Paramyxoviruses für Tumor-gezielte Immunmodulation: Gestaltung und Evaluation Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Dieses Protokoll beschreibt einen detaillierten Workflow für die Generierung und ex-Vivo Charakterisierung von onkolytische Viren für den Ausdruck von Immunmodulatoren, Masern-Viren Codierung bispezifische T Zelle Engagers als Beispiel verwenden. Anwendung und Anpassung an andere Vektor-Plattformen und transgene beschleunigt die Entwicklung von neuartigen Immunovirotherapeutics für klinische Übersetzung.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Erfolgreich den Krebs-Immuntherapie hat das Potenzial, langfristige Tumorkontrolle zu erreichen. Trotz der jüngsten klinischen Erfolge bleibt ein dringender Bedarf an sicheren und wirksamen Therapien auf individuellen Tumor immun Profile zugeschnitten. Onkolytische Viren ermöglichen die Induktion von Anti-Tumor-Immunantwort sowie Tumor beschränkt Genexpression. Dieses Protokoll beschreibt die Erzeugung und Ex Vivo-Analyse der immunmodulatorische onkolytische Vektoren. Fokussierung auf Masern-Impfstoff Viren Codierung bispezifische T Zelle Engagers als Beispiel, kann die allgemeine Methodik zu anderen Virus-Arten und transgene angepasst werden. Die dargestellte Workflow umfasst Design, Klonen, Rettung und Verbreitung von rekombinanten Viren. Assays zur Replikation Kinetik und lytische Aktivität des Vektors sowie Funktionalität des isolierten Immunmodulator ex Vivo Analyse enthalten sind, und erleichtert so die Generation der neuen Agenten für die weitere Entwicklung in präklinischen Modellen und letztlich klinische Übersetzung.

Introduction

Onkolytische Viren (OVs) entstehen als Anti-Krebs-Therapeutika, die speziell in replizieren und Tumorzellen zu töten, wobei gesundes Gewebe intakt bleibt. Es ist mittlerweile gemeinsamen Verständnis, dass onkolytische Virotherapie (OVT), in den meisten Fällen, verlässt sich nicht allein auf komplette Tumor-lyse durch effiziente Replikation und die Verbreitung des Virus, aber erfordert zusätzlichen Wirkmechanismen Behandlungserfolg, einschließlich vaskuläre und Stromazellen targeting und allem Immunstimulation1,2,3,4. Während viele OV Frühstudium unveränderte Viren verwendet, hat aktueller Forschung profitiert eine verbesserte biologische Verständnis, Virus Biobanken, die potenziell Roman OVs und die Möglichkeiten der Gentechnik um erweiterte OV schaffen enthalten Plattformen5,6,7.

Angesichts der jüngsten Erfolge der Immuntherapie, sind immunmodulatorische transgene von besonderem Interesse bezüglich der Gentechnik OVs. Gezielte Ausdruck solcher gen-Produkte von OV-infizierte Tumorzellen reduziert die Toxizität im Vergleich zu systemischen Verabreichung. Targeting wird mithilfe von Viren mit inhärenten Oncoselectivity oder durch Ändern der viralen Tropismus8erreicht. Lokalen Immunmodulation verbessert die facettenreichen anti-Tumor-Mechanismen der OVT. Darüber hinaus ist diese Strategie maßgeblich daran beteiligt das Zusammenspiel zwischen Viren, Tumorzellen und dem Immunsystem des Wirts zu verhören. Dieses Protokoll sieht zu diesem Zweck einen anwendbar und einstellbaren Workflow zu gestalten, Klonen, zu retten, zu propagieren und validieren onkolytische Paramyxovirus (speziell Masernvirus) Vektoren Codierung solche transgene.

Modulation der Immunantwort kann durch eine Vielzahl von Transgen-Produkten, die auf verschiedenen Stufen der Krebs-Immunität Zyklus9, einschließlich der Verbesserung der Tumor Antigen Anerkennung [z. B. Tumor-assoziierten Antigenen (TAAs) oder Induktoren der erreicht werden großen Histocompatibility complex (MHC) Klasse I Moleküle] über Unterstützung von dendritischen Zellen Reifung für effizienten Antigenpräsentation (Zytokine); Rekrutierung und Aktivierung gewünschte Immunzellen wie zytotoxische und T-Helfer-Zellen [Chemokine, bispezifische T Zelle Engagers (HdOs)]; Ausrichtung auf unterdrückerische Zellen wie regulatorische T-Zellen, myeloische abgeleitet Suppressor-Zellen und Tumor-assoziierten Makrophagen Krebs-assoziierten Fibroblasten (Antikörper, BTEs, Zytokine); und Vermeidung von Effektor Zellen Hemmung und Erschöpfung (Checkpoint-Hemmer). So gibt es eine Fülle von biologischen Arbeitsstoffen. Bewertung von solchen Virus-codierte Immunmodulatoren zur therapeutischen Wirksamkeit und mögliche Synergien sowie Verständnis der jeweiligen Mechanismen ist notwendig, Verbesserung der Krebstherapie.

Negativen Sinne einzelsträngigen RNA-Viren der Familie Paramyxoviridae zeichnen sich durch mehrere Merkmale förderlich für ihre Verwendung als onkolytische Vektoren. Dazu gehören ein natürliches Oncotropism, große genomische Kapazität für transgene (mehr als 5 kb)10,11, effiziente Verbreitung einschließlich Syncytia Bildung und hohe Immunogenität12. Daher OV-Plattformen basierend auf Hundestaupe Virus13, Mumps-Virus14, Newcastle Disease Virus15, Sendai-Virus16,17, simian Virus 518und Modellorganismus Paramyxovirus19 entstanden sind. Vor allem live abgeschwächten Masern-Virus-Impfstoff, die Stämme (MV) in präklinischen und klinischen Entwicklung20,21vorangekommen sind. Diese Virusstämme wurden jahrzehntelang für Routineimpfungen mit einen ausgezeichneten Sicherheit Aufzeichnung22verwendet. Darüber hinaus gibt es kein Risiko für insertional Mutagenese durch die streng cytosolischen Replikation von Paramyxoviruses. Ein vielseitiges reverse Genetik-System basierend auf Anti-genomische cDNA ermöglicht eine Einfügung von transgenen in zusätzliche Transkriptionseinheiten (ATUs) ist verfügbar11,23,24. MV-Vektoren Codierung Natrium-Iodid-Symporter (MV-NIS) für Bildgebung und Strahlentherapie oder lösliche carcinoembryonales Antigen (MV-CEA) als ein Surrogat-Marker für virale Genexpression werden derzeit in klinischen Studien (NCT02962167, NCT02068794, geprüft NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 und NCT00408590). Sichere Verwaltung bestätigt wurde und der Anti-Tumor-Wirkung wurden Fälle in früheren Studien25,26,27,28,29, 30 (rezensiert von Msaouel et al.31), ebnet den Weg für zusätzliche onkolytische Masern-Viren, die entwickelt wurden und preclinically getestet. MV Codierung immunmodulatorische, die Moleküle gezielt verschiedene Schritte des Krebs-Immunität Zyklus gezeigt worden, um Tumorwachstum verzögern und/oder verlängert Überleben bei Mäusen, mit Nachweis für immun-vermittelte Wirksamkeit und schützende immun Langzeitgedächtnis im Phänomen Maus-Modellen. Vektor-codierte transgene gehören Granulozyten-Makrophagen-Kolonie-stimulierende Faktor (GM-CSF)32,33, H. Pylori Neutrophilen-aktivierende Protein34, immun Checkpoint-Hemmer35 Interleukin-12 (IL-12)36, TAAs37und BTEs38, die ein Tumor Oberflächenantigen mit CD3 zu vernetzen und so induzieren anti-Tumor-Aktivität von polyklonalen T-Zellen, unabhängig von der T-Zell-Rezeptor Spezifität und Co-Stimulation ( ( Abbildung 1). Die vielversprechende präklinische Ergebnisse für diese Konstrukte weitere translational Anstrengungen bedarf.

Talimogene Laherparepvec (T-VEC), eine Art ich Codierung GM-CSF, Herpes-Simplex-Virus ist die einzige onkolytische therapeutische genehmigt durch die United States Food und Drug Administration (FDA) und European Medicines Agency (EMA). Die Phase-III-Studie führt zu Genehmigungen Ende 2015 hat nicht nur Wirksamkeit auf dem Gelände des Intra-Tumor Injektion, aber auch Abscopal Effekte (z.B. Remissionen nicht injiziert Läsionen) in fortgeschrittenem Melanom39gezeigt. T-VEC getreten da zusätzliche Prüfungen für die Anwendung in anderen Tumorentitäten (z.B., nicht-Melanom-Hautkrebs, NCT03458117, Bauchspeicheldrüsenkrebs, NCT03086642) sowie eine Bewertung der Kombinationstherapien, vor allem mit immun-checkpoint Inhibitoren (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 und Ribas et al.40).

Dies zeigt nicht nur das Potential der onkolytische Immuntherapie, sondern auch die weiteren Forschungsbedarf, hervorragende Kombinationen von OVT und Immunmodulation zu identifizieren. Rationales Design von zusätzlichen Vektoren und ihre Entwicklung zur präklinischen Prüfung ist der Schlüssel zu diesem Unternehmen. Dies wird auch Verständnis der zugrunde liegenden Mechanismen voraus und hat Auswirkungen auf die Entwicklung hin zu stärker personalisierten Krebstherapie. Zu diesem Zweck präsentiert dieser Publikation die Methodik für die Modifikation und Entwicklung von Paramyxoviruses für gezielte Krebsimmuntherapie und genauer gesagt, der onkolytische Masern-Viren Codierung T-Zell-Gewinnung Antikörper (Abbildung 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hinweis: [O], [P] und [M] Unterabschnitte für anzugeben: OVs im Allgemeinen, (die meisten) Paramyxoviruses oder MV nur, beziehungsweise. [B] zeigt Abschnitte speziell für BTE transgene.

1 Klonen von transgenen Immunmodulator Codierung in Masern-Virus-Vektoren

  1. [O] Design einfügen Sequenz.
    1. [O] entscheiden Sie sich für ein Immunmodulator Interesse basierend auf Literaturrecherchen oder explorative Daten wie genetische Bildschirme41 und ableiten die relevanten cDNA-Sequenz aus entsprechenden Datenbanken wie GenBank, die europäischen Nukleotid-Archiv oder die internationalen Immungenetik-Informationssystem (IMGT).
    2. [O] zusätzliche Elemente hinzufügen der Transgen-Sequenz (Abbildung 3). Eine vorhergehende Kozak-Sequenz und artspezifische Codon Optimierung können Ausdruck verbessern. Signalsequenzen sind erforderlich für Sekretion. Enthalten Sie Sequenzen, die Codierung N - und/oder C-terminale Protein-Tags für Erkennung und Reinigung42. Gehören Sie Restriktionsschnittstellen zum Einfügen in den Vektor.
      Hinweis: [M] zusätzliche Transkriptionseinheiten (ATUs) beherbergen MV Polymerase gen beginnen und Signale sind für Transgene Ausdruck von rekombinanten MV Genome notwendig. Geeignete Anti-genomische DNA-Vektoren, CMV Promotoren und enthaltenden ATUs mit einzigartigen Restriktionsschnittstellen für die Einführung von positiven Sinne transgenen an definierten Positionen gesteuert haben bisher11entwickelt. [P] angemessene Positionierung des Transgens ist entscheidend, da es virale Replikation und Transgene Ausdruck durch den Ausdruck Verlauf typisch für Paramyxoviruses43betrifft. Einführung in ein ATU in der Nähe der 3'-Ende des Anti-Genoms (dh., in die Führungsposition oder flussabwärts des Gens P ) führt in der Regel hohe Transgene Ausdruck auf Kosten reduzierter Virusreplikation. Erhöhte Replikation und unteren Ebenen des Transgens Ausdrucks können erwartet werden, bei Verwendung der ATU stromabwärts des Gens H . Verpackung des Genoms von mehreren Paramyxoviruses, einschließlich der Masern-Virus, erfordert jede Nukleokapsid Protein44Bindung von sechs Nukleotide. Zum Einfügen von transgenen in solchen Viren sicherzustellen Sie, dass die Anzahl der Nukleotide des kompletten Genoms durch sechs teilbar sein wird. Dies wird auch als "Herrschaft der sechs"45,46bezeichnet. Gegebenenfalls enthalten Sie zusätzliche Nukleotide im Einsatz (der Kozak Sequenz vor- oder nachgelagerten Stop-Codons) ohne Rahmen Verschiebungen oder vorzeitige Stopp-Codon. [M] vermeiden Sie bestimmte Sequenzen in das Transgen, die sind ähnlich wie MV gen Start (AGGRNCMARGW) und stoppen (RTTAWANAAAA) Signale und RNA-Sequenzen (AAAAAGGG) bearbeiten. Solchen Konsensus-Sequenzen wurden veröffentlicht (siehe z. B. Parks Et Al.47).
    3. [O] kaufen Oligonukleotid der gewünschten Sequenz oder montieren von verfügbaren Sequenzen mit standard molekularen Klonen48.
      Hinweis: [O] für PCR-Amplifikation des Transgens entwerfen Sie eine forward Primer einschließlich der vorgelagerten Einschränkung-Website und den ersten 15-20 Nukleotiden des Einsatzes und eine rückwärts-Primer einschließlich des letztes 15-20 Nukleotiden des Einsatzes durch die nachgeschaltete Beschränkung gefolgt Website.
  2. [O] Klon einfügen in DNA Kodierung der viralen (Anti-) Genom.
    1. [O] Klonen des Einsatzes in DNA-Vektoren oder DNA Anti-Genome von RNA-Viren durch standard molekularen Klonen Techniken48 (d. h., enzymatischen Restriktion gefolgt von DNA-Ligatur).
      1. [O] zu verhindern, dass Re Unterbindung des Vektors mit nicht-kompatiblen Restriktionsschnittstellen oder durch de-Phosphorylierung vor der Ligatur.
      2. [O] die Ligatur Produkt durch Agarose-Gelelektrophorese und anschließende Gel Reinigung mit handelsüblichen Kits zu isolieren. Im Allgemeinen wird eine optimale Ligatur Effizienz bei einem 3:1 molare Verhältnis von einfügen, um Vektor-erreicht.
    2. [O] Transformation der Ligatur Produkt in zuständigen Bakterien für effiziente Rückgewinnung von großer Plasmide geeignet (d. h., durchführen Hitzeschock von E. Coli49) und identifizieren bakterieller Klone beherbergen die richtige DNA von Colony PCR50 .
    3. [O] Isolat verstärkt DNA aus einem einzigen bakterielle Klon mit im Handel erhältlichen DNA-Vorbereitung-Kits. Genomische Integrität von Kontrolle Digest mit geeigneten Restriktionsenzymen zu bestätigen (z.B., HindIII für MV Genome [M]). Richtig einsetzen und die Integrität des Transgens durch Sequenzierung zu bestätigen.
      Hinweis: [M] für transgene eingefügt in die MV- H- ATU, Sanger durchführen Sequenzierung mit die folgenden Primer: H-9018 [forward Primer, bindet an MV Genom Position 9018 in H open reading Frame (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (reverse Primer, bindet an MV Genom Position 9249 im ORF L ): 5' CAGATAGCGAGTCCATAACGG 3'.

(2) Rettung rekombinante Masern-Virus-Partikel, die Codierung Immunmodulatoren

  1. [O] generieren Sie rekombinanten Virus-Partikel aus (Anti-) genomische DNA über Transfektion von Virus Produzent Zellen nach dem Standardprotokoll für die jeweiligen Virus. Richtlinien Sie für das Arbeiten unter sterilen Bedingungen. Führen Sie Zellkultur unter Hauben, insbesondere alle Schritte mit Virus in biologische Sicherheitswerkbänke der Klasse II.
    1. [M] für die Rettung von Masern-Viren aus cDNA23,24, Platte MV Produzent (African Green Monkey Niere stammenden Vero) Zellen gleichmäßig auf eine 6-Well-Platte 24 h vor Transfektion. Samen 2 x 105 Zellen in 2 mL Dulbeccos geändert Eagle Medium (DMEM) mit 10 % fetalen bovine Serum (FBS) pro Bohrloch 65 – 75 % Konfluenz zum Zeitpunkt der Transfektion zu erreichen.
      Hinweis: [P] reduzieren Sie Zellzahlen, wenn die Zellen vor virusbedingte Syncytia Bildung überwuchern.
    2. [P] Transfect Zellen mit DNA Kodierung Plasmide virale Anti-Genom, erforderliche Helfer und, falls gewünscht, ein Plasmid Codierung einen fluoreszierenden Reporter Transfektion Effizienz bewerten.
      1. [M] Mix 5 µg der rekombinanten DNA Kodierung das Masern-Virus Anti-Genom, 500 ng von Säugetieren Ausdruck Plasmide Codierung Masernvirus N und L Proteine und 100 ng der Plasmide P Protein und einem fluoreszierenden Reporter in einem Gesamtvolumen von 200 µL DMEM-Codierung.
      2. 18.6 µL liposomalen Transfection Reagens hinzufügen, sofort durch Streichen der Röhre mischen und 25 min bei Raumtemperatur (RT) inkubieren.
      3. [P] ersetzen Sie das Medium mit 1,8 mL DMEM, 2 % FBS, 50 µg/mL Kanamycin (oder andere Antibiotika um Kontaminationen zu vermeiden) pro Well, dann geben Sie die Transfektion Mischung tropfenweise in die und schwenken Sie vorsichtig. Inkubieren Sie Zellen über Nacht bei 37 ° C, 5 % CO2. Ersetzen Sie Medium mit 2 mL frische DMEM, 2 % FBS und 50 µg/mL Kanamycin am nächsten Tag; Wiederholen Sie diesen Vorgang, wenn Medium sauer wird.
        Vorsicht: [O] wie Virus aus Transfektion durch die folgenden Schritte möglicherweise behandeln Sie Zellen und Materialien vorschriftsmäßig Biosafety. (Potentiell) infektiöser Abfälle ordnungsgemäß entsorgen.
  2. [P] sammeln und Viruspartikel zu propagieren.
    1. [P] beobachten Sie Zellen täglich durch Mikroskopie für Reporter-gen Ausdruck und Syncytia Bildung (Abbildung 4). Virus zu ernten, wenn große Syncytia, bestehend aus 20 oder mehr Zellen sichtbar sind, oder wenn Zellen zu dicht werden (dh., wenn sie anfangen zu wachsen in mehreren Schichten, in der Regel nach 7 – 9 Tagen).
      Hinweis: [P] Wenn keine Syncytia für einen gegebenen Vektor-Konstrukt beobachtet werden, bedeutet dies nicht notwendigerweise, dass die Rettung gescheitert ist. Überweisen Sie ansteckende Virus möglicherweise trotzdem in der Probe vorhanden, frische Produzent Zellen zur Passagierung.
    2. [P] Samen ca. 1,5 x 106 Produzent Zellen in 12 mL DMEM mit 10 % FBS, auf 10 cm 24 Stunden vor der erwarteten Ernte oder 2,5 x 106 Zellen pro Gerichte Platte 4 – 6 h vor Passagierung Virus, 65-75 % Konfluenz zum Zeitpunkt der Virus Inoculat zu erreichen Ion.
    3. [P] um Virus nachkommen zu sammeln, sorgfältig kratzen Sie anhaftende Produzent Zellen von der Platte mit einem Schaber Zelle und übertragen Sie den Überstand mit Zellen in einem Zentrifugenröhrchen zu. Entfernen Sie die Zelle Ablagerungen durch Zentrifugation für 5 min bei 2.500 X g und 4 ° C.
      Hinweis: Geschabte Zellen können direkt ohne Zentrifugation Virus Übertrag auf Kosten der suboptimale Kulturbedingungen und potenzielle Mikroskopie Artefakte zu maximieren übertragen werden.
      Vorsicht: [O] vermeiden Sie Medien zu verschütten, wenn Zellen zu kratzen. Minimieren Sie Aerosolbildung.
    4. [P] bereiten Sie Inokulum durch Mischen des zellfreie Überstands aus Schritt 2.2.3 mit serumfreien Medium zu einem Endvolumen von 4 mL. Ersetzen Sie das Medium auf Produzent Zellen durch das Inokulum und inkubieren Sie Zellen für mindestens 2 h bei 37 ° C und 5 % CO2. Fügen Sie 6 mL DMEM mit 10 % FBS und inkubieren Sie Zellen über Nacht vor dem Wechsel des Mediums zu 12 mL frische DMEM mit 10 % FBS.
    5. [P] zu beobachten, die Zellen mindestens zweimal täglich und Ernte-Virus vor Syncytia platzen (d. h., als Membran Störung sichtbar wird). Um den ersten Durchgang des Virus zu ernten, Überstand von der Platte zu entfernen, fügen Sie 600 µL serumfreien Medium kratzen Zellen mit einer Zelle Lifter und übertragen auf ein sauberes Röhrchen.
      Hinweis: [M] je nach Virus-Stamm51,52 und das Fortschreiten der Infektion übertragen Sie Platten mit infizierten Zellen auf 32 ° C, virale Replikation und Verbreitung zu erleichtern. In der Regel propagieren MV Schwarz Stämme gut bei 37 ° C, während der Übertragung von Zellen mit Edmonston B Belastung Viren auf 32 ° C führt zu langsameren Syncytia Bildung aber höhere Titer infiziert.
      Hinweis: [P] lassen Sie Zellschicht während der Ernte, trocknen nicht, da dies zu geringeren Infektiosität der Viruspartikel führt. Obwohl einige Virus verloren geht, wenn den Überstand der infizierten Zellen zu verwerfen, können höhere Titer der Zellschicht entnommen werden.
    6. [P] sofort frieren Sie die Virus-Aussetzung in flüssigem Stickstoff ein. Shop bei-80 ° C für mindestens 24 h darauf gründlich einfrieren. Erstrecken Sie sich auf mehrere Tage, um die Prozedur zu unterbrechen Wenn nötig.
    7. Lösen Sie Viruspartikel durch Auftauen bei 37 ° C. Homogenisieren von aufschütteln und Zentrifuge für 5 min bei 2.500 X g und 4 ° C. Übertragen Sie die Überstände beschrifteten Cryoröhrchen und Store bei-80 ° C.
      Hinweis: [O] bewahren Sie Viren in aliquoten Größen ausreichend für spätere Experimente, auf, da sie bevorzugt nur einmal aufgetaut und sofort verwendet werden. [P] Frost-Tau-Zyklen oder Lagerung bei 4 ° C über mehrere Tage führen deutliche Reduzierung der viralen Titer.
    8. [P] einen Tag vor der weiter zur Erreichung erforderlichen Menge und Titer, Passagierung Samen 4 x 106 Produzent Zellen in 12 mL DMEM mit 10 % FBS 15 cm Gerichte. Mit einer Vielzahl von Infektionen (MOI) von 0,03-Virus immun. In 8 mL serumfreien Medium pro Platte zu infizieren und ändern Sie Medium in DMEM mit 10 % FBS nach Inkubation Zellen für mindestens 2 h Skala mit mehreren Platten.
    9. Ernte wie unter Schritt 2.2.5, wenn Syncytia über die ganze Zelle Schicht ausgebreitet haben. Bündeln Sie die erhaltenen Suspensionen in 50 mL-Tuben und Prozess beschriebenen Schritte 2.2.6–2.2.7.
      Hinweis: [O] Es ist wichtig, alle Platten optisch auf bakterielle und Pilzinfektionen Kontamination vor der Ernte zu überprüfen. Überprüfen Sie in der Regel alle Zelllinien regelmäßig auf Kontaminationen mit Mykoplasmen oder zufällige Viren mittels Multiplex-PCR.
  3. [P] Evaluate virale Titer. Titer von Virus-Bestände in Octuplicates pro aliquoten mit 96-Well Platten zu bestimmen. Durchführen Sie Titration von drei einzelnen Aliquote pro Virus Rettung und verwenden Sie den Durchschnittswert, um die Berechnung des Virus Aussetzung in Experimenten verwendet werden.
    1. [P] Pool Hersteller Zellen, Graf, und passen Sie auf 1,5 x 105 Zellen pro mL in DMEM mit 10 % FBS.
    2. [P] Pipettieren 90 µL DMEM mit 10 % FBS in jede Vertiefung einer 96-Well-Platte.
    3. [P] 10 µL aus ein Aliquot der Virus bestand in allen 8 Vertiefungen in der ersten Spalte der Platte und gründlich mischen durch Pipettieren mindestens 10 Mal rauf und runter.
    4. [P] führen Sie 10-divisibel Verdünnungsreihen des Virus. Übertragen von 10 µL jedes gut aus der ersten in die zweite Spalte mit einem Mehrkanal-pipettieren. Von oben und unten Pipettieren mischen Sie gründlich und verwenden Sie frische Pipettieren Tipps für jedem Verdünnungsschritt. 10 µL aus jedem Brunnen der letzten Spalte zu verwerfen.
      Hinweis: Jede 96-Well-Platte ermöglicht 12 serielle Verdünnung Schritte. [M] für MV-Vektoren 8 Stufen des 10-divisibel Verdünnungen sind in der Regel ausreichend, als Titer über 1 x 109 Zelle infektiöse Einheiten (Ciu) /mL selten erhält man, indem die Methode der Fortpflanzung im Schritt 2.2 beschrieben. [P] Kontroll-Vertiefungen ohne Virus können zum Vergleich und zur Überwachung von Kontamination verwendet werden.
    5. [P] fügen Sie 100 µL Zellsuspension in jede Vertiefung und Inkubation bei 37 ° C, 5 % CO2 für 48 h stellen Sie sicher das Fehlen der Zelle Klumpen in der Suspension, homogene Verteilung der Zellen zu erreichen.
    6. [P] Check für Syncytia mit einem Lichtmikroskop. Zählen Sie Syncytia in jede Vertiefung der Spalte mit der höchsten Verdünnungsfaktor mit sichtbaren Syncytia.
    7. [P] berechnen Sie die durchschnittliche Anzahl der Syncytia pro Bohrloch in dieser Spalte durch die Gesamtzahl der Syncytia durch acht geteilt. Multiplizieren Sie diesen Durchschnitt mit der Verdünnungsfaktor der jeweiligen Spalte, beginnend bei 102 Ciu pro mL für die erste Spalte53 (siehe Abbildung 5 als Beispiel).

3. Bestimmung der replikative und zytotoxische Kapazitäten von viralen Vektoren Codierung Immunmodulatoren

  1. [O] vergleichen Sie Replikation Kinetik des generierten rekombinanten Virus und die unveränderte Vektor mit einstufigen oder mehrstufigen Wachstumskurven (GCs). Für einstufige GCs sind virale Nachkommen beurteilt nach gleichzeitiger Infektion aller Zellen (theoretisch 100 % Infektion). Mehrstufige GCs beginnen bei einem geringen Prozentsatz der infizierten Zellen mehrere Folgen Runden der Virusreplikation.
    1. [M] für die Analyse der Masern-Virus-Replikation-Kinetik, seed 1 x 105 Vero-Zellen in 1 mL DMEM mit 10 % FBS pro Bohrloch auf 12-Well-Platten einen Tag vor der Infektion. Platte mit mindestens zwei Brunnen für jeden Timepoint von Interesse als technische repliziert.
    2. [O] infizieren die Zellen mit dem Virus bei niedrigen MOI für mehrstufige oder bei hohen MOI für einstufige GCs [M] (0,03 und 3 für die MV-Replikation auf Vero Zellen). Ersetzen Sie Medium mit 300 µL serumfreien Medium mit der entsprechenden Menge des Virus und Inkubation bei 37 ° C und 5 % CO2 für mindestens 2 h entfernen Inokulum, fügen Sie 1 mL DMEM mit 10 % FBS, und weiter Inkubation.
    3. [P] an relevanten Zeitpunkten wie 12, 24, 36, 48, 72 und 96 h nach Infektion ernten Sie virale Nachkommen durch Schaben direkt Zellen in das Medium. Inhalt von jedem Bohrloch auf eine einzelne Röhre übertragen, Snap-Einfrieren in flüssigem Stickstoff und Lagerung bei-80 ° C bis Titration.
      Hinweis: [P] replicate Proben können bei diesem Schritt zur Analyse der durchschnittlichen Titer gebündelt werden.
    4. [P] Sammle Proben von allen Zeitpunkten. Tauen Sie gleichzeitig bei 37 ° C zur Beurteilung der viralen nachkommen. Wirbel und Pellet Zellenrückstand durch Zentrifugation für 5 min bei 2.500 x g und 4 ° C.
    5. [P] berechnen Sie durchschnittliche Titer jedes Konstrukt und Timepoint wie oben beschrieben. Plot-Titer im Laufe der Zeit. Vergleichen Sie Wachstumskurven von Vektoren mit und ohne eingefügte transgene, mit verschiedenen transgene oder transgene an verschiedenen Positionen eingefügt (siehe Abbildung 6).
  2. [O] vergleichen Sie lytische Aktivitäten der Immunmodulator Codierung und unveränderten Viren.
    1. [O] wählen Sie von möglichen Methoden einschließlich Impedanz Messungen, Laktat-Dehydrogenase (LDH) release Assay oder Stoffwechsel-basierte farbmetrischen Zellviabilität assays [z. B., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) und 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assays].
      1. [M] zu analysieren, Zytotoxizität von Masern assay Virus Vektoren mit XTT, Saatgut-Vero-Zellen wie unter Punkt 3.1.1 beschrieben. Gehören Sie Wiederholungen eines nicht infizierten Steuerelements für jedes Timepoint.
        Hinweis: [O] XTT Assay an verschiedenen Zeitpunkten an derselben Probe durchführen kann technische Fehler beschränken, sondern mehrmaliges Waschen und Exposition gegenüber XTT Reagenz Anzahl der lebensfähigen Zellen beeinflusst. Impedanz bietet eine alternative Anzeige für Dauermessungen.
    2. [M] infizieren Sie Vero-Zellen bei einer MOI von 1 wie in Schritt 3.1.2 beschrieben.
      Hinweis: [M] für Infektion der weniger freizügig Zielzellen wie einige murinen Tumor-Zell-Linien kann ein höheres MOI von 3 oder 5 notwendig sein.
    3. [O] an Zeitpunkten von Interesse (z. B.., 12, 24, 36, 48, 72 und 96 h nach der Infektion) bereiten Sie die erforderliche Menge an XTT Reagenz (dh., 300 µL pro gut plus 10 % Überschuss). Vermeiden Sie Belichtung.
    4. [M] bei jedem Timepoint entfernen Sie Mittel aus den jeweiligen Brunnen. Ersetzen von 300 µL XTT Reagenz und Inkubation bei 37 ° C im Dunkeln. Überstände zu sammeln, wenn das Reagenz in der Kontroll-Vertiefungen tiefrot,, die in der Regel zwischen 15 Minuten und 2 Stunden dauert gedreht hat, und frieren bei-20 ° C.
      Hinweis: [O] Inkubationszeiten hängen Virus Konstrukt, Zelltyp, Dichte und zytopathischen Effekt.
    5. [O] nach sammeln Auftauen aller Proben gleichzeitig. 100 µL jeder Probe auf einer 96-Well-Platte übertragen und Messen optische Extinktion bei 450 nm, mit 630 nm als eine Referenzwellenlänge.
    6. [O] Grundstück Zeitpunkte (x-Achse) Vs. optische Absorption von Proben im Vergleich zu Kontrollen, metabolische Aktivität als Surrogat für die Zellviabilität (y-Achse) angibt. Virale Zytotoxizität bedeutet relative Absorption im Laufe der Zeit abnimmt (siehe Abbildung 6B).

4. Analyse der Aktivität des Virus-codierte Immunmodulatoren abgesondert von infizierten Zellen

  1. [O] isolieren sekretierten Transgen Produkte durch Virus-infizierten Zielzellen ausgedrückt.
    1. [P] lassen Sie Virus-Hersteller wachsen Zellen zu 70 % Konfluenz in T175 Fläschchen.
    2. [P] entfernen Sie Medium aus Zellen und waschen Sie zweimal mit 12 mL PBS, Serum zu entfernen. Zellen mit Virus bei einer MOI von 0,03 in 12 mL serumfreien Medium zu impfen und Inkubation über Nacht bei 37 ° C und 5 % CO2 . Medium mit 12 mL frisches serumfreien Medium zu ersetzen.
      1. [M] für Edmonston B Viren übertragen Sie Zellen von 37 auf 32 ° C nach 40 h für ein weiteres 24 h Inkubation Infektion erleichtern und verhindern vorzeitige Platzen der Syncytia. Je nach Virusstamm können für eine optimale Proteinausbeute und Reinheit51,52 und Syncytia fortschreiten, Inkubation Temperaturen und Zeiten angepasst werden.
    3. [P] sammeln Sie sorgfältig Überstände ohne trennen Zellen vor Syncytia platzen. Optimal, haben Syncytia über die gesamte Zelle Schicht verteilt. Pool-Überstände in 50 mL-Tuben.
      Hinweis: [P] für effiziente Reinigung des Transgens Produkts vermeiden Sie platzen der Syncytia und minimieren Sie Zellenrückstand zu, wenn die Überstände der infizierten Zellen zu ernten.
    4. [P] entfernen Sie Zelle Verschmutzungen aus der Überstand durch Zentrifugation für 5 min bei 2.500 x g und 4 ° C und Weitergabe durch 0,22 µm-Filter. Je nach das Gesamtvolumen des Filtrats kann dies mit einer Spritze oder einer Vakuumpumpe durchgeführt werden.
    5. [O] Transgene Produkt mit einer geeigneten Reinigungsverfahren zu isolieren. Proteine mit einem Hexa-Histidin (His) durch den Austausch Affinitätschromatographie mit Ni-NTA Mini Spin Spalten38 , wie hier in Kürze beschrieben (Schritte 4.1.5.1–4.1.5.4) zu reinigen.
      Hinweis: [O] führen Sie alle Schritte, schnell und auf Eis. Pre-chill-Puffer und Pre-kühl Zentrifuge bis 4 ° C.
      1. [O] bereiten Sie 100 mL des Puffers mit PBS, 200 mM Natriumchlorid und Imidazol bei Endkonzentrationen von 10 mM (Waschen Puffer 1, WB1) vor, 20 mM (Waschpuffer 2, WB2) und 500 mM (Elution Buffer, EB). Stellen Sie pH WB1 und WB2 bis 8,0 und EB bis 7.0. Je nach dem Protein gereinigt werden müssen Imidazol-Konzentrationen angepasst werden.
      2. [O] equilibrate Spalten mit 600 µL WB1 und Zentrifuge bei 800 X g für 2 min mit einem geöffnetem Deckel.
      3. [O] Last 600 µL des gefilterten Überstände auf Spalten. Ermöglichen Sie Bindung des His-Tags Proteine in der Spalte Matrix durch Zentrifugation bei 200 X g 5 min mit geschlossenem Deckel. Be- und Bindung können bis zu einer Gesamtkapazität von 300 µg sein-tagged Protein pro Spalte wiederholt werden.
      4. [O] waschen Sie dreimal mit WB1 und einmal mit WB2, oder bis der durchströmten farblos ist. Fügen Sie 600 µL Puffer und Spin 800 X g für 2 min mit geöffnetem Deckel.
      5. [O] eluieren Sie Protein in ein frisches Gefäß von Schritten zwei Elution mit 300 µL EB und Zentrifugation für 2 min bei 800 X g.
      6. [O] entsalzen und Produkt mit zentrifugalen Filtern nach Produktgröße zu konzentrieren. Ein Volumen von 15 mL und Filter durch Zentrifugation für 10 min bei 4.000 X gPBS hinzufügen. Wiederholen Sie, bis die gewünschte Reinheit und Konzentration erreicht wird. Um die Proteinkonzentration erhöhen, reduzieren Sie das Endvolumen auf etwa 200 µL durch Zentrifugation für 40 min bei 4.000 X g.
  2. [O] bestätigen Sie Reinheit und Identität des Produkts.
    1. [O] die Höhe der Gesamt-Protein in die Isolate mit standard farbmetrischen Assays wie Bicinchoninic Säure (BCA) oder Bradford-Test54,55zu quantifizieren. [M] typische Werte reichen von 1 – 3 µg Transgen Produkt pro mL Überstand der infizierten Zellen.
    2. [O] für relative Quantifizierung von Protein Isolate über Sodium Dodecyl Sulfat Polyacrylamid Gelelektrophorese (SDS-PAGE) zu trennen und Coomassie-Färbung56durchführen.
    3. [O] bestätigen Sie Identität der gereinigten Produkte durch Immunoblotting mit spezifischen Antikörpern, die Ausrichtung auf das Protein oder einer damit verbundenen Peptid Tag57.
    4. [O] Protein Bindung Besonderheit mit entsprechenden Techniken, die eventuell umfassen Enzym-linked Immunosorbentprobe Assay (ELISA), flow Cytometry analysieren (siehe Abbildung 7). Zelle Bindung kann mit einer kürzlich beschriebenen magnetischen Pulldown-Assay38bestätigt werden.
      Hinweis: [O] verwenden Sie entsprechende Steuerelemente. In Zelle verbindliche Tests sind Negativkontrollen mit Zellen, die nicht mit dem Ausdruck des gezielte Moleküls (wie in Abbildung 9) und nicht-targeting Protein Surrogate (Abbildung 8). Im Flow Cytometry Experimente sind positiv, negativ und Isotype Steuerelemente (Abbildung 7).
      1. [O] Co inkubieren das Ziel Zellen und Protein zu isolieren, um Bindung zu ermöglichen. [B] für die Analyse der BTEs an peripherem Blut binden inkubieren Mononukleäre Zellen (PBMCs) isoliert von Menschenblut58, 2,5 x 106 Zellen mit 200 ng BTE in 100 µL PBS mit 1 % FBS (Bindung Puffer, BB) für 1 h auf dem Eis.
      2. [B] waschen Zellen mit 1 mL BB, ungebundenen Protein zu entfernen. 300 X g für 5 min Zentrifugieren, überstand verwerfen und Pellet in 100 µL der BB aufzuwirbeln. Fügen Sie Biotinylierte Antikörper gezielt das Protein des Interesses oder einem damit verbundenen Peptid-Tag hinzu und inkubieren Sie für 30 min auf Eis. Für BTEs mit Grippe Hämagglutinin (HA) Tag, Einsatz 100 ng von Anti-HA-Biotin (Klon-3F10).
      3. [B] waschen Sie Zellen zweimal mit 1 mL BB und in 80 µL BB aufzuwirbeln. Fügen Sie 20 µL Streptavidin-gekoppelte magnetische Microbeads und 15 min bei 4 ° c inkubieren
      4. [B] einmal waschen, um entfernen überschüssige Perlen und Aufschwemmen Pellet in 500 µL BB mit 2 mM EDTA (Spalte Puffer, CB) ergänzt.
      5. [B] Zellen mit Säulen und ein Magnetstativ gemäß des Anbieters Handbuch zu isolieren.
        1. [B] equilibrate dadurch, dass 500 µL CB übergeben durch die Säule durch Schwerkraft.
          Hinweis: [B] die Spalte darf nie trocken laufen. Pipettieren sorgfältig und Entgasen der Puffer, um Luftblasen zu vermeiden.
        2. [B] legen Sie ein sauberes Röhrchen unter der Spalte und der Spalte zuweisen Sie die Zelle/Wulst-Suspension. Waschen Sie die Spalte dreimal mit 500 µL CB pro Waschgang. Durchströmten Proben der Suspension und zumindest die ersten Waschschritt im Rohr, dann speichern auf Eis.
        3. [B] eluieren Sie Wulst-gebundenen Zellen erhalten durch das magnetische Feld. Entfernen Sie zu diesem Zweck die Spalte aus der Magnetstativ, legen Sie es über ein sauberes Röhrchen, fügen Sie 1 mL CB und schieben Sie schnell den Puffer durch die Säule das Rohr mit einem Kolben. Halten Sie das Rohr auf dem Eis.
      6. [B] Zentrifuge Röhren mit Durchfluss und Elution Proben für 20 min bei 16.000 x g und 4 ° C, pellet-Zellen. Überstände zu verwerfen und lösen Sie Zellen in einem Tests Testpuffer (RIPA) (empfohlene: 75 µL). Durchführen Sie SDS-PAGE56.
      7. [B] durchführen Sie Immunoblotting mit einem geeigneten Primärantikörper. Antikörper können gezielt das Transgen-Produkt oder eine zelluläre Proteine (z.B.., β-Aktin, Abbildung 8) BTE-Zelle Bindung zu beurteilen.
  3. [O] immunologische Funktion von isolierten Immunmodulatoren zu beurteilen.
    1. [O] relevanten Tests nach den Merkmalen der codierten Immunmodulator zu identifizieren. Bezüglich der erwarteten immunmodulatorische Aktivität kann Methoden der Beurteilung Zellproliferation, Migration, Reifung, Aktivierung oder Zytotoxizität angewendet werden.
      Hinweis: [O] Zellproliferation kann durch CFSE-59 Kennzeichnung oder Ki67 Färbung60analysiert werden. Transwell oder Kratzer Experimente stehen Zelle Migration61zu analysieren. Reifung und Aktivierung von Zellen können mit geeigneten Färbung Protokolle für jeweiligen Marker bewertet werden. [B] verfügbare Techniken zu beurteilen, BTE-vermittelte zelluläre Zytotoxizität gehören Impedanz Messungen und Chrom-release-Assay. Wenn die Entscheidung für Chrom-Release-Assay, beobachten Sie angemessene Sicherheitsmaßnahmen beim Umgang mit radioaktiven Materials.
    2. [B] als Alternative nicht radioaktiv beschreibt im folgenden im Detail BTE-induzierte, zellvermittelte Zytotoxizität von LDH Release Assay (beschrieben in kurzen38) zu bewerten.
      1. [B] entscheiden über Bedingungen während des Experiments getestet werden (siehe Abbildung 9 als Beispiel). Zeitpunkte (Stunden bis Tage), Konzentrationen von Immunmodulator (Pg/mL bis µg/mL) und Effektor Ziel-Zelle (E:T)-Verhältnisse (zwischen 01:50 und 50: 1, zum Beispiel) variiert werden. Bereiten Sie immer Proben in Triplicates.
      2. [B] Proben ohne Eiweiß enthalten und ohne Effektorzellen, Steuerelemente für spontane LDH-release von der einzelnen Zelltypen (Tsp und Esp), eine Zelle maximale Lyse Zielsteuerelement (Tmax) mit Reinigungsmittel vor dem Auslesen, ein Medium hinzugefügt nur eine Kontrolle und einen Lautstärkeregler für Tmax.
        Hinweis: [B] erforderliche Anzahl von Zielzellen und Inkubationszeiten kann variieren. Führen Sie erste Testläufe ohne Effektorzellen und Immunmodulatoren, optimale Parameter zu identifizieren. Enthalten Sie Tsp und Tmax Muster und entsprechenden Kontrollen, verschiedene Zellzahlen und Zeitpunkte zu beurteilen.
      3. [B] immun Effektorzellen z. B. durch (Dichte Gradienten Zentrifugation von menschlichem Blut PBMCs58 zu erhalten) oder negative Auslese der murinen T-Zellen aus Maus Splenocyten62zu isolieren.
      4. [B] Samen gezielt Zellen gemäß Schritt 4.3.2 (z. B., 5 x 10³ pro Well) in ein U-Boden-96-Well-Platte.
      5. [B] die isolierte Protein am gewünschten Konzentrationen zu den jeweiligen Beispielen hinzufügen. Immun Effektorzellen im gewünschten Verhältnis hinzufügen. Einem Gesamtvolumen von 100 µL pro Bohrloch Medium hinzufügen.
      6. [B] Incubate für den Zeitrahmen bestimmt steigen 4.3.2, in der Regel zwischen 4 und 48 Stunden (24 h für unstimulierte PBMCs und 48 h für frisch isolierte murinen T-Zellen; prestimulated Immunzellen kürzere Inkubationszeiten beantragen können), bei 37 ° C und 5 % CO2.
      7. [B] 45 Minuten vor dem Sammeln der Proben hinzufügen 10 µL 10 X Lyse Lösung Brunnen, Tmax Muster und die entsprechenden mittleren Steuerelemente enthält. Weiter Inkubation.
      8. [B] spin-down Zellen bei 250 X g für 4 min. Transfer 50 µL jeder überstand zu einem flach-Boden-96-Well-Platte. Übertragen Sie Zellen, um Zelle gebundenes LDH zu vermeiden nicht.
      9. [B] Prepare Substratlösung nach Angaben des Herstellers. Jede Vertiefung 50 µL hinzu und im Dunkeln für 30 Minuten oder bis Tmax Muster tiefrot färben bei RT inkubieren.
      10. [B] jede Vertiefung 50 µL Stopplösung hinzufügen. Entfernen Sie Luftblasen durch Zentrifugation für 1 min bei 4.000 X g, und manuell mit einer hohlen Nadel. Messen optische Extinktion bei 490 nm.
      11. [B] berechnen Sie % spezifische Lyse Werte für jede Probe.
        1. [B] berechnen Sie Durchschnitte für Wiederholungen der mittlere Regler mit und ohne Lyse-Lösung. Subtrahieren Sie erhaltenen Werte von experimentellen Proben, Tmax und spontane Freisetzung Kontrollen bzw.. Verwenden Sie diese Hintergrund-korrigierte Werte für weitere Berechnungen.
        2. [B] berechnen Sie Durchschnitte für Hintergrund-korrigierte Tmax, Tspund E-sp -Steuerelemente. Mithilfe dieser durchschnittliche Werte ergibt die folgende Gleichung den Prozentsatz von bestimmten Lyse für jede Probe:

          Equation 1
        3. [B] des Grundstückes % spezifische Lyse Werte vs. Proteinkonzentration oder E:T Verhältnis und im Vergleich zu nicht-targeting Kontrollproben.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Abbildung 1 zeigt den Wirkmechanismus von onkolytische Masern-Viren Codierung bispezifische T Zelle Engagers. Ein Flussdiagramm Darstellung des Workflows dieses Protokolls wird in Abbildung 2dargestellt. Abbildung 3 zeigt ein Beispiel eines modifizierten onkolytische Masern-Virus Genoms. Dies bietet eine visuelle Darstellung der spezifischen Änderungen auf die Masern Virus Anti-Genom und besondere Merkmale der eingefügten transgene angewendet. Typischen Masern-Virus-induzierte Syncytia sind in Abbildung 4dargestellt. Beachten Sie die hohe Zelldichte bei Timepoint des Erntens der Rettungs (A, B), darauf hinweist, dass die Anzahl von Zellen reduziert werden kann, wenn Sie das Experiment zu wiederholen. Inkubation-Temperaturen und -Zeiten möglicherweise optimiert für Passagierung auf Vero-Zellen (C, D), verbesserte Verbreitung von Syncytia über die Platte zu erreichen. Abbildung 5 stellt das Ergebnis eines typischen Titration Assays. In Abbildung 6, einstufige Wachstumskurven (A) und relative Zellviabilität (B) nach der Inokulation mit unveränderten (MV) und HdO-Codierung werden onkolytische Masern-Viren (MV-H-mCD3xhCD20) angezeigt. Während Wachstumskurven der verglichenen Vektoren auf Vero-Zellen ähneln, hinkt lytische Aktivität des Transgens Codierung Virus in der murinen Tumor-Zell-Linie. Flow Cytometry Daten des Ziel-Antigen exprimierenden Zellen inkubiert mit BTEs bei fünf verschiedenen Verdünnungen ist in Abbildung 7, zur Verfügung gestellt unter Angabe BTE Bindung von Zellen in gewissem Sinne Konzentration abhängig. Abbildung 8 stellt eine beispielhafte Immunoblot nach magnetischen Pulldown BTE verbundenen Zellen. Pulldown mit nicht-targeting BTEs (n1, n2) Ausbeute nicht nachweisbare Mengen von Zellen, während Bands in der Elution Bruchteil, bezeichnend für gebundene Zellen für die Zielgruppenadressierung BTE Proben (t1, t2) beobachtet wurden. HdO-vermittelten, Ziel Antigen-spezifische und Konzentration-abhängige Zytotoxizität von murinen T-Zellen wird durch eine repräsentative LDH Release Assay in Abbildung 9angezeigt.

Figure 1
Abbildung 1 : Wirkmechanismus von onkolytische Masern-Viren Codierung ein bispezifische T-Zell-Veranstalter (MV-HdO). Infektion von einer Tumorzelle (infiziert: grau, nicht infizierten: hellblau) mit MV-BTE folgt die Virusreplikation und Ausbreitung in den Tumor, wodurch Tumor Zellstimulation lyse und das Immunsystem. Gleichzeitig sind BTEs [bestehend aus zwei einzelnen Ketten von Antikörpern CD3 auf T-Zellen (gelb) und ein Tumor Oberflächenantigen (blau) gezielt abgeleitet] produziert und vor Ort durch Virus-infizierten Zellen abgesondert. HdO-vermittelten Vernetzung mit Tumorzellen induziert Aktivierung ruhender, polyklonale T-Zellen, was zu weiteren Tumor Zelle töten. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : Flussdiagramm beschreiben den Workflow entwerfen, Erzeugung und Auswertung von Roman Virenvektoren Codierung immunmodulatorische transgene. Schritte 1 bis 4 entsprechen die jeweiligen Abschnitten des Protokolls. Aufzählungspunkte zeigen entsprechende Überlegungen und Teilschritte. Aufgrund der empirischen Natur des Verfahrens können Anpassungen oder Verbesserungen notwendig, bei jedem Schritt des Workflows geworden. Darüber hinaus können experimentelle Befunde führen zu neuen Hypothesen und Entwicklung von zusätzlichen Vektoren oder Kombinationsbehandlungen zu begeistern. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : Schematische Darstellung eines Masern-Virus-Genoms. Verbesserte grünes fluoreszierendes Protein (eGFP) wird in einer zusätzlichen Transkription Unit flussabwärts der Leader (ld)-Sequenz kodiert. N, P, M, F, H und L bezeichnen Gene kodieren die Masern-Virus Strukturproteinen Nucleoprotein, P Protein Matrix Protein, Fusionsprotein, Hämagglutinin-Protein und großen Protein (Polymerase), bzw. die differenziell ausgedrückt werden, wie visualisiert oben. Ein bispezifische T Zelle verlorengegangene (BTE) Transgen ist in eine zusätzliche Transkription Einheit (ATU) stromabwärts von der offenen Leserahmen H eingefügt. Das Transgen kodiert ein Igκ Führer Peptid für effiziente Sekretion sowie Grippe Hämagglutinin (HA) und Hexa-Histidin (His) Protein-Tags für die Erkennung und Reinigung. Gene codieren für Variable Heavy (VH) und leichte Kette (VL) Domains von Antikörpern auf CD3 und CD20, bzw. sind verbunden über Peptid Linker Sequenzen, Glycin (G) und Serin (S) Rückstände enthält. Die Transgen-Sequenz ist eine Sequenz von Kozak vorangestellt. Stromabwärts der kodierenden Region, zusätzliche Nukleotide aufgenommen wurden exemplarisch zur Einhaltung der Regel von sechs. Die Insert-Kassette ist flankiert von zwei Restriktionsschnittstellen Einfügung in die jeweiligen ATU ermöglicht. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4 : Masern-Virus-induzierte Syncytia. (A, B) Vero-Zellen wurden mit cDNA für die Rettung von rekombinanten Masern-Viren Codierung verbesserte grün fluoreszierendes Protein (eGFP) und ein bispezifische T Zelle verlorengegangene (BTE) targeting murinen CD3 und menschlichen CD20 transfiziert. Vorhandensein einer fluoreszierenden Synzytien (weisse Pfeile) bedeutet erfolgreiche Rettung des ansteckenden Virus. (C, D) Masern-Viren waren nach Rettung geerntet und auf Vero-Zellen (Abschnitt 1) propagiert. Großen Syncytia gebildet haben und sind schon an zu platzen (gelbe Pfeile). Bilder von Phasenkontrast (B, D) und Fluoreszenz-Mikroskopie nach Anregung für 80 ms (A) und 100 ms (C) erworben. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5 : Repräsentatives Ergebnis eines Titration Assays. Titration einer dritten Durchgang Charge von MV-H-mCD3xhCD20, ein HdO-Codierung onkolytische Masern-Virus, auf Vero-Zellen. Eine 10-divisibel serielle Verdünnung erfolgte auf einer 96-Well-Platte, beginnend mit 10 µL des Virus Aussetzung in jede Vertiefung der Spalte 1. keine Syncytia waren in Spalte 7, sichtbar, wie durch Nullen angezeigt. Für die nächste niedrigsten Verdünnung des Virus Aussetzung in Spalte 6 wurde durchschnittlich sechs Syncytia pro Bohrloch beobachtet, was zu einer endgültigen Titer von ca. 6 x 107 Zelle infektiöse Einheiten (Ciu) pro mL Virus Aussetzung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6 : Replikation Kinetik und lytische Aktivität von rekombinanten Masern-Viren. (A) einstufige Wachstumskurven nach Infektion von Vero-Zellen mit unveränderten onkolytische Masern-Virus (MV) oder Masern-Virus bispezifische T Zelle verlorengegangene (MV-H-mCD3xhCD20) bei einer MOI von 1 Codierung generiert wurden. Titer von viralen Nachkommen wurden nach der Infektion, zeigt ähnliche Virus-Replikation-Kinetik an bestimmten Zeitpunkten ausgewertet. Mittel und Standardabweichung von acht Proben (vier technische repliziert jeweils zwei biologische Wiederholungen pro Timepoint) werden angezeigt. (B) Zelle Lebensfähigkeit wurde auf MC38 murinen kolorektalen Karzinoms beurteilt Zellen menschlichen carcinoembryonales Antigen und den MV-Rezeptor CD46 stabil zum Ausdruck zu bringen (MC38-CEA-CD46) nach der Inokulation mit mittlerer nur (Mock) oder angegebenen Viren bei einer MOI von 1. XTT Zelle Lebensfähigkeit Assay wurde an angegebenen Zeitpunkten durchgeführt. Reduzierung im Zellviabilität wurde an früheren Zeitpunkten für die unveränderte Vektor beobachtet. Werte über 100 %, berechnet für MV-H-mCD3xhCD20 bei der 12 h Timepoint werden häufig kurz nach der Infektion, die möglicherweise aufgrund zellulären Stresses beobachtet oder Zelle abgeleitet Faktoren in der Virus-Suspension zu präsentieren. Mittelwerte und Standardabweichungen von drei technischen Wiederholungen sind für jedes Timepoint gezeigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 7
Abbildung 7 : Ziel-Zelle-Bindung durch bispezifische T Zelle Engagers (HdOs) von Masern Virus-infizierten Zellen ausgedrückt. Menschlichen Mantel-Zell-Lymphom-Zellen endogen ausdrücken CD20 (Granta-519) inkubiert mit menschlichen Immunglobulin G, Fc-Rezeptoren, gefolgt von Inkubation mit 2, 4, 6, 8 oder 10 µL (A) der gereinigten mCD3xhCD20 BTE Lösung, bzw. zu blockieren. HdO-gebundenen Zellen nachgewiesen mit Phycoerythrin (PE)-konjugierten Antikörper gezielt das HdO-assoziierten HA-Tag. Prozentsätze der gefärbten Zellen mit BTE Konzentrationen korreliert. (B) Controls für Selektivität und Spezifität der Bindung. Hier sind Steuerelemente von einem unabhängigen Experiment gezeigt, inkubiert einschließlich einer Probe von Zellen nicht mit BTE aber mit dem BTE-targeting Antikörper nur (Steuerung für unspezifische Bindung des Antikörpers an Zellen) oder mit einem BTE, die bekanntermaßen zu den Zellen des Interesses binden , gefolgt von Inkubation mit der BTE-targeting Antikörper (Positivkontrolle) oder einen Antikörper Isotype. Wenn verfügbare, isogene Zellen, die nicht mit dem Ausdruck des Ziel-Antigens der Wahl verwendet werden, können um weitere verbindliche Selektivität zu überprüfen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 8
Abbildung 8 : Magnetische Pulldown von menschlichen peripheren Blut Mononukleäre Zellen (PBMCs) durch Masern-Virus-codierte BTEs gebunden. Zellen wurden jeweils mit zwei verschiedenen Chargen des menschlichen T-Zell-targeting (t1, t2) oder nicht-targeting Kontrolle BTEs (n1, n2) inkubiert. HdO-gebundenen Zellen wurden auf Spalten mit magnetischen Beads beibehalten, oelletiert und lysiert. Β-Aktin in Lysates wurde durch Immunoblotting nachgewiesen. Intensitäten der Bands in der Elution Proben zeigen relative BTE-Zell-Bindung. Durchströmten Proben bestätigen die Anwesenheit von Zellen in allen Proben. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 9
Abbildung 9 : Zytotoxische Aktivität der Masern-Virus-codierte BTEs. Ziel-Tumor-Zellen (5 x 10³ B16-CD20-CD46 Zellen pro Well) wurden mit murinen T-Zellen in einem Verhältnis von 01:50 inkubiert. BTEs, die zuvor von der Überstand des MV-H-mCD3xhCD20-infizierte Zellen gereinigt wurden in angegebenen Konzentrationen hinzugefügt. Relative lyse der Zielzellen wurde von LDH-Release-Assay bewertet, nach 48 h. Zellen fehlt die BTE Antigen (B16-CD46) diente als Referenz auszuwertende antigenspezifischen Zytotoxizität abzielen. Mittel plus Standardabweichungen von drei technischen Wiederholungen pro Probe werden angezeigt. Ziel-Antigen exprimierenden Zellen wurden speziell in gewissem Sinne BTE Konzentration abhängig lysiert. Reinheit der BTE Produkt und Zielgruppe Antigen Expression Ebenen Einfluss Zelle Tötung. Im vorliegenden Beispiel wurde 15 % bestimmte Zelle Tötung bei einer relativ hohen BTE-Konzentration von 1 µg/mL erreicht. Dies ist ein typischer Wert für ein Versuchsaufbau mit langen Co Inkubationszeiten und suboptimale T-Zell-Kulturbedingungen. In anderen Situationen war bis zu 60 % spezifische Tötung erzielt mit BTEs gereinigt von MV-infizierten Überstände, erreichen ein Plateau bei HDO-Konzentrationen von 100 ng/mL und höhere38. Dies bedeutet, dass kontraintuitiv, die Grenze des Assays weniger als 100 ist % spezifische töten, die von unterschiedlichen Wachstum Kinetik in Tmax Steuerelementen Kokultur Proben gegenüber erklärt werden kann. Bitte klicken Sie hier für eine größere Version dieser Figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Onkolytische Immuntherapie (dh., OVT in Kombination mit Immunmodulation) hält große Verheißung für die Krebsbehandlung, anspruchsvolle weitere Entwicklung und Optimierung von onkolytische Viren immunmodulatorische Proteine codieren. Dieses Protokoll beschreibt Methoden zum generieren und validieren diese Vektoren für die spätere Prüfung in relevanten präklinischen Modellen und potenzielle zukünftige klinische Übersetzung in neuer Anti-Krebs-Therapeutika.

Zahlreiche verschiedene onkolytische Viren Plattformen mit klaren Vorteilen sind verfügbar63. Neben Krebs Spezifität, Vektor-Sicherheit, Anforderungen für Herstellung, Wirksamkeit bei Tumor Zelle Lysis und Induktion von Immunreaktionen ist Klonen Kapazität Schlüssel für erfolgreiche Vektorisierung von Immunmodulatoren, die mit einem bestimmten onkolytische. Leider fehlen derzeit direkte Vergleiche der verschiedenen OVs und verfolgt werden sollten, um optimale Behandlungsmöglichkeiten für den einzelnen Patienten zu identifizieren. Dies kann durch die Förderung der rationellen Entwicklung und Erprobung von neuartigen Transgen-Codierung Vektoren, beispielhaft hier für MV-BTE erleichtert werden. Angesichts der positiven Eigenschaften von MV (d. h., Oncotropism, Sicherheit, Fusogenicity, Immunogenität, Machbarkeit der genetischen Veränderung) konzentriert sich dieses Protokoll auf diese onkolytische Vektor, der für andere OV, vor allem Paramyxoviruses verallgemeinert werden können .

Für eine vernünftige Auswahl an potenziell relevante Immunmodulatoren als Kandidat transgene (Schritt 1.1.1) unbedingt ein gründliches Verständnis des Krebs-Immunität Zyklus macht systematische Literaturrecherche unverzichtbar. Darüber hinaus können großflächige Bildschirme, aber teuer, wertvoll, um neue Ziele zu identifizieren beweisen (siehe z. B. Patel Et Al.41).

Für Gestaltung der rekombinanten OVs sollte die gewünschte Expressionsprofile betrachtet werden. Im Fall von RNA-Viren Genexpression auf RNA-Ebene die jeweiligen Polymerase gesteuert. Beim Entwerfen von Transgen-Kassetten zum Einfügen in MV Genome (Schritt 1.1.2) ist die Vermeidung von Sequenzen, die MV Polymerase-gen Start/Stopp-Signale und RNA Seiten bearbeiten und im Anschluss an die sechs ähneln entscheidend für erfolgreiche Vektor Entwicklung. Darüber hinaus entsprechen Paramyxovirus gen Ausdruck Niveaus Positionierung innerhalb des Genoms, daraus eine Ausdruck gradient43. Positionierung des Transgens in einem upstream-Position erhöht in der Regel Ausdruck auf Kosten reduzierter Replikation. Diese Parameter hängen jedoch auch von der Größe, Struktur und Abfolge der jeweiligen Transgen. Infolgedessen ist eine Einschränkung der in diesem Protokoll beschriebenen Methodik die Notwendigkeit für die empirische Prüfung von neuartigen Vektor-Designs. In bestimmten Fällen Anpassungen der Transgen-Sequenz oder Positionierung kann zur Erreichung der gewünschten Vektor-Eigenschaften (Abbildung 2). Systematischer Vergleich der verschiedenen Positionen für Checkpoint Antikörper fügt zeigte optimale Ergebnisse für die H- ATU (unveröffentlichte Daten). Wie HdO-Einsätze haben vergleichbare Eigenschaften (Größe und Immunglobulin-Domänen), MV-BTE Vektoren analog geklont wurden38.

Rettung der infektiöse Partikel vom Virus cDNA (Schritt 2.1) erfordern mehrere Versuche für einige Konstrukte. Anpassung der Zellzahlen kann Zelldichte für Syncytia Bildung optimieren. Während eine bestimmten Dichte notwendig für effiziente Verbreitung von Zelle zu Zelle und Fusion der Zellmembranen, reduziert Kontakt Hemmung Virusreplikation. Darüber hinaus kann die Anzahl der infektiöse Partikel sichtbar Zellfusion induzieren nicht ausreichen. Wie Viren in Abwesenheit von Syncytia vorhanden sein können, können Rettung Proben jedoch trotzdem werden geerntet und frisch Produzent Zellen zur möglichen Ausbreitung übertragen. Ineffiziente Transfektion durch DNA minderwertige oder ungeeignete oder degradierten Transfektion Reagenzien repräsentieren typische Probleme, die relativ leicht zu beurteilen und durch neue DNA-Präparate zu generieren und testen verschiedene Reagenzien, bzw. zu beheben.

Erfolgreiche Virus Vermehrung (Schritt 2.2) ist entscheidend abhängig von den Bedingungen, die virale Replikation und lyse der Zelle bestimmen. Mit niedrigen Durchgang Zahlen von Produzent Zellen empfiehlt und infizierte Zellen für Syncytia Verlauf regelmäßig überprüft werden müssen. Anpassung der Zellzahlen, sein Temperaturen und Inkubationszeiten erforderlich, virale Verbreitung Vs. -Zell-Proliferation auszugleichen.

Eine wesentliche Einschränkung des beschriebenen Verfahrens der Virus-Produktion ist die Vorbereitung von Virus-Suspensionen aus groben Zelle Lysates. Forscher sollten sich der Tatsache bewusst sein, dass die Virus-Suspension zelluläre Faktoren enthält. Viruspartikel können konzentriert über Dichte Gradienten/Saccharose Kissen Ultrazentrifugation auf Kosten der Gesamtzahl der infektiöse Partikel und auch potentiell steigenden Konzentrationen von zellulären Reste werden. Virus kann auch von infizierten Zelle Überstände, Erhöhung der Reinheit, sondern weniger Gesamtausbeute konzentriert werden. GMP und groß angelegte Produktion von Paramyxoviruses erfolgt in der Regel über mehrere Schichten von Produzent Zellen ausgesät auf einem Faden net in Bioreaktoren für erhöhte Titer Ausbeute63. Genaue Überwachung, kontinuierliche Datenträgeraustausch serumfreien Bedingungen und anschließende Filtrationsschritte gewährleisten hohen Reinheit des produzierten Virus.

Bewertung der viralen Titer (Schritte 2,3 und 3,1) über die beschriebenen Syncytia Zählmethode ist nicht genau, aber es ist einfach durchzuführen und hinreichend genau ist bei ausreichender Anzahl von technischen Verwendung repliziert. Bei der Auswertung OV-vermittelte Zytotoxizität (Schritt 3.2) Grenzen der verfügbaren Tests berücksichtigt werden müssen. Metabolischen Tests unterscheiden nicht zwischen Zytostatika und Zytolyse Auswirkungen der experimentelle Behandlungen. Zur Messung der Zytolyse kann ein LDH-Release-Assay durchgeführt werden. Allerdings können beide Arten von Assays Inhalt des Virus Zubereitungen aus groben Zelle Lysates (Abbildung 6) betroffen sein.

Isolierung von Proteinen durch Virus-infizierten Zellen (Schritt 4.1) ausgedrückt kann Ausbeute und Reinheit, abhängig von der jeweiligen Transgen und Virus verwendet sowie technische Genauigkeit stark variieren. Qualitätskontrolle der Proteinreinigung ist somit entscheidend für die Bewertung der damit verbundenen experimentellen Ergebnissen.

Da eine ausführliche Beschreibung von möglichen funktionellen Assays für die Vielfalt der möglichen Immunmodulatoren würde den Rahmen dieser Publikation sprengen ist, konzentriert sich dieses Protokoll auf ex Vivo Methodik zur zellulären Zytotoxizität (Schritt 4.3) zu messen. Zelluläre Zytotoxizität, vor allem durch CD8 + T-Zellen, ist ein wichtiger Vermittler der immunologischen Tumorkontrolle erfolgreiche Immuntherapien64. Dies hat wichtige Implikationen für Ansätze Immuntherapie mit Antikörpern anti-Tumor-Immunantwort im Allgemeinen verbessern und bispezifische T Zelle Engagers insbesondere. Lokalen BTE Ausdruck von onkolytische Vektoren hat viel versprechende Ergebnisse in mehreren präklinischen Studien, einschließlich der RNA38 und DNA-Viren65,66,67,68erbracht.

Aufgrund der komplexen Wechselwirkungen von Tumor, Virus, Transgen Produkt- und Immunsystem des Wirts in lebenden Organismen Validierung der Immunmodulator Codierung onkolytische Vektoren in der Zellkultur wie gezeigt, hier ist nicht ausreichend, um die therapeutischen Ergebnisse vorherzusagen. Wichtig ist, die vorgeschlagenen isolierte Bewertung der Vektor- und Immunmodulator Funktionen bzw. ist unerlässlich für die Machbarkeitsstudie aber nicht beschreiben mögliche Synergien und komplexen Interaktionen innerhalb der Tumor Mikroumgebung. Tests für Toxizität und Wirksamkeit in entsprechenden in-vivo-Modelle ist entscheidend für weitere Entwicklung der neuartigen rekombinanten Vektor konstruiert, aber ist nicht leicht zu bewerkstelligen. Immunologische Sicherheit ist bei nichtmenschlichen Primaten wie Makaken, regelmäßig überwacht und Mausmodelle dienen der Bioverteilung und Wirksamkeit analysiert20,69. Jedoch viele dieser Modelle haben Einschränkungen in Bezug auf den Ausdruck von Virus-Rezeptoren im Gewebe der Host und Host Permissivität und einige nur unzureichend imitieren des komplexen Zusammenspiel von OV, Tumor und immun Mikroumgebung. Sorgfältiger Prüfung der entsprechenden Modelle ist daher obligatorisch.

MV-HdO-Behandlung wurde zuvor in menschlichen Xenograft und Phänomen Mausmodellen untersucht. Keine BTE Transgen Produkte waren nachweisbar im Serum von Mäusen mit HdO-Codierung MV38behandelt, Dämpfung der weitere erfolgreiche Verhinderung der systemischen Exposition auch ohne Angabe der natürlich Oncotropic Stamm Impfvirus. Lokalen Ausdruck ist entscheidend für OV-codierte Immunmodulatoren, die giftig beim systemisch verabreicht werden. Falls erforderlich, Tumor-Spezifität erweiterbar durch Re-Target um Oberflächenmarker der Wahl70,71,72 und RNA-basierten de-targeting für verbesserte Oncotropism73,74 (Zelle bewertet von Ruiz und Russell75). Weitere Änderungen können eingeführt werden, um Vektoren für spezifische therapeutische Anwendungen (rezensiert von Miest und Cattaneo76), einschließlich Aufnahme von transgenen für Diagnosezwecke77,78 oder Prodrug optimieren Umstellung auf Nebenwirkungen von Chemotherapie79,80, Einführung von Sicherheit zu minimieren schaltet81und Ausrichtung der Tumor Stroma oder Gefäßsystem (z. B. über Bispezifische Antikörper82).

Neben der gentechnischen Veränderung von viralen Vektoren übertragen Kombination Therapien mit Chimären Antigen-Rezeptor (Auto)-T-Zell83, Chemotherapie84,85,86oder Strahlentherapie87, 88 , 89 weitere erweitern das Repertoire der OVT. Wie MV Immunität stark verbreitet ist, Strategien zur Neutralisierung der Antikörper zu umgehen sind entwickelt worden, unter anderem den Austausch von Umschlag Glucoproteide für diejenigen Verwandten Paramyxoviruses90, Polymer Coating von Partikeln, Zellträger zu verwenden liefern Sie Viren und transiente Immunsuppression (rezensiert von Russell Et Al.6). Weiterentwicklung des erweiterten OV Immuntherapie Therapien erfordert Sicherheit und therapeutische Wirksamkeit in geeigneten Tiermodellen mit Patientenmaterial, und letztlich in kontrollierten klinischen Studien getestet.

Angesichts die Fülle von möglichen Kombinationen, ist umfassende Tests nicht durchführbar. Mathematischer Modellierung kann in der Priorisierung der möglichen Kombination Therapien sowie ihre jeweiligen Dosierung und Planung durch die Vorhersage Behandlungsergebnisse in Silico (rezensiert von Santiago Et Al.91) unterstützen. Beim Testen von Wirksamkeiten des Romans rational gestaltete Vektoren, solide translationale Begleitforschung ist maßgeblich für ein tieferes Verständnis der zugrunde liegenden virologischen und immunologischen Prozesse. Dies ist im Allgemeinen für die Generation der entsprechenden Modelle, Informationen über weitere mögliche Ziele und Fortschritte auf dem Gebiet von entscheidender Bedeutung. Abschließend werden aus erster Hand Einblick in relevante Methoden der Vektor-Design, Erzeugung und Charakterisierung in dieser Linie der Arbeit beschleunigen Sie Entwicklung und Erforschung neuartiger Therapeutika für zukünftige klinische Übersetzung zu unterstützen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.e. Engeland wird als Miterfinder der ein patent über RNA-Viren für Krebs Immunovirotherapy im Besitz von Universität Heidelberg aufgeführt. J.P.W. Heidbuechel hat nichts preisgeben.

Acknowledgments

Diese Methoden wurden in der Virotherapie Gruppe unter der Leitung von Prof. Dr. Dr. Guy Ungerechts im nationalen Zentrum für Tumorerkrankungen in Heidelberg gegründet. Wir sind verpflichtet, ihm und allen Mitgliedern des Labor-Teams, vor allem Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler und Jessica Albert. Diese Arbeit wurde von der Else Kröner-Fresenius-Stiftung unterstützt (Grant 2015_A78, C.E. Engeland) und der Deutschen Forschungsgemeinschaft (DFG, C.E. Engeland EN 1119/2-1 gewähren). J.P.W. Heidbuechel erhält ein Stipendium in Höhe von Helmholtz International Graduate School for Cancer Research.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics