst cellelinjer, kan en høyere MOI 3 eller 5 være nødvendig.
    3. [O] på timepoints av interesse (f.eks., 12, 24, 36, 48, 72 og 96 h etter infeksjon) klargjøre den nødvendige mengden av XTT reagens (i.e., 300 µL per godt pluss 10% overflødig). Unngå lyseksponering.
    4. [M] på hver timepoint, Fjern du middels fra respektive brønnene. Erstatte med 300 µL av XTT-reagensen og ruge på 37 ° C i mørket. Samle supernatants når reagensen i kontroll brønnene har slått dyp rødt, som vanligvis tar mellom 15 minutter og 2 h, og fryse på 20 ° C.
      Merk: [O] inkubasjon ganger avhenger av virus konstruksjon, celle type, tetthet og cytopathic effekt.
    5. [O] etter samle alle prøver, tine samtidig. Overføre 100 µL av hvert utvalg til en 96-brønns plate og måle optisk absorbans ved 450 nm, med 630 nm som en referanse bølgelengde.
    6. [O] plot timepoints (x-aksen) vs. optisk absorbansen av prøver i forhold til kontroller, angi metabolsk aktivitet som et surrogat for cellen levedyktigheten (y-aksen). Redusere relative absorbansen over tid innebærer viral cytotoksisitet (se figur 6B).

4. analysere aktiviteten til Virus-kodede Immunomodulators skilles ut fra infiserte celler

  1. [O] isolere utskilles transgene produkter uttrykt av virusinfiserte målcellene.
    1. [P] la virus produsent cellene vokse til 70% confluency i T175 flasker.
    2. [P] fjerne mediet fra celler og vask to ganger med 12 mL PBS fjerne serum. Vaksinere celler med virus på en MOI 0.03 i 12 ml av serum-free medium og ruge på 37 ° C og 5% CO2 over natten. Erstatt medium med 12 mL av fersk serum-free medium.
      1. [M] for Edmonston B virus, overføre celler fra 37 til 32 ° C etter 40 h for en annen 24 timer med inkubering å lette infeksjon og forhindre tidlig sprengning av syncytia. Avhengig av viruset belastning kan51,52 og syncytia progresjon, inkubasjon temperaturer og klokkeslett bli justert for optimal protein avkastning og renhet.
    3. [P] nøye samle supernatants uten koble celler før syncytia brast. Optimalt, har syncytia spredt over hele cellen laget. Pool supernatants i 50 mL rør.
      Merk: [P] for effektiv rensing av transgene produktet, unngå sprengning av syncytia og minimere celle rusk når høsting supernatants av infiserte celler.
    4. [P] fjerne celle rusk fra nedbryting av sentrifugering i 5 min på 2500 x g og 4 ° C og passerer gjennom 0.22 µm filtre. Avhengig av det totale volumet av filtratet, kan dette utføres ved hjelp av en sprøyte eller en vakuumpumpe.
    5. [O] isolere transgene produktet ved hjelp av en passende rensing metoden. Rense proteiner med en hexa-histidin (hans) kode ved affinitet exchange kromatografi med Ni-NTA mini spinn kolonner38 som beskrevet her kort (trinn 4.1.5.1–4.1.5.4).
      Merk: [O] utføre alle skritt raskt og på is. Pre chill buffere og pre kule sentrifuge til 4 ° C.
      1. [O] forberede 100 mL hver bufferen med PBS, 200 mM natriumklorid og imidazole på siste konsentrasjoner av 10 mM (vask buffer 1, WB1), 20 mM (vaske bufferen 2, WB2) og 500 mM (elueringsrør buffer, EB). Justere pH av WB1 og WB2 til 8.0 og EB 7.0. Avhengig av proteinet renses og må imidazole konsentrasjoner justeres.
      2. [O] likevekt kolonner med 600 µL WB1 og sentrifuger 800 x g i 2 minutter med en åpen lokk.
      3. [O] laste 600 µL av filtrerte supernatants på kolonner. Tillate binding av hans-merket proteiner til kolonnen matrix med sentrifugering 200 x g 5 min med lukket lokk. Lasting og binding kan gjentas opptil totalt 300 µg hans-merket protein per kolonne.
      4. [O] vask thrice med WB1 og en gang med WB2, eller til gjennomflytsenhet er fargeløs. Legge til 600 µL av bufferen og spinn på 800 x g i 2 minutter med åpne lokket.
      5. [O] elute protein i en fersk rør ved å utføre to elueringsrør trinn med 300 µL av EB og sentrifugering i 2 minutter på 800 x g.
      6. [O] desalt og konsentrere produktet ved hjelp av sentrifugal filtre etter produktstørelse. Legge til PBS et volum på 15 mL og filteret via sentrifugering i 10 min 4000 x g. Gjenta til ønsket renhet og konsentrasjonen er oppnådd. For å øke protein konsentrasjon, redusere det siste bindet til ca 200 µL av sentrifugering for 40 min 4000 x g.
  2. [O] bekrefte renhet og identiteten til produktet.
    1. [O] kvantifisere mengden totalt protein i isolert bruker standard kolorimetrisk analyser som bicinchoninic syre (BCA) eller Bradford analysen54,55. [M] verdiene kan variere fra 1 – 3 µg transgene produkt per mL nedbryting av infiserte celler.
    2. [O] for relativ kvantifisering av protein isolat, separate via natrium dodecyl sulfate polyakrylamid gel geleelektroforese (SDS-side) og utføre Coomassie flekker56.
    3. [O] Bekreft identiteten til renset produkter ved immunoblotting med spesifikke antistoffer målretting protein eller en tilknyttet peptid tag57.
    4. [O] analysere protein bindende spesifisitet ved hjelp av teknikker som kan inkludere enzym knyttet immunosorbent analysen (ELISA) eller flow cytometri (se figur 7). Cellen binding kan bekreftes ved hjelp av en nylig beskrevet magnetiske pulldown analysen38.
      Merk: [O] Bruk egnede kontroller. I celle bindende analyser, ta med negative kontroller celler ikke uttrykke målrettet molekylet (som i figur 9) og ikke målretting protein surrogater (Figur 8). Flow cytometri eksperimenter, inkluderer positive, negative og isotype kontroller (figur 7).
      1. [O] co ruge målet celler og protein isolere for å tillate binding. [B] for binding analyse av BTEs til perifert blod mononukleære celler (PBMCs) isolert fra menneskeblod58, ruge 2.5 x 106 celler med 200 ng av BTE i 100 µL av PBS med 1% FBS (bindende buffer, BB) 1t på is.
      2. [B] vask celler med 1 mL av BB fjerne ubundet protein. Sentrifuge på 300 x g i 5 min, forkaste nedbryting og resuspend pellets i 100 µL av BB. Legg biotinylated antistoff målretting protein av interesse eller en tilknyttet peptid-kode og ruge på is 30 min. For BTEs med influensa hemagglutinin (HA) tag, bruk 100 ng til anti-HA-Biotin (klone 3F10).
      3. [B] vask celler to ganger med 1 mL av BB og resuspend i 80 µL av BB. Legge til 20 µL av streptavidin-kombinert magnetiske microbeads og ruge i 15 min på 4 ° C.
      4. [B] vask en gang for å fjerne overflødig perler og resuspend pellets i 500 µL av BB supplert med 2 mM EDTA (kolonne buffer, CB).
      5. [B] isolere celler med kolonner og en magnetisk stå etter leverandørens manuell.
        1. [B] likevekt ved at 500 µL av CB å passere gjennom kolonnen gravitasjon flow.
          Merk: [B] kolonnen må aldri gå tørr. Pipetter forsiktig og degas bufferne for å unngå bobler.
        2. [B] plasserer en ren tube kolonnen og gjelder kolonnen cellen/perle suspensjon. Vask kolonnen tre ganger med 500 µL av CB per vask. Gjennomflytsenhet prøver av suspensjon og minst første vask skritt i røret, og deretter lagre på is.
        3. [B] elute perle-bundet celler beholdes av magnetfeltet. Dette fjerne kolonnen fra magnetiske stativet, plasserer den over en ren tube, Legg 1 mL av CB og raskt presse bufferen gjennom kolonnen inn i røret ved hjelp av en stempelet. Holde røret på is.
      6. [B] sentrifuge rør som inneholder gjennomflytsenhet og elueringsrør prøver for 20 min på 16.000 x g og 4 ° C pellets celler. Forkaste supernatants og lyse cellene i en radioimmunoprecipitation-analysebuffer (RIPA) (foreslått: 75 µL). Utføre SDS side56.
      7. [B] utføre immunoblotting med et passende primære antistoff. Antistoffer kan målrette transgene produktet eller et mobilnettet protein (f.eks., β-utgangen, Figur 8) å vurdere BTE-celle bindende.
  3. [O] vurdere immunologiske funksjonaliteten til isolerte immunomodulators.
    1. [O] identifisere relevante analyser basert på egenskapene til den kodede immunomodulator. Om forventet immunmodulerende aktiviteten, kan metoder vurdere celle spredning, migrasjon, modning, aktivisering eller cytotoksisitet brukes.
      Merk: [O] celle spredning kan analyseres av CFSE59 merking eller Ki67 flekker60. Transwell eller scratch eksperimenter er tilgjengelige til å analysere celle migrasjon61. Modning og aktivering av celler kan vurderes ved hjelp av riktig flekker protokoller for respektive markører. [B] tilgjengelig teknikker å vurdere BTE-mediert mobilnettet cytotoksisitet inkluderer impedans målinger og krom løslate analysen. Hvis velger krom utgivelsen analysen, observere riktige sikkerhetstiltak ved håndtering av radioaktivt materiale.
    2. [B] som en ikke-radioaktivt beskriver følgende i detalj hvordan du evaluerer BTE-indusert, celle-mediert cytotoksisitet av LDH utgivelsen analysen (beskrevet tidligere i kort38).
      1. [B] bestemme vilkårene skal testes under eksperimentet (se figur 9 som et eksempel). Timepoints (timer til dager), konsentrasjoner av immunomodulator (pg/mL til µg/mL) og effektor til målet cellen (E:T) prosenter (mellom 1:50 og 50:1, for eksempel) kan varieres. Alltid forberede prøver triplicates.
      2. [B] ta prøver uten protein og uten Effektor celler, kontroller for spontane LDH slipper typene enkeltcelle (Tsp og Esp), en målet cellen maksimal lysis kontroll (Tmax) med vaskemiddel før avlesning, et medium bare kontroll og volumkontroll for TMaks.
        Merk: [B] nødvendig antall målcellene og inkubasjon ganger kan variere. Utføre innledende test kjører uten Effektor celler og immunomodulators til å identifisere optimale parametere. Inkluder Tsp og Tmax prøver og tilsvarende kontroller å vurdere ulike celle tall og timepoints.
      3. [B] isolere immun Effektor celler f.eks ved (tetthet gradert sentrifugering menneskelig blod å få PBMCs58 ) eller negativ utvalg av murine T celler fra mus splenocytes62.
      4. [B] frø målet celler i henhold til trinn 4.3.2 (f.eks, 5 x 10³ per brønn) i en U-bunn 96-brønns plate.
      5. [B] legge isolert protein på ønsket konsentrasjoner til de respektive prøvene. Legge immun Effektor celler på ønsket prosenter. Legge til middels et totalt volum på 100 µL per brønn.
      6. [B] Incubate for tidsrammen fastsatt i trinn 4.3.2, vanligvis mellom 4 og 48 h (24 h for unstimulated PBMCs og 48 timer for fersk isolert murine T celler; kortere inkubasjon ganger kan søke om prestimulated immunceller), på 37 ° C og 5% CO2.
      7. [B] 45 minutter før samle utvalgene, legge 10 µL av 10 x lysis løsning brønner som inneholder Tmax prøver og tilsvarende middels kontrollene. Fortsette inkubasjon.
      8. [B] Nedspinning cellene på 250 x g for 4 min. overføre 50 µL av hver nedbryting til en flat bunn 96-brønns plate. Overfør ikke celler for å unngå celle-bundet LDH.
      9. [B] Forbered ifølge produsenten. Legg til 50 µL hver brønn og ruge på RT i mørket i 30 minutter eller til Tmax prøver slå dyp rød.
      10. [B] legge til 50 µL av stopp løsning i hver brønn. Fjerne luftbobler ved sentrifugering for 1 min 4000 x gog manuelt med en hul nål. Måle optisk absorbans ved 490 nm.
      11. [B] beregne % bestemt lysis verdier for hvert utvalg.
        1. [B] beregne gjennomsnitt for av middels kontroller med og uten lysis løsning. Trekk fått verdier fra eksperimentelle prøver og TMaks og spontan utgivelsen kontroller, henholdsvis. Bruke disse bakgrunn-korrigert verdiene for ytterligere beregninger.
        2. [B] beregne gjennomsnitt for bakgrunn-korrigert TmaxTspogsp E-kontroller. Bruker disse gjennomsnittsverdiene, gir følgende ligning prosentandelen av bestemte lyse for hver prøve:

          Equation 1
        3. [B] plot % bestemt lysis verdier vs protein konsentrasjon eller E:T forhold og sammenligne ikke målretting kontroll prøvene.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 illustrerer virkningsmekanismen kan meslinger virus koding bispecific T celle engagers. Et flytskjema som viser arbeidsflyten for denne protokollen vises i figur 2. Figur 3 viser et eksempel på en modifisert kan meslinger viruset genomet. Dette gir en visuell fremstilling av de bestemte endringene gjelder meslinger viruset anti-genom og bestemt funksjonene i innsatte effekter av transgener. Typisk meslinger viruset-indusert syncytia er avbildet i Figur 4. Merk høyt tettheten på timepoint for høsting redning (A, B), som angir at celle nummer kan bli redusert når gjenta eksperimentet. Inkubasjon temperaturer og -klokkeslett kan optimaliseres for passaging på Vero celler (C, D) for å oppnå bedre spredning av syncytia på platen. Figur 5 representerer resultatet av en typisk titrering analysen. I figur 6, ettrinns vekst kurver (A) og relative celle levedyktighet (B) etter vaksinering med uendret (MV) og BTE-koding vises kan meslinger virus (MV-H-mCD3xhCD20). Mens vekst kurver av forhold vektorer på Vero celler ligne, henger lytisk aktiviteten av transgene-koding viruset etter i murine svulst celle linje. Flow cytometri data av antigen-uttrykke målcellene inkubert med BTEs på fem forskjellige fortynninger finnes i figur 7, angir BTE binding av cellene en konsentrasjon-avhengige måte. Figur 8 representerer en eksemplarisk immunoblot etter magnetiske pulldown BTE-assosiert celler. Rullegardinmenyen med ikke målretting BTEs (n1, n2) ikke gi synlig mengder celler, mens band i elueringsrørets fraksjonen, indikativ av bundet celler, ble observert for målretting BTE prøver (t1, t2). BTE-mediert, målet antigen-spesifikke og konsentrasjon-avhengige cytotoksisitet murine T celler angis av en representant LDH utgivelsen analysen i figur 9.

Figure 1
Figur 1 : Virkningsmekanismen av kan meslinger virus koding en bispecific T celle agere (MV-BTE). Infeksjon av en svulst celle (infisert: grå, infisert: lys blå) med MV BTE etterfølges av viral replikasjon og spredning gjennom svulsten, som resulterer i svulst celle lyse og immune stimulering. Samtidig BTEs [bestående av to singelen kjedene avledet fra antistoffer målretting CD3 på T-celler (gul) og en svulst overflate antigen (blå)] produseres og skilles ut lokalt av virus-infiserte celler. BTE-mediert cross-linking med kreftceller induserer aktivering av hvile, polyklonale T-celler, som resulterer i ytterligere svulst celle drapet. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Flytskjema som beskriver arbeidsflyten utforming, generere og evaluere romanen viral vektorer koding immunmodulerende effekter av transgener. Trinn 1 til 4 gjenspeiler de respektive delene av protokollen. Punkt viser relevante hensyn og undertrinn. På grunn av empirisk natur prosedyren, kan justeringer eller forbedringer bli nødvendig på alle trinn i arbeidsflyten. I tillegg kan eksperimentelle resultatene føre til nye hypoteser og inspirere utviklingen av flere vektorer eller kombinasjon behandlinger. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Skjematisk fremstilling av en meslinger viruset genomet. Forbedret grønne fluorescerende protein (eGFP) er kodet i en ekstra transkripsjon enhet nedstrøms leder (ld) sekvensen. N, P, M, F, H og L angi vilt koding av meslinger viruset strukturelle proteiner nucleoprotein, P protein, matrix proteiner, fusion protein, hemagglutinin protein og store protein (utvalg), henholdsvis som er ulikt som visualisert ovenfor. En bispecific T celle agere (BTE) transgene settes inn i en ekstra transkripsjon enhet (ATU) nedstrøms H åpent lesing rammen. Transgene koder en Igκ leder peptid for effektiv sekresjon i tillegg til influensa hemagglutinin (HA) og hexa-histidin (hans) protein koder for deteksjon og rensing. Gener koding for variabel tunge (VH) og lys kjeden (VL) domener av antistoffer rettet mot CD3 og CD20, henholdsvis, er koblet via peptid koblingsfunksjonalitet sekvenser som inneholder glysin (G) og serine (S) rester. Transgene sekvensen er foran en Kozak sekvens. Nedstrøms koding regionen, ekstra nukleotider blitt inkludert exemplarily å overholde rettssikkerhet seks. Sett inn kassetten er flankert av to begrensning områder slik at innsetting i de respektive ATU. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Meslinger viruset-indusert syncytia. (A, B) Vero celler var transfekterte med cDNA for redning av rekombinant meslinger virus koding forbedret grønne fluorescerende protein (eGFP) og en bispecific T celle agere (BTE) rettet mot murine CD3 og menneskelige CD20. Tilstedeværelsen av en fluorescerende syncytium (hvite piler) angir vellykkede redningen av smittsomme virus. (C, D) Meslinger virus ble høstet etter redning og spres på Vero celler (passering 1). Store syncytia har dannet og allerede begynner å sprekke (gule piler). Bildene ble anskaffet av kontrast (B, D) og fluorescens mikroskopi etter eksitasjon 80 ms (A) og 100 ms (C). Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5 : Representant resultatet av en titrering analysen. Titrering av en tredje-passasjen bunke MV-H-mCD3xhCD20, en BTE-koding kan meslinger viruset, Vero celler. En 10 ganger føljetong fortynning ble utført på en 96-brønns plate, starter med 10 µL av virus suspensjon i hver brønn av kolonnen 1. var ingen syncytia i kolonnen 7, som indikert av nuller. For den neste laveste fortynning av virus suspensjon i kolonnen 6, ble gjennomsnitt seks syncytia per brønn observert, resulterer i en siste titer ca 6 x 107 celle smittsomme enheter (ciu) per mL virus suspensjon. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6 : Replikasjon kinetikk og lytisk aktivitet av rekombinant meslinger virus. (A) ettrinns vekst kurver ble generert etter smitte av Vero celler med uforandret kan meslinger viruset (MV) eller meslinger viruset koding en bispecific T celle agere (MV-H-mCD3xhCD20) på en MOI 1. Titers viral Progeny ble vurdert på utpekte timepoints etter infeksjon, som viser lignende virus replikasjon kinetikk. Betyr og standardavvik av åtte prøver (fire teknisk replikerer hver av to biologiske replikat per timepoint) vises. (B) cellen levedyktighet ble vurdert MC38 murint colorectal karsinom celler stabilt uttrykke menneskelige carcinoembryonic antigen og MV reseptoren CD46 (MC38-CEA-CD46) etter vaksinering med middels bare (falske) eller angitte virus på en MOI 1. XTT celle levedyktighet analysen ble utført på angitt timepoints. Reduksjon i cellen levedyktighet ble observert på tidligere timepoints for uforandret vektoren. Verdier over 100%, som beregnet for MV-H-mCD3xhCD20 på 12 h timepoint, er ofte observert etter infeksjon, som kan skyldes mobilnettet stress eller cellen-avledet faktorer presentere i virus suspensjon. Mean verdier pluss standardavvik av tre tekniske replikat vises for hver timepoint. Klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7 : Målet cellen binding av bispecific T celle engagers (BTEs) uttrykt fra meslinger virus-infiserte celler. Menneskelige mantelen celle lymfomer celler uttrykke endogenously CD20 (Granta-519) ble inkubert med menneskelige immunglobulin G blokkere Fc reseptorer, etterfulgt av inkubasjon med 2, 4, 6, 8 eller 10 µL (A) av renset mCD3xhCD20 BTE løsning, henholdsvis. BTE-bundet celler ble oppdaget ved hjelp av phycoerythrin (PE)-konjugert antistoff målretting BTE-assosiert HA-koden. Prosentandeler av farget celler korrelert med BTE konsentrasjoner. (B) kontroller for selektivitet og spesifisitet av bindingen. Vist her er kontroller fra et uavhengig eksperiment, inkludert en prøve hver av cellene ikke inkubert med BTE men med BTE målretting antistoffer bare (kontroll for uspesifikke bindingen av antistoff celler) eller en BTE som kan binde til cellene rundt , etterfulgt av inkubasjon BTE målretting antistoffer (positiv kontroll) eller en isotype antistoff. Hvis tilgjengelig, isogenic celler ikke uttrykke målet antigen valgfrihet kan brukes til å bekrefte binding selektivitet. Klikk her for å se en større versjon av dette tallet.

Figure 8
Figur 8 : Magnetisk rullegardinmenyen for menneskelig perifere blod mononukleære celler (PBMCs) bundet av meslinger viruset-kodet BTEs. Cellene ble inkubert med to forskjellige grupper av menneskelige T celle målretting (t1, t2) eller ikke målretting kontroll BTEs (n1, n2), henholdsvis. BTE-bundet celler ble beholdt på kolonner med magnetiske perler, pelleted og lysed. Β-utgangen i lysates ble oppdaget av immunoblotting. Intensiteter av band i elueringsrørets prøvene viser relativ BTE-celle bindende. Gjennomflytsenhet prøver bekrefte tilstedeværelse av celler i alle prøvene. Klikk her for å se en større versjon av dette tallet.

Figure 9
Figur 9 : Cytotoksiske aktivitet av meslinger viruset-kodet BTEs. Mål kreftceller (5 x 10³ B16-CD20-CD46 celler per brønn) ble inkubert med murine T celler i forholdet 1:50. BTEs tidligere renset fra nedbryting av MV-H-mCD3xhCD20-infiserte celler ble lagt i angitte konsentrasjoner. Relativ lysis av målcellene ble vurdert av LDH utgivelsen analysen etter 48 h. celler mangler BTE målrette antigen (B16-CD46) som referanse å evaluere antigen-spesifikke cytotoksisitet. Betyr pluss standardavvik av tre tekniske replikat per prøve vises. Antigen-uttrykke målcellene var spesielt lysed på en BTE konsentrasjon-avhengige måte. Renhet av BTE produktet og målet antigen uttrykket nivåer innflytelse celle drapet. I dagens eksempel ble 15% bestemt celle drapet oppnådd i en relativt høy BTE konsentrasjon av 1 µg/mL. Dette er en typisk verdi for slik en eksperimentelle oppsett med lange co inkubasjonstiden ganger og suboptimal T celle kultur forhold. I andre innstillinger, var opp til 60% bestemt drapet oppnådd, med BTEs renset fra MV-infiserte supernatants, nå et platå på BTE konsentrasjoner av 100 ng/mL og høyere38. Dette indikerer at omsatte, grensen for denne analysen er mindre enn 100% bestemt drap, som kan forklares med ulike vekst kinetics i Tmax kontroller sammenlignet co kultur prøver. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Kan immunterapi (i.e., overtid i kombinasjon med immunomodulation) har store løftet for kreftbehandling, krevende videre utvikling og optimalisering av kan virus koding immunmodulerende proteiner. Denne protokollen beskriver metoder for å generere og godkjenne slike vektorer for påfølgende testing i relevante prekliniske modeller og potensielle fremtidige klinisk oversettelse til romanen kreft therapeutics.

Mange ulike kan virus plattformer med forskjellige fordeler er tilgjengelig63. Kreft spesifisitet, vektor sikkerhet, krav til produksjon, effekt i svulst celle lyse og induksjon av immunreaksjoner er kloning kapasitet nøkkelen til vellykket vectorization av immunomodulators ved hjelp av en bestemt kan. Dessverre direkte sammenligninger av ulike OVs mangler nå og skal gjennomføres for å identifisere optimal behandlingstilbud for enkelte pasienter. Dette kan ordnes ved å fremme rasjonell utvikling og testing av romanen transgene-koding vektorer, som eksemplifisert her for MV-BTE. Gitt den fordelaktige beliggenheten til MV (dvs., oncotropism, sikkerhet, fusogenicity, immunogenisitet, muligheten for genetisk modifisering) fokuserer denne protokollen på denne kan vektor, som kan generaliseres for andre OV, spesielt paramyxoviruses .

For en rasjonell valg av potensielt relevant immunomodulators som kandidat effekter av transgener (trinn 1.1.1) er en grundig forståelse av kreft-immunitet syklusen viktig, gjør systematisk litteratur forskning uunnværlig. I tillegg store skjermer, skjønt kostbar, kan bevise verdifullt å identifisere romanen mål (f.eks se Patel et al.41).

For design av rekombinant OVs anses ønsket uttrykket profiler. Ved RNA-virus kontrolleres genuttrykk på RNA nivå av de respektive faglige utvalg. Når du utformer transgene kassetter for innsetting MV genomer (trinn 1.1.2), er unngå sekvenser som ligner MV polymerase genet start/stopp signaler og RNA redigering nettsteder og etter regelen av seks avgjørende for vellykket vektor utvikling. Videre tilsvarer paramyxovirus gene expression nivåer posisjonering i genomet, som følge av et uttrykk gradient43. Generelt, øker plassering av transgene i oppstrøms stilling uttrykk på bekostning av redusert replikering. Men avhenger disse parametrene også størrelse, struktur og rekkefølgen av de respektive transgene. Derfor er en begrensning av metodikk beskrevet i denne protokollen behovet for empirisk testing av romanen vektor design. I bestemte tilfeller, justeringer av transgene rekkefølgen eller posisjonering kan være nødvendig for å oppnå ønsket vektor egenskaper (figur 2). Systematisk Sammenlikning av ulike stillinger for checkpoint antistoff setter inn viste optimale resultater for H- ATU (upubliserte data). BTE setter har sammenlignbare egenskaper (størrelse og immunglobulin domener), MV BTE vektorer ble klonet analogt38.

Redning av smittsomme partikler fra virus cDNA (trinn 2.1) kan kreve flere forsøk for noen konstruksjoner. Justere cellen tallene kan optimalisere celle tetthet for syncytia-formasjonen. Mens en bestemt tetthet er nødvendig for effektiv celle til celle spredning og blanding av celle membraner, reduserer kontakt hemming viral replikasjon. Videre, hvor mange smittsomme partikler kan ikke være tilstrekkelig til å indusere synlig celle fusion. Men som virus kan være tilstede i fravær av syncytia, kan redning prøver likevel høstes og overført til frisk produsent celler for potensielle overføring. Ineffektiv transfection på grunn av dårlig DNA kvalitet eller upassende eller forringet transfection reagenser representerer typiske problemer som er relativt enkle å vurdere og rette ved å generere nye DNA forberedelser og testing forskjellige reagenser, henholdsvis.

Vellykket virus overføring (trinn 2.2) er avgjørende avhengig av forholdene bestemme viral replikasjon og celle lysis. Anbefales bruker lav passasje antall produsent celler, og infiserte celler skal kontrolleres regelmessig for syncytia progresjon. Justere cellen tallene, kan temperaturer og inkubasjon ganger være nødvendig å balansere viral spredning vs. celle spredning.

En avgjørende begrensning av metoden beskrevet av virus er utarbeidelsen av virus suspensjoner fra råolje celle lysates. Forskere bør være klar over det faktum at viruset suspensjon inneholder cellulære faktorer. Viruspartikler kan være konsentrert via tetthet gradert/sukrose pute ultracentrifugation på bekostning av antall smittsomme partikler og også potensielt økende konsentrasjoner av mobilnettet restene. Virus kan også være konsentrert fra infiserte cellen supernatants, øker renhet men redusere totale avkastning. GMP og storskala produksjon av paramyxoviruses er vanligvis utføres ved hjelp av flere lag med produsent celler seeded på en filament netto i bioreactors for økt titer gi63. Nøyaktig overvåking, kontinuerlig media utveksling, serum-free forhold og påfølgende filtrering trinnene sikrer høy renhetsgrad produsert virus.

Evaluering av viral titers (trinn 2.3 og 3.1) via de beskrevet syncytia telling metoden er ikke nøyaktig, men det er enkelt å utføre og tilstrekkelig nøyaktig ved tilstrekkelig antall teknisk replikerer. Når du vurderer OV-mediert cytotoksisitet (trinn 3.2), må begrensninger i tilgjengelige analyser vurderes. Metabolsk analyser skiller ikke mellom cytostatic og cytolytic effekter av eksperimentell behandlinger. For å måle cytolysis, kan LDH utgivelsen analysen utføres. Begge typer analyser kan imidlertid påvirkes av innholdet av virus preparater fra råolje celle lysates (figur 6).

Isolering av proteiner uttrykt av virus-infiserte celler (trinn 4.1) kan variere i yield og renhet, avhengig av respektive transgene og virus brukt og teknisk nøyaktighet. Dermed er kvalitetskontroll av protein rensing avgjørende for vurdering av relaterte eksperimentelle resultater.

Som en uttømmende beskrivelse for potensielle funksjonelle analyser dekker rekke mulige immunomodulators er utenfor omfanget av denne publikasjonen, fokuserer denne protokollen på ex vivo metode for å måle mobilnettet cytotoksisitet (trinn 4.3). Mobilnettet cytotoksisitet, spesielt av CD8 + T celler, er en viktig formidler av immunologiske svulst kontroll i vellykket immunotherapies64. Dette har viktige implikasjoner for gjeldende immunterapi tilnærminger bruker antistoffer til å forbedre anti-tumor immunreaksjoner generelt og bispecific T celle engagers spesielt. Lokale BTE uttrykk av kan vektorer har gitt lovende resultater i flere prekliniske studier, inkludert RNA38 og DNA virus65,66,67,68.

På grunn av de komplekse interaksjonene svulst, virus, transgene produkt og vert immunsystemet i levende organismer, validering av immunomodulator-koding kan vektorer i cellekultur som vist her ikke er tilstrekkelig til å forutsi terapeutiske resultater. Viktigere, foreslåtte isolert vurdering av vektor og immunomodulator funksjoner, henholdsvis er avgjørende konseptbeviskode men unnlater å beskrive mulige synergier og komplekse interaksjoner i svulst microenvironment. Testing for både toksisitet og effekt i relevante i vivo modeller er avgjørende for videre utvikling av romanen rekombinant vektor konstruerer men ikke enkelt oppnås. Immunologiske sikkerhet overvåkes regelmessig i ikke-menneskelige primater som aper, og musen modeller brukes for biodistribution og effekt analyserer20,69. Men mange av disse modellene har begrensninger med hensyn til uttrykk for virus reseptorer i vert vev og vert toleranse, og noen bare etterligne det komplekse samspillet mellom OV svulst og immun microenvironment. Dermed er nøye vurdering av aktuelle modeller obligatorisk.

MV-BTE behandling har tidligere blitt evaluert i menneskelig xenograft og syngeneic musen modeller. Ingen BTE transgene produkter var i serum mus behandlet med BTE-koding MV38, indikerer vellykket forebygging av systemisk eksponering selv uten ytterligere demping av den naturlig oncotropic vaksine belastning virus. Lokale uttrykk er avgjørende for OV-kodede immunomodulators som er giftige når det gis systemisk. Eventuelt svulst spesifisitet kan forsterkes med ny målretting celle overflate markører valg70,71,72 og de microRNA-baserte målretting for forbedret oncotropism73,74 ( gjennomgått av Ruiz og Russell75). Ytterligere endringer kan innføres for å optimalisere vektorer for bestemte terapeutisk bruk (anmeldt av Miest og Cattaneo76), inkludert innsetting av effekter av transgener for diagnoseformål77,78 eller prodrug konvertering til redusere bivirkninger av kjemoterapi79,80, innføring av sikkerhet bytter81og målretting av svulst stroma eller blodkar (f.eks via bispecific antistoffer82).

Bortsett fra genetisk modifisering av viral vektoren, kombinasjon regimer med chimeric antigen reseptor (bil) T celle overføre83, kjemoterapi84,85,86eller strålebehandling87, 88 , 89 ytterligere øke repertoaret av overtid. MV immunitet er svært utbredt, strategier for å omgå antistoff nøytralisering er utviklet, inkludert utveksle konvolutten glykoproteiner for de relaterte paramyxoviruses90, polymer-belegg av partikler, bruker celle flyselskapene levere virus og forbigående immunsuppresjon (anmeldt av Russell et al.6). Videre utvikling av avansert OV immunterapi regimer krever testing av sikkerhet og terapeutisk effekt passende dyr modeller med pasienten materiale, og til slutt, i kontrollerte kliniske studier.

Gitt mengde mulige kombinasjoner, er omfattende testing ikke gjennomførbart. Matematisk modellering kan hjelpe i prioritering av potensielle kombinasjon regimer som deres respektive dosering og planlegging av forutsi behandlingsresultater i sili (anmeldt av Santiago et al.91). Når du tester efficacies roman, rasjonelt designet vektorer, lyd følger translasjonsforskning er instrumental for en dypere forståelse av underliggende virological og immunologiske prosesser. Dette er avgjørende for generering av aktuelle modeller, informasjon om videre potensielle mål og avansement innen generelt. Avslutningsvis vil førstehånds innsikt i relevante metoder for vektor design, generasjon og karakteristikk i denne bransje akselerere utviklingen og støtter utforsking av romanen therapeutics for fremtidige klinisk oversettelse.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

CE Engeland er oppført som oppfinnerne av en patent vedrørende RNA-virus for kreft Immunovirotherapy eid av Heidelberg University. J.P.W. Heidbuechel har ikke noe å avsløre.

Acknowledgments

Disse metodene ble etablert i gruppen Virotherapy ledet av professor Dr. Dr. Guy Ungerechts ved National Center for svulst sykdommer i Heidelberg. Vi står i gjeld til ham og alle medlemmer av laboratoriet team, spesielt Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler og Jessica Albert. Dette arbeidet ble støttet av den andre Kröner-Fresenius-Stiftung (Grant 2015_A78 til CE Engeland) og tysk National Science Foundation (DFG, gi EN 1119/2-1 til CE Engeland). J.P.W. Heidbuechel mottar et stipend av Helmholtz International Graduate School for kreftforskning.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics