Paramyxoviruses עבור Immunomodulation, ממוקדות הגידול: הערכה לשעבר Vivo ועיצוב

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

פרוטוקול זה מתאר עבודה מפורט עבור הדור של ex-vivo אפיון של וירוסים oncolytic ביטוי של immunomodulators, באמצעות וירוסי חצבת קידוד bispecific תא T engagers כדוגמה. יישום והתאמה וקטור פלטפורמות אחרות, transgenes נאיץ את ההתפתחות של הרומן immunovirotherapeutics לתרגום קליניים.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

חיסוני סרטן מוצלח יש פוטנציאל להשגת שליטה הגידול לטווח ארוך. למרות ההצלחות האחרונות קליני, נותר צורך דחוף טיפולים יעילה ובטוחה המותאמים פרופילים המערכת החיסונית גידול בודדים. וירוסים Oncolytic לאפשר את תנאי הגיוס של תגובות חיסוניות אנטי הגידול, כמו גם ביטוי גנים בעל הגבלת הגידול. פרוטוקול זה מתאר את דור לשעבר vivo וניתוח של וקטורים oncolytic immunomodulatory. התמקדות וירוסים החיסון נגד חצבת קידוד bispecific תא T engagers כדוגמה, המתודולוגיה הכללית ניתן להתאים וירוס מינים אחרים, transgenes. זרימת העבודה הציג כוללת של עיצוב, שיבוט, הצלה, הפצת וירוסים רקומביננטי. מבחני לנתח שכפול קינטיקה, פעילות lytic של וקטור הפונקציונליות של immunomodulator מבודדים ex-vivo כלולים, ובכך להקל על הדור של סוכנים הרומן להמשך פיתוח במודלים פרה, ובסופו של דבר תרגום רפואי.

Introduction

Oncolytic וירוסים (OVs) מפותחים כמו הרפוי אנטי סרטניים, במיוחד לשכפל בתוך ולהרוג תאים סרטניים תוך השארת רקמות בריאה ללא פגע. זה הפך נפוץ להבין את virotherapy oncolytic (ש'), ברוב המקרים, לא להסתמך רק על פירוק הגידול מלאה על-ידי שכפול יעיל והפצת של הוירוס, אבל דורש מנגנון פעולה נוספים להצלחה בטיפול, כולל כלי הדם, סטרומה מיקוד ומעל הכל גירוי המערכת החיסונית1,2,3,4. בעוד מחקרים רבים OV מוקדם בשימוש וירוסים שלא שונתה, המחקר הנוכחי יש שהרוויח ביולוגית משופרת הבנה, וירוס biobanks המכילים פוטנציאל הרומן OVs, ואת האפשרויות המוצעות על ידי הנדסה גנטית על מנת ליצור OV מתקדם פלטפורמות5,6,7.

לאור ההצלחה האחרונה של חיסוני, immunomodulatory transgenes הם עניין מיוחד בנושא הנדסה גנטית של OVs. ביטוי יישוב של המוצרים בהם הגן על-ידי תאי הגידול הנגועים OV מפחית רעילות לעומת ניהול מערכתי. פילוח מושגת באמצעות וירוסים עם oncoselectivity הגלום או על-ידי שינוי נגיפי tropism8. Immunomodulation המקומיות משפר את מנגנוני אנטי הגידול ומגובש של עבודה בשעות נוספות. יתר על כן, אסטרטגיה זו הוא אינסטרומנטלי חוקר את יחסי הגומלין בין וירוסים, תאים סרטניים את מערכת החיסון של הפונדקאי. לשם כך, פרוטוקול זה מספק זרימת עבודה ישימים, הניתנים לשינוי עיצוב, שיבוט, להציל, להפיץ של אמת oncolytic paramyxovirus (במיוחד וירוס חצבת) וקטורים קידוד כזה transgenes.

אפנון של התגובה החיסונית יכולה להיות מושגת על ידי מגוון רחב של מוצרים transgene מיקוד שלבים שונים של סרטן-חסינות מחזור9, כולל שיפור זיהוי אנטיגן הגידול [למשל, אנטיגנים סרטניים הקשורים (תעש) או inducers של מרכזי histocompatibility מורכבים (MHC) מחלקה אני מולקולות] מעל תמיכה תא דנדריטי ההבשלה למצגת יעילה אנטיגן (ציטוקינים); גיוס והפעלת תאים חיסוניים הרצוי כגון ציטוטוקסיות helper T תאי [נוגדנים, bispecific תא T engagers (BTEs)]; פילוח מדכא תאים כגון בתאי T רגולטוריים, התאים מיאלואידית נגזר משתיק קול, מקרופאגים סרטניים הקשורים לסרטן-הקשורים fibroblasts (נוגדנים, BTEs, ציטוקינים); ומניעת עיכוב תא אפקטור ותשישות (מעכבי המחסום). לפיכך, שפע של גורמים ביולוגיים זמין. הערכה של כזה immunomodulators מקודד וירוס לגבי היעילות הטיפולית ואת הסינרגיה אפשרי, כמו גם ההבנה של מנגנונים בהתאמה יש צורך לשפר טיפול בסרטן.

וירוסי RNA חד-גדילי תחושה שלילית של משפחת Paramyxoviridae מאופיינים על ידי תורמת את השימוש בהם מספר תכונות כמו oncolytic וקטורים. אלה כוללים oncotropism טבעי, קיבולת גנומית transgenes (יותר מ 5 kb)10,11, היעילה מתפשט כולל היווצרות syncytia ו- immunogenicity גבוהה12. לכן, פלטפורמות OV בהתבסס על וירוס כלבלבת13, וירוס חזרת14, וירוס מחלת ניוקאסל15,16,סנדאי וירוס17, וירוס קופיים 518, Tupaia paramyxovirus19 פותחו. בולטת, חיים חיסון וירוס חצבת הקלוש זנים (MV) התקדמו קליניות פיתוח20,21. זני וירוס אלה שימשו במשך עשרות שנים עבור חיסונים שגרתיים עם שיא בטיחות מעולה22. יתר על כן, אין שום סיכון עבור insertional מוטגנזה מכוונת בשל השכפול בקפדנות cytosolic של paramyxoviruses. מערכת רב תכליתי גנטיקה הפוכה המבוססת על אנטי-גנומית cDNA המאפשר החדרת transgenes ליחידות שעתוק נוספים (ATUs) הוא זמין11,23,24. וקטורים MV קידוד symporter סודיום יודיד (MV-ש"ח) לדימות, הקרנות או אנטיגן carcinoembryonic מסיסים (MV-CEA) כסמן הפונדקאית על ביטוי גנים ויראליים הם שמחושב כעת בניסויים קליניים (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 ו- NCT00408590). ניהול בטוח אושרה, דווח על מקרים של יעילות אנטי הגידול הקודם מחקרים25,26,27,28,29, 30 (נבדקה על ידי Msaouel et al.31), לסלול את הדרך עבור וירוסים חצבת oncolytic נוספים יש פותחה, נבדק preclinically. MV קידוד immunomodulatory מולקולות מיקוד שלבים מגוונים של מחזור סרטן-חסינות הוכחו לעכב צמיחת הגידול ו/או להאריך את הישרדות בעכברים, עם הוכחה יעילות החיסון בתיווך, זיכרון לטווח ארוך של מערכת החיסון מגן ב- syngeneic מודלים העכבר. מקודד וקטור transgenes כוללים המושבה גרנולוציט-מקרופאג מגרה פקטור (GM-CSF)32,33, חלבון מפעיל נויטרופילים של ה פילורי 34, מעכבי המערכת החיסונית מחסום35, אינטרלוקין-12 (IL-12)36תעש37, BTEs38, אשר קשר צולב אנטיגן פני שטח הגידול עם CD3, ובכך לעודד פעילות אנטי הגידול על-ידי תאי T polyclonal, ללא קשר (ירידה לפרטים וגירוי שיתוף של קולטן תא T איור 1). תוצאות פרה מבטיח שהושג בונה דרישה נוספת translational למאמצים אלו.

Talimogene laherparepvec (T-VEC), סוג אני וירוס הרפס סימפלקס קידוד GM-CSF, הוא oncolytic היחידה הטיפולית אושרה על ידי ארצות הברית מזון, והתרופות האמריקני (FDA) סוכנות התרופות האירופית (EMA). שלב המחקר השלישי המוביל אישורי בשנת 2015 מאוחר לא רק הראו יעילות באתר של הזרקת אינטרה-tumoral, אלא גם השפעות abscopal (קרי, הפוגות של נגעים ללא הזרקת) במלנומה מתקדמת39. T-VEC מאז נכנסה ניסויים נוספים עבור יישומים אחרים הישויות הגידול (למשל סרטן עור שאינו מלנומה, , NCT03458117; סרטן הלבלב, NCT03086642), הערכה של טיפולים משולבים, במיוחד עם מחסום המערכת החיסונית מעכבי (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 ו Ribas et al.40).

זה מדגים לא רק את הפוטנציאל של חיסוני oncolytic, אלא גם את הצורך בהמשך מחקר לזיהוי סופריור שילובים של תעריף שעות נוספות, immunomodulation. עיצוב רציונלית של וקטורים נוספים ופיתוח שלהם לבדיקה פרה הוא המפתח במשימה. זה גם לקדם את ההבנה של מנגנונים הבסיסית, יש השלכות על ההתקדמות לקראת טיפול בסרטן אישית יותר. לשם כך, פרסום זה מציג את המתודולוגיה שינוי ופיתוח של paramyxoviruses על חיסוני סרטן ממוקד, ליתר דיוק, של וירוסי חצבת oncolytic קידוד נוגדנים מפעיל את תא T (איור 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

הערה: [O], [P], ו [ז] להצביע על סעיפים קטנים החלים: OVs הכללי, paramyxoviruses (רוב) או MV בלבד, בהתאמה. [B] מציין סעיפים ספציפיים עבור BTE transgenes.

1 שכפול של קידוד Immunomodulator Transgenes לתוך וקטורים וירוס חצבת

  1. [O] עיצוב הכנס רצף.
    1. [O] להחליט על immunomodulator עניין מבוסס על ספרות מחקר או על מידע כגון מסכי גנטי41 , שואבים את רצף cDNA רלוונטי המתאים מסדי נתונים כגון GenBank, הארכיון נוקלאוטיד האירופית, או ImMunoGeneTics מידע מערכת בינלאומית (IMGT).
    2. [O] להוסיף תכונות נוספות הרצף transgene (איור 3). רצף קוזאק הקודמת ואופטימיזציה codon ספציפית יכול לשפר את הביטוי. האות רצפים נדרשים עבור הפרשה. כוללים רצפי קידוד תגים חלבון N - ו/או C-מסוף עבור זיהוי וטיהור42. כוללות הגבלה אתרים להכנסה לתוך וקטור.
      הערה: [M] יחידות שעתוק נוספים (ATUs) מחסה MV פולימראז ג'ין ומתחילים לעצור אותות נחוצים עבור ביטוי transgene מ רקומביננטי הגנום MV. וקטורים מתאים cDNA אנטי-גנומית, נשלט על-ידי היזמים CMV, המכיל ATUs עם הגבלת ייחודי אתרי היכרות ראשונית של תחושה חיובית transgenes-תפקידים מוגדרים, פותחו בעבר11. [P] מיקום הולם transgene הוא קריטי, מכיוון שזה משפיע על שכפול ויראלי והביטוי transgene עקב מעבר הצבע ביטוי אופייני paramyxoviruses43. ההיכרות ATU קרובים לסיומה 3' של הגנום אנטי (כלומר., בתפקיד מנהיג או במורד הזרם של הגן P ) בדרך כלל תוצאות בביטוי transgene גבוהה במחיר מופחת שכפול ויראלי. שכפול מוגבר, רמות נמוכות יותר של ביטוי transgene ניתן לצפות בעת שימוש את ATU במורד הזרם של הגן H . אריזה של הגנום של מספר paramyxoviruses, כולל וירוס חצבת, דורש קשירה של שישה נוקלאוטידים על ידי כל חלבון nucleocapsid44. להכנסה של transgenes לתוך וירוסים כאלה, להבטיח מספר נוקלאוטידים בגנום מלאה יהיה שמתחלק שש. זה גם נקרא "כלל לשישה"45,46. במידת הצורך, לכלול נוקלאוטידים נוספים תותב (הזרם של הרצף קוזאק או במורד הזרם של stop codon) ללא היכרות עם מסגרת משמרות או עצירה מוקדמת codons. [ז] למנוע רצפי transgene המסוים דומים MV ג'ין התחלה (AGGRNCMARGW), לעצור אותות (RTTAWANAAAA) ו- RNA עריכת רצפי (AAAAAGGG). רצפי הקונצנזוס כאלה פורסמו (ראה למשל, פארקים ואח47).
    3. [O] לרכוש oligonucleotide של הרצף הרצוי או להרכיב של רצפים זמינים באמצעות שיבוט מולקולרי רגיל48.
      הערה: [O] עבור הגברה PCR של transgene, לתכנן פריימר לפנים כולל האתר הגבלת במעלה הזרם של נוקלאוטידים 15-20 הראשון את תותב, פריימר הפוכה כולל האחרון 15-20 נוקלאוטידים של הקדמי ואחריו ההגבלה במורד הזרם אתר.
  2. [O] שיבוט הוספה לתוך ה-DNA קידוד הגנום הנגיפי (אנטי-).
    1. [O] לשכפל את תותב לתוך ה-DNA וקטורים או DNA הגנום אנטי וירוסים RNA לפי תקן מולקולרית שיבוט טכניקות48 (קרי, אנזימטי הגבלת ואחריו מצדו דנ א).
      1. [O] למנוע מחדש מצדו של וקטור באמצעות אתרים שאינם תואמים הגבלה או זרחון והתבקשתי לפני מצדו.
      2. [O] לבודד את המוצר מצדו על-ידי agarose בג'ל ג'ל עוקבות טיהור באמצעות ערכות זמינים מסחרית. באופן כללי, יעילות אופטימלית מצדו מושגת ביחס 3:1 שן טוחנת של הוספה וקטוריים.
    2. [O] שינוי צורה המוצר מצדו לתוך החיידקים המוסמכת המתאימה להתאוששות יעילה של פלסמידים גדולים (קרי, מבצע הלם חום של e. coli49) ולזהות שיבוטים חיידקי מסתיר את ה-DNA הנכונה על ידי המושבה PCR50 .
    3. [O] בידוד מוגבר DNA שיבוט חיידקי יחיד באמצעות ערכות הכנה DNA זמינים מסחרית. לאשר את תקינות גנומית שליטה תקציר עם אנזימי הגבלה המתאים (למשל, HindIII עבור MV הגנום [M]). לאשר נכון והתקינות של transgene ידי רצף.
      הערה: [ז] עבור transgenes הוכנס HMV - ATU, לבצע סנגר רצף עם תחל הבאים: H-9018 [פריימר לפנים, איגודים למיקום MV הגנום 9018 H פתח קריאה מסגרת (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (הפוך פריימר, איגודים למיקום הגנום MV 9249 ב ORF L ): 5' CAGATAGCGAGTCCATAACGG 3'.

2. להציל את חלקיקי וירוס חצבת רקומביננטי קידוד Immunomodulators

  1. [O] לייצר חלקיקי וירוס רקומביננטי מ (אנטי-) גנומית הדנ א באמצעות תקנים של וירוס תאים מפיק לפי הפרוטוקול הסטנדרטי עבור הנגיף בהתאמה. פעל לפי ההנחיות לעבודה בתנאים סטריליים. לבצע תרבית תאים תחת וקולטי, בפרט כל השלבים הכרוכים וירוס ב- class II ארונות בטיחות ביולוגית.
    1. [ז] על לעזרתו של וירוסי חצבת מ cDNA23,24, צלחת MV מפיק (הקוף הירוק אפריקאי כליות נגזר Vero) תאים באופן שווה על צלחת 6-ובכן 24 שעות לפני תרביות תאים. זרע 2 x 105 תאים ב- 2 mL בינוני (DMEM ששינה הנשר של Dulbecco) המכיל 10% סרום שור עוברית (FBS) לכל טוב כדי להשיג 65-75% confluency בזמנו של תרביות תאים.
      הערה: [P] להפחית את מספרי הטלפון הנייד אם התאים והדבר לפני היווצרות syncytia הנוצרות על-ידי וירוס.
    2. [P] Transfect התאים עם ה-DNA קידוד של פלסמידים עוזר נגד הגנום, נדרש ויראלי, וקידוד, אם רצונך בכך, פלסמיד כתב פלורסנט כדי להעריך את יעילות תרביות תאים.
      1. [M] µg 5 מיקס של דנ א רקומביננטי קידוד חצבת וירוס אנטי הגנום, 500 ננוגרם של פלסמידים ביטוי בתרבית של קידוד וירוס חצבת N ו- L חלבונים ו 100 ננוגרם של פלסמידים קידוד החלבון P ו כתב פלורסנט הנפח הכולל של 200 µL DMEM.
      2. הוסף µL 18.6 של ריאגנט liposomal תרביות תאים, לערבב מיד על ידי מצליף את הצינור, תקופת דגירה של 25 דקות בטמפרטורת החדר (RT).
      3. [P] להחליף את המדיום 1.8 מ של DMEM, 2% FBS, 50 kanamycin µg/mL (או אנטיביוטיקה אחרים למניעת זיהום) לכל טוב, ואז להוסיף את תערובת תרביות תאים dropwise הבאר ו מערבולת בקפידה. דגירה תאים בין לילה ב 37 מעלות צלזיוס, 5% CO2. החלף בינוני 2 מ של DMEM טריים, 2% FBS ו- µg 50/mL kanamycin למחרת; חזור על זה בינוני הופך חומצי.
        התראה: [O] להתמודד עם תאים וחומרים לפי תקנות אבטחה, כמו וירוס עשויה להיות נוכח של תרביות תאים באמצעות השלבים הבאים. השלך פסולת זיהומית (פוטנציאל) כראוי.
  2. [P] לאסוף, הפצת חלקיקי וירוס.
    1. [P] להתבונן תאים מדי יום על ידי מיקרוסקופ על הכתב ג'ין ביטוי syncytia היווצרות (איור 4). הקציר וירוס כאשר syncytia גדול, המורכב תאים 20 או יותר, גלויים או תאים להפוך צפופה מדי (כלומר., כשהם מתחילים לגדול בשכבות מרובות, בדרך כלל לאחר 7-9 ימים).
      הערה: [P] אם אין syncytia שנצפו בונה ווקטור נתון, זה לא בהכרח אומר כי החילוץ נכשלה. כמו וירוסים זיהומיות עשויות להיות נוכח במדגם, העברת תאים מפיק טריים עבור passaging.
    2. [P] זרע כ 1.5 x 10 תאים מפיק6 ב 12 מ של DMEM עם 10% FBS, על 10 ס מ מנות 24 שעות לפני הקציר הצפוי, או 2.5 x 106 תאים לכל צלחת 4-6 שעות לפני passaging של הווירוס להשיג 65-75% confluency בזמנו של וירוס inoculat יון.
    3. [P] כדי לאסוף וירוס רומא, בזהירות לגרד מפיק חסיד התאים מהצלחת באמצעות מגרד תא ולהעביר את תגובת שיקוע המכיל תאים לתוך שפופרת צנטרפוגה. להסיר את שאריות תאים על ידי צנטריפוגה עבור 5 דקות ב 2,500 x g ו- 4 מעלות צלזיוס.
      הערה: שרוטים תאים עשוי להיות מועבר ישירות מבלי צנטריפוגה כדי למקסם את וירוס דחויים על חשבון תנאי שיוצרת התרבות וחפצים מיקרוסקופ פוטנציאליים.
      זהירות: הימנעו [O] לשפוך המדיה כאשר גירוד התאים. מזער את היווצרות תרסיס.
    4. [P] להכין על ידי ערבוב את תגובת שיקוע ללא תא מהשלב 2.2.3 בינונית ללא סרום לאמצעי הסופי של 4 מ ל- inoculum. החלפת המדיום על המפיק תאים על-ידי inoculum, דגירה תאים עבור פחות 2 h-CO 37 ° C ו-5%2. להוסיף 6 מ של DMEM עם 10% FBS דגירה תאים בין לילה לפני שינוי המדיום 12 מ של DMEM טריים עם 10% FBS.
    5. [P] לבחון את התאים לפחות פעמיים ביום ואת הקציר וירוס לפני פרץ syncytia (קרי, ממברנה הפרעה הופך גלוי). הקציר המעבר הראשון של וירוס, להסיר את תגובת שיקוע מהצלחת, להוסיף µL 600 בינוני ללא סרום, לגרד תאים עם מרים התא, להעביר צינור נקי.
      הערה: [ז] תלוי וירוס זן51,52 והתקדמות של זיהום, להעביר צלחות עם תאים נגועים 32 ° C כדי להקל על שכפול ויראלי וכפולה. באופן כללי, MV שוורץ זנים להפיץ טוב ב- 37 מעלות צלזיוס, תוך העברת תאים נגועים בוירוסים זן edmonston ב B 32 ° C תוצאות היווצרות syncytia איטי יותר אך titers גבוהה יותר.
      הערה: [P] אינם מאפשרים את שכבת תאים להתייבש במשך הקציר, כמו התוצאה תהיה infectivity מופחת של נגיפים. למרות כמה וירוס אבודים כשזה מגיע. להסתרת את תגובת שיקוע של תאים נגועים, ניתן להשיג titers גבוהה משכבת תאים.
    6. [P] מיד להקפיא את המתלים וירוס בחנקן נוזלי. חנות ב-80 מעלות צלזיוס במשך לפחות 24 שעות להבטיח יסודית קפוא. להאריך עד כמה ימים כדי להפסיק את ההליך, במידת הצורך.
    7. לשחרר חלקיקים נגיפיים ידי מפשיר ב 37 º C. Homogenize על ידי vortexing, צנטריפוגה עבור 5 דקות ב 2,500 x g ו- 4 מעלות צלזיוס. להעביר את supernatants cryotubes שכותרתו וחנות ב-80 מעלות צלזיוס.
      הערה: [O] לאחסן וירוסים בגדלים aliquot נאותה לניסויים מאוחר יותר, כפי הם מעדיפים הקרת פעם אחת בלבד, שימוש באופן מיידי. [P] נוסף ההקפאה-הפשרה מחזורי או אחסון ב 4 מעלות צלזיוס במשך מספר ימים התוצאה בהפחתה משמעותית של titers ויראלי.
    8. [P] יום אחד לפני passaging נוספת כדי להשיג את הכמות הנדרשת כייל נוגדנים, זרע 4 x 106 תאים מפיק 12 מ של DMEM עם 10% FBS על מנות 15 ס מ. לחסן עם וירוס-ריבוי של זיהום (MOI) של 0.03. להדביק ב mL 8 ללא סרום בינוני לכל צלחת ושנה בינונית ל- DMEM עם 10% FBS לאחר המקננת תאים עבור פחות 2 ה סולם למעלה באמצעות לוחות מרובים.
    9. הקציר כפי שמתואר שלב 2.2.5, כאשר syncytia התפשטו לאורך השכבה כל התא. מאגר של המתלים שהושג ב 50 מ ל צינורות, תהליך כפי שמתואר שלבים 2.2.6–2.2.7.
      הערה: [O]. זה חיוני לבדוק את כל הצלחות באופן חזותי עבור חיידקים ופטריות זיהום לפני הקציר. באופן כללי, בדוק את כל השורות תא באופן קבוע עבור זיהום עם mycoplasma או וירוסים adventitious על ידי ה-PCR מולטיפלקס.
  3. [P] הערך נגיפי titers. לקבוע titers של וירוס מניות ב- octuplicates לכל aliquot באמצעות לוחות 96-ובכן. לבצע טיטור של שלוש aliquots בודדים לכל וירוס הצלה ולהשתמש הערך הממוצע כדי לחשב את הכמות של וירוסים ההשעיה כדי לשמש בניסויים.
    1. [P] בריכת המפיק תאים, ספירה, ולהתאים את 1.5 x 10 תאי5 מ ל DMEM עם 10% FBS.
    2. [P] pipet 90 µL של DMEM עם 10% FBS לתוך כל טוב של צלחת 96-ובכן.
    3. [P] להוסיף 10 µL aliquot אחד של המניה וירוס אל כל בארות 8 בעמודה הראשונה של הצלחת ומערבבים היטב על-ידי pipetting למעלה ולמטה לפחות 10 פעמים.
    4. [P] ביצוע דילולים 10-fold סדרתי של הנגיף. העברת 10 µL של כל טוב מן הראשונים העמודה השניה באמצעות של pipet רב-ערוצי. לערבב ביסודיות על ידי pipetting למעלה ולמטה ולהשתמש pipet טריים טיפים עבור כל שלב דילול. להתעלם µL 10 מכל קידוח של העמודה האחרונה.
      הערה: כל צלחת 96-ובכן מאפשר 12 השלבים דילול טורי. [ז] וקטורים MV, 8 צעדים של דילולים 10-fold מספיקים בדרך כלל, כפי titers לעיל עונה 1 פרק 109 תאים יחידות זיהומיות (ciu לקדם) /mL מתקבלים לעיתים רחוקות בשיטה של התפשטות שמתואר בשלב 2.2. [P] וולס בקרה ללא וירוס ניתן להשוואה וכדי לפקח על זיהום.
    5. [P] להוסיף 100 µL תא השעיה מכל קידוח, דגירה ב 37 מעלות צלזיוס, 5% CO2 עבור 48 ה ודא העדר תא גושים ההשעיה להשגת הומוגנית חלוקת תאים.
    6. [P] בדוק syncytia באמצעות מיקרוסקופ אור. הרוזן syncytia היטב כל העמודה עם הגורם הדילול הגבוהה ביותר המכיל syncytia גלויה.
    7. [P] לחשב את המספר הממוצע של syncytia לכל טוב באותה עמודה על-ידי חלוקת המספר הכולל של syncytia עד שמונה. להכפיל את הממוצע עם הגורם דילול של העמודה בהתאמה, החל מ- 10 ciu לקדם2 לכל mL עבור העמודה הראשונה53 (ראה איור 5 כדוגמה).

3. קביעת Replicative ויכולות ציטוטוקסיות של וקטורים ויראלי קידוד Immunomodulators

  1. [O] השווה שכפול קינטיקה של וירוס רקומביננטי שנוצר ולא הווקטור יאומתו באמצעות עקומות גדילה בשלב אחד או צעד מרובת (Gc). עבור מחשבי: קטלוגים כלליים בשלב אחד, רומא ויראלי הם העריכו בעקבות זיהום בו זמנית של כל התאים (תיאורטית, 100% זיהום). רב שלבי ההתחלה מחשבי קטלוגים כלליים על אחוז נמוך של תאים נגועים לעקוב אחרי כמה סיבובים של וירוס שכפול.
    1. [ז] לניתוח של קינטיקה שכפול הוירוס חצבת, זרע עונה 1 פרק 105 תאים Vero ב 1 מ"ל של DMEM עם 10% FBS לכל טוב על. ובכן 12 צלחות יום אחד לפני זיהום. צלחת לפחות שתי בארות עבור כל timepoint עניין כמו משכפל טכני.
    2. [O] להדביק את התאים בווירוס. נמוכה שהוויזה בתוקף רב שלבי או MOI גבוהה עבור מחשבי קטלוגים כלליים בשלב אחד [מ] (0.03 ו- 3 עבור שכפול MV ב- Vero תאים, בהתאמה). החלף בינוני µL 300 בינוני ללא סרום המכיל את הכמות המתאימה של וירוס, דגירה-37 מעלות צלזיוס ו-5% CO2 לפחות 2 ה' הסר inoculum, להוסיף 1 מ"ל של DMEM עם 10% FBS, ולהמשיך הדגירה.
    3. [P] בבית timepoints רלוונטי כגון 12, 24, 36, 48, 72 ו- h 96 לאחר ההדבקה, לקצור ויראלי רומא על ידי ישירות גירוד התאים לתוך האמצעי. להעביר תוכן מכל קידוח שפופרת בודדים, snap-הקפאת בחנקן נוזלי, לאחסן ב- 80 ° C עד טיטור.
      הערה: [P] דוגמאות שכפל ייתכן איחדו בשלב זה לניתוח של titers הממוצעת.
    4. [P] לאסוף דגימות timepoints כל. להפשיר בו זמנית ב 37 מעלות צלזיוס להערכת צאצאי ויראלי. מערבולת, גלולה שאריות תאים על ידי צנטריפוגה למשך 5 דקות ב 2500 x g ו- 4 מעלות צלזיוס.
    5. [P] לחשב ממוצע titers של כל מבנה, timepoint כפי שתואר לעיל. מגרש titers לאורך זמן. להשוות עקומות גדילה של וקטורים עם ובלי transgenes שנוסף, עם transgenes שונים, או עם transgenes מוכנס לעבר עמדות שונות (ראה איור 6א).
  2. [O] השווה lytic פעילויות של וירוסים קידוד immunomodulator ולא יבוצעו בהם שינויים.
    1. [O] בחר מתוך מתודולוגיות אפשרי כולל מדידות עכבה, לקטט דהידרוגנאז (LDH) לשחרר assay, או מבוסס-מטבוליזם התא ערכי צבע מוחלטים הכדאיות מבחני [למשל, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) ו 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) מבחני].
      1. [ז] לנתח את cytotoxicity של חצבת וירוס וקטורים באמצעות XTT assay, תאים Vero זרע כפי שמתואר בשלב 3.1.1. כוללים/בית לבריא פקד עבור כל timepoint.
        הערה: [O] ביצוע XTT assay בבית timepoints שונים באותה דגימת זרע יכול להגביל את שגיאות טכניות, אבל הכביסה חוזרות וחשיפה ריאגנט XTT משפיע על מספר התאים קיימא. עכבה מספק readout חלופית של מדידות רציפה.
    2. [ז] להדביק תאים Vero ב MOI 1 כפי שמתואר בשלב 3.1.2.
      הערה: [ז] לדלקת של תאים פחות מתירניות היעד כמו כמה שורות תאים סרטניים מאתר, MOI גבוה 3 או 5 ייתכן שיהיה צורך.
    3. [O] בבית timepoints עניין (למשל., 12, 24, 36, 48, 72 ו- h 96 לאחר ההדבקה) להכין את הכמות הנדרשת של ריאגנט XTT (כלומר., µL 300 לאדם טוב פלוס 10% עודף). למנוע חשיפה קלה.
    4. [ז] על כל timepoint, הסר בינוני ולס המתאימות. להחליף על ידי 300 µL של ריאגנט XTT, דגירה ב 37 מעלות צלזיוס בחושך. איסוף supernatants כאשר הכימית ב הבארות שליטה הפך אדום עמוק, אשר בדרך כלל לוקח בין 15 דקות ו- 2 h, ומקפיאים ב-20 ° C.
      הערה: [O] אינקובציה פעמים תלויים לבנות וירוס, סוג התא, צפיפות, אפקט ציטופתי.
    5. [O] לאחר איסוף כל הדגימות, להפשיר בו זמנית. להעביר 100 µL של כל מדגם צלחת 96-ובכן ולמדוד את ספיגת אופטי-450 nm, עם 630 ננומטר כמו אורך גל הפניה.
    6. [O] מגרש timepoints (ציר x) לעומת. ספיגת אופטי של דגימות ביחס פקדים, המציינת פעילות חילוף החומרים בתור פונדקאית עבור תא הכדאיות (ציר y). הפחתת ספיגת יחסית לאורך זמן מרמז cytotoxicity ויראלי (ראה איור 6B).

4. ניתוח פעילות של Immunomodulators מקודד הווירוס מופרש מתאי נגוע

  1. [O] transgene מופרשים ולבודד מוצרים לידי ביטוי התאים הנגועים בנגיף היעד.
    1. [P] תן מפיק וירוס תאים לגדול 70% confluency ב T175 המבחנות.
    2. [P] להסיר את המדיום של תאים, לשטוף פעמיים עם 12 מ של PBS להסיר בסרום. לחסן תאים עם הוירוס MOI של 0.03 ב 12 מ ל בינונית ללא סרום, דגירה-CO של 37 ° C ו- 5%-2 בלילה. החלף בינוני 12 מ ל בינונית ללא סרום טריים.
      1. [ז] עבור וירוסים edmonston ב B, להעביר תאים מ 37 עד 32 ° C לאחר ה 40 עבור עוד 24 שעות של דגירה כדי להקל על זיהום ולמנוע התפוצצותה מוקדמת של syncytia. בהתאם למתח וירוס התקדמות52 ו- syncytia51,, דגירה טמפרטורות ושעות ייתכן לכוונן את התשואה חלבון אופטימלי וטוהר.
    3. [P] בזהירות לאסוף supernatants ללא תאים התולש לפני פרץ syncytia. בצורה אופטימלית, syncytia התפשטו לאורך השכבה כל התא. בריכת supernatants צינורות 50 מ.
      הערה: [P] עבור טיהור יעיל של המוצר transgene, להימנע התפוצצותה של syncytia, למזער את שאריות תאים כאשר לקצור את supernatants של תאים נגועים.
    4. [P] להסיר שאריות תאים תגובת שיקוע על ידי צנטריפוגה למשך 5 דקות ב 2500 x g ו 4 ° C ועובר דרך מסננים מיקרומטר 0.22. בהתאם לנפח הכולל של פילטרט של, זה ניתן לבצע באמצעות מזרק או של משאבת ואקום.
    5. [O] לבודד transgene מוצר באמצעות שיטת טיהור המתאים. לטהר חלבונים עם תג hexa-היסטידין (שלו) על ידי exchange כרומטוגרפיית זיקה באמצעות Ni-נ ספין מיני עמודות38 כפי שמתואר כאן בקצרה (צעדים 4.1.5.1–4.1.5.4).
      הערה: [O] לבצע את כל השלבים מהר על קרח. מראש להירגע buffers וצנטריפוגה מראש מגניב עד 4 ° C.
      1. [O] להכין 100 מ"ל כל מאגר עם PBS, 200 מ"מ נתרן כלוריד, imidazole בריכוזים הסופי של 10 מ מ (כביסה מאגר 1, WB1), 20 מ מ (שטיפת מאגר 2, WB2), 500 מ מ (מאגר • תנאי, EB). להתאים את ה-pH של WB1 ושל WB2 כדי 8.0 ושל EB אל 7.0. בהתאם החלבון כדי להיטהר, ריכוזי imidazole עשוי להיות יותאם.
      2. [O] equilibrate עמודות עם 600 µL של WB1, צנטריפוגה ב x 800 גרם למשך 2 דקות עם מכסה פתוח.
      3. [O] לטעון 600 µL של supernatants מסוננים על גבי עמודות. מאפשרים קשירה של חלבונים שלו מתויג למטריקס עמודה על-ידי צנטריפוגה ב x 200 גרם 5 דקות עם מכסה סגור. ניתן לחזור על טעינת ואיגוד עד סך של 300 µg שלו מתויג חלבון בכל עמודה.
      4. [O] לשטוף שלוש פעמים עם WB1 ופעם עם WB2, או עד הזרימה דרך חסר צבע. להוסיף 600 µL של המאגר, ספין-800 x גרם למשך 2 דקות עם מכסה פתוח.
      5. [O] elute החלבון לתוך צינור טריים על-ידי ביצוע שני צעדים • תנאי עם 300 µL EB, צנטריפוגה למשך 2 דקות ב x 800 גרם.
      6. [O] desalt, להתרכז מוצר באמצעות מסננים צנטריפוגלי בהתאם לגודל המוצר. להוסיף PBS נפח של 15 מ"ל, מסנן באמצעות צנטריפוגה 10 דקות ב x 4,000 גרם. אני חוזר עד טוהר הרצוי, ריכוז מושגת. כדי להגדיל את ריכוז חלבון, להפחית את נפח סופי כדי µL כ 200 על ידי צנטריפוגה למשך 40 דקות ב x 4,000 גרם.
  2. [O] לאשר טוהר והזהות של המוצר.
    1. [O] לכמת את כמות חלבון הכולל מבודד באמצעות מבחני ערכי צבע מוחלטים סטנדרטיים כגון חומצה bicinchoninic (BCA) או ברדפורד assay54,55. [M] ערכי טיפוסי יכול לנוע בין 1-3 µg transgene מוצר לפי תגובת שיקוע מ"ל של תאים נגועים.
    2. [O] על כימות היחסי של חלבון מבודד, להפריד באמצעות סודיום dodecyl סולפט לזיהוי בג'ל (מרחביות-עמוד) ולבצע Coomassie מכתים56.
    3. [O] לאשר את הזהות של המוצרים מטוהרת על ידי immunoblotting בעזרת נוגדנים ספציפיים מיקוד החלבון או תג של פפטיד המשויך57.
    4. [O] לנתח חלבון מחייב ירידה לפרטים באמצעות טכניקות המתאימות העשויות לכלול מקושרים-אנזים immunosorbent assay (אליסה) או לזרום cytometry (ראה איור 7). איגוד התא יכול לאשר שימוש assay תיאר לאחרונה הנפתח מגנטי38.
      הערה: [O] השתמש בפקדי המתאים. תא מבחני הכריכה, לכלול פקדים שלילי עם תאים לא מבטא את המולקולה יישוב (כמו ב איור 9), חלבון ללא פילוח המחליפים (איור 8). בניסויים cytometry זרימה, כוללים חיובי, שלילי בקרות isotype (איור 7).
      1. [O] שיתוף דגירה היעד תאים וחלבונים לבודד כדי לאפשר מחייב. [B] עבור מחייב ניתוח של BTEs לדם ההיקפי תאי תאי (PBMCs) מבודד דם אנושי58, דגירה 2.5 x 106 תאים עם 200 ng של BTE ב µL 100 ל- PBS עם 1% FBS (מאגר מחייב, BB) עבור h 1 על קרח.
      2. [B] שטיפת תאים עם 1 מ"ל של BB להסרת חלבון לא מאוגד. צנטריפוגה ב x 300 גרם במשך 5 דקות, למחוק את תגובת שיקוע ולאחר resuspend צנפה ב 100 µL של BB. מוסיפים נוגדן biotinylated מיקוד החלבון עניין או תג פפטיד משויך, דגירה על קרח למשך 30 דקות. עבור BTEs עם שפעת hemagglutinin (HA) תג, שימוש 100 ננוגרם של אנטי-HA-ביוטין (שיבוט 3F10).
      3. [B] לשטוף תאים פעמיים עם 1 מ"ל של BB, resuspend, µL 80 של BB. להוסיף 20 µL של גרגרי מגנטי מצמידים streptavidin ולאחר תקופת דגירה של 15 דקות ב 4 º C.
      4. [B] השטיפה פעם כדי להסיר עודפי חרוזים, resuspend צנפה ב 500 µL של BB בתוספת 2 מ מ EDTA (מאגר עמודה, CB).
      5. [B] לבודד תאים עם עמודות ו עמדה מגנטי לפי המדריך של הספק.
        1. [B] equilibrate על-ידי מתן µL 500 של CB לעבור דרך העמודה על-ידי כוח הכבידה זרם.
          הערה: [B] העמודה חייבים להתייבש. Pipet בקפידה, דגה המאגרים להימנע בועות.
        2. [B] למקם צינור נקי תחת העמודה ולהחיל התליה תא/חרוז על העמודה. לשטוף את העמודה שלוש פעמים עם 500 µL של CB לכל לשטוף. לאסוף זרימה דרך דגימות של המתלה ושל לפחות כביסה הצעד הראשון בצינור ולאחר מכן לאחסן בקירור.
        3. [B] elute חרוז מכורך תאים נשמרים על ידי השדה המגנטי. לשם כך, הסר את העמודה הדוכן מגנטי, למקמו מעל צינור נקי, להוסיף 1 מ"ל של CB, ודחף במהירות המאגר באמצעות המדור לתוך הצינורית באמצעות פומפה. שמור את הצינורית על קרח.
      6. [B] צנטריפוגה צינורות המכיל דוגמאות זרימה דרך ו • תנאי למשך 20 דקות ב- 16,000 x g ו- 4 ° C עד הצניפה תאים. למחוק את supernatants ואת lyse תאים במאגר assay (ריפה) radioimmunoprecipitation (המוצע: 75 µL). לבצע מרחביות-עמוד56.
      7. [B] immunoblotting באמצעות נוגדן ראשוני מתאימים לבצע. נוגדנים עשויים למקד את המוצר transgene או חלבון תאית (למשל., β-אקטין, איור 8) כדי להעריך BTE-תא מחייב.
  3. [O] להעריך את הפונקציונליות אימונולוגי של immunomodulators מבודדים.
    1. [O] לזהות מבחני הרלוונטי לפי מאפייני immunomodulator מקודד. בנוגע לפעילות immunomodulatory הצפוי, שיטות הערכת התפשטות תאים, הגירה, התבגרות, הפעלה או cytotoxicity ניתן להחיל.
      הערה: [O] התפשטות תאים ניתן לנתח באמצעות תיוג59 CFSE או מכתימים Ki6760. ניסויים Transwell או לשרוט זמינים לנתח תא העברה61. ההבשלה והפעלה של תאים יכול להיות מוערך באמצעות פרוטוקולי מכתימים המתאים עבור סמני בהתאמה. [B] זמינה טכניקות כדי להעריך בתיווך BTE cytotoxicity הסלולר כוללות עכבה מדידות ו כרום לשחרר וזמינותו. אם בחירה וזמינותו שחרור כרום, להתבונן אמצעי בטיחות נאותים בעת טיפול חומר רדיואקטיבי.
    2. [B] בתור חלופה לא-רדיואקטיבי, להלן מתאר בפירוט כיצד להעריך BTE-induced, תאית cytotoxicity על ידי LDH שחרור assay (כפי שתוארה לעיל בקצרה38).
      1. [B] להחליט על תנאים להיבדק במהלך הניסוי (ראה איור 9 כדוגמה). Timepoints (שעות עד ימים), ריכוזי immunomodulator (pg/mL כדי µg/mL), יכולים להיות מגוונים אפקטור אל היעד יחסי תא (E:T) (בין 1:50 50:1, למשל). תמיד הכינו דגימות ב- triplicates.
      2. [B] לכלול דוגמאות ללא חלבון ולשחרר ללא תאים אפקטור, פקדים עבור LDH ספונטנית של סוגי לתא בודד (Tsp ו- Esp), פקד פירוק המרבי תא מטרה (Tmax) עם חומר ניקוי נוסף לפני הבדיקה, מדיום רק שליטה, פקד עוצמת הקול עבור Tmax.
        הערה: [B] נדרש מספר התאים היעד ושעות אינקובציה יכול להשתנות. לבצע מבחן ראשוני פועל ללא תאים אפקטור, immunomodulators כדי לזהות פרמטרים אופטימליים. כוללים Tsp ו Tmax ודוגמאות הפקדים המתאימים כדי להעריך את מספרי הטלפון הנייד שונים ו- timepoints.
      3. [B] בידוד תאי מערכת החיסון אפקטור, למשל על-ידי (צפיפות, הדרגתיות צנטריפוגה של דם אנושי כדי לקבל PBMCs58 ) או שלילי מבחר מאתר T תאים מן העכבר splenocytes62.
      4. [B] זרע היעד תאים על פי שלב 4.3.2 (למשל, 5 x 10³ לכל טוב) לתוך צלחת U-התחתון 96-ובכן.
      5. [B] להוסיף חלבון מבודד בריכוזים הרצויים כדי הדגימות בהתאמה. להוסיף תאים חיסוניים אפקטור היחס הרצוי. להוסיף בינוני הנפח הכולל של µL 100 לכל טוב.
      6. [B] Incubate עבור מסגרת הזמן נקבע צעד 4.3.2, בדרך כלל בין 4 ל- 48 שעות (24 h עבור unstimulated PBMCs ו- h 48 עבור תאי T מאתר טרי מבודדים; פעמים דגירה קצר יכול להגיש בקשה prestimulated תאים חיסוניים), ב- CO 37 ° C ו-5%2.
      7. [B] 45 דקות לפני איסוף הדגימות, להוסיף 10 µL של 10 x פירוק פתרון בארות המכיל Tmax ודוגמאות הפקדים בינונית המתאימה. המשך הדגירה.
      8. [B] ספין למטה תאים ב x 250 g עבור 4 דק 50 להעביר µL של כל תגובת שיקוע על צלחת 96-ובכן שטוח התחתונה. אל תעביר תאים כדי להימנע תא מכורך LDH.
      9. [B] הכנת המצע פתרון על פי היצרן. להוסיף 50 µL מכל קידוח, דגירה-RT בחושך למשך 30 דקות או עד טימקס דגימות אדום עמוק.
      10. [B] להוסיף 50 µL של להפסיק פתרון טוב לכל. להסיר בועות אוויר על ידי צנטריפוגה עבור 1 דקות ב x 4,000 גרם, באופן ידני עם מחט חלולה. למדוד את ספיגת אופטי 490 nm.
      11. [B] לחשב ערכים ספציפיים פירוק % עבור כל דגימה.
        1. [B] לחשב ממוצעים עבור בית פקדים בינוני עם וללא פירוק פתרון. להחסיר ערכים שהושג דגימות ניסיוני ומן Tמקס ופקדי לשחרור ספונטני, בהתאמה. השתמש בערכים אלה תוקנו-רקע לחישובים נוספים.
        2. [B] לחשב ממוצעים עבור מתוקן-רקע Tmax, Tspופקדים Esp . המשוואה הבאה באמצעות ממוצע של ערכים אלה, התשואות האחוז של פירוק ספציפיים עבור כל דגימה:

          Equation 1
        3. [B] להתוות % פירוק ספציפי ערכים לעומת חלבון ריכוז או יחס E:T, להשוות בין דגימות הבקרה ללא פילוח.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

איור 1 מדגימה את מנגנון הפעולה של וירוסי חצבת oncolytic קידוד bispecific תא T engagers. תרשים זרימה המתאר את זרימת העבודה של פרוטוקול זה מוצגת באיור2. איור 3 מראה דוגמה של גנום הוירוס חצבת oncolytic שונה. זה מספק ייצוג חזותי של השינויים מסוים מוחל על חצבת וירוס אנטי הגנום מסוים התכונות של transgenes שנוסף. Syncytia הנוצרות על-ידי וירוס חצבת טיפוסי מתוארים באיור4. הערה הגבוה תא צפיפות-timepoint של קציר החילוץ (A, B), המציין את מספר הנייד עלול להצטמצם כאשר חוזרים על הניסוי. הדגירה טמפרטורות ושעות - עשוי להיות אופטימיזציה עבור passaging בתאי Vero (C, D) כדי להשיג שיפור התפשטות syncytia על פני הלוח. איור 5 מייצג את התוצאה של assay טיטור טיפוסי. איור 6, עקומות גדילה בשלב אחד (א), יחסיות לתאים הכדאיות (ב) לאחר חיסון עם שלא שונתה (MV), קידוד BTE מוצגים וירוסי חצבת oncolytic (MV-H-mCD3xhCD20). בעוד עקומות גדילה של הווקטורים בהשוואה בתאי Vero מופיעים דומים, פעילות lytic של הנגיף קידוד transgene ומהפיתוח הקו תא מאתר הגידול. הנתונים cytometry זרימה של התאים לבטא אנטיגן היעד מודגרות עם BTEs בשעה חמש דילולים שונים מסופק ב איור 7, המציין BTE לכריכה על ידי תאים באופן תלוי-ריכוז. איור 8 מייצג של immunoblot למופת לאחר הנפתח מגנטי של תאים הקשורים BTE. הנפתח עם לא פילוח BTEs (n1, n2) לא נכנע לזיהוי כמויות של תאים, ואילו להקות של השבר • תנאי, הרומז על מצבה העגום של תאים מאוגד, נצפו הכוונת BTE דגימות (t1, t2). בתיווך BTE, מציינים cytotoxicity אנטיגן ספציפי, תלויית ריכוז היעד של תאי T מאתר assay שחרור נציג LDH באיור9.

Figure 1
איור 1 : מנגנון הפעולה של וירוסי חצבת oncolytic קידוד engager תא T (MV-BTE) bispecific. זיהום של תא הגידול (נגוע: אפור, נגוע: תכלת) עם MV-BTE ואחריו שכפול ויראלי, התפשטה ברחבי הגידול, וכתוצאה מכך גידול התא פירוק ואת החיסון גירוי. במקביל, BTEs [המורכב שתי שרשראות יחיד נגזר נוגדנים מיקוד CD3 על תאי T (צהוב) ו אנטיגן פני שטח הגידול (כחול)] המיוצר, מופרש באופן מקומי על ידי תאים הנגועים בנגיף. Cross-linking בתיווך BTE עם תאים סרטניים גורם ההפעלה של נח, polyclonal T תאים, וכתוצאה מכך המשך הגידול תא הרג. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : תרשים זרימה המתאר את זרימת העבודה של מעצב, יוצר הערכת הרומן וקטורים ויראלי קידוד immunomodulatory transgenes. שלבים 1 עד 4 לשקף את הסעיפים המתאימים של הפרוטוקול. נקודות תבליט מצביעים על שיקולים רלוונטיים substeps. בשל אופיו הניסיוני של ההליך, התאמות או ליטושים יכול להיות הכרחי בשלב כלשהו של זרימת העבודה. בנוסף, הממצאים ניסיוני יכול להוביל היפותזה חדשה וזה לעודד התפתחות של וקטורים נוסף או טיפולים שילוב. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : ייצוג סכמטי של גנום הוירוס חצבת. משופרת חלבון פלואורסצנטי ירוק (eGFP) מקודד ביחידה שעתוק נוספים במורד הזרם של הרצף מנהיג (ld). N P, M, F, H, L לייעד גנים קידוד של חצבת וירוס חלבונים מבניים נוקלאופרוטאין P חלבון, מטריקס חלבון, חלבון כימרי, חלבון hemagglutinin, חלבון גדולה (פולימראז), בהתאמה, אשר מתבטאים באופן שונה כמו דמיינו מעל. Transgene engager (BTE) תא T bispecific מוכנס לתוך שעתוק נוספים יחידת (ATU) במורד הזרם של מסגרת קריאה פתוחה H . Transgene מקודד של פפטיד מנהיג Igκ הפרשת יעיל, כמו גם שפעת hemagglutinin (HA) ותגים חלבון hexa-היסטידין (שלו) זיהוי, טיהור. גנים קידוד משתנה כבד (VH), שרשרת אור (VL) תחומים של נוגדנים מיקוד CD3 ו CD20, בהתאמה, הם מחוברים באמצעות פפטיד מקשר רצפים המכיל גליצין (G), ומשקעים סרין (S). רצף transgene קודם רצף קוזאק. במורד הזרם את הקוד באזור, נוקלאוטידים נוספים נכללו exemplarily לקיים הכלל של שישה. בקלטת הוספה משני צדדיה שני אתרים הגבלת הפעלת הכניסה לתוך ATU בהתאמה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4 : Syncytia הנוצרות על-ידי וירוס חצבת. (A, B) Vero התאים היו transfected עם cDNA על לעזרתו של וירוסי חצבת רקומביננטי קידוד משופרת חלבון פלואורסצנטי ירוק (eGFP) engager תא T bispecific (BTE) מיקוד מאתר CD3 ו CD20 האנושית. הנוכחות של syncytium פלורסנט (החצים הלבנים) מציין חילוץ מוצלח של וירוס מדבק. (C, D) וירוסי חצבת שנקטפו לאחר החילוץ, הופץ בתאי Vero (קטע 1). Syncytia גדול יצרו, כבר מתחילים. להיכנס פרץ (חיצים צהובים). תמונות נרכשו על ידי ניגודיות שלב (B, D), מיקרוסקופיה קרינה פלואורסצנטית לאחר עירור עבור ms 80 (א) ו- ms 100 (ג). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5 : נציג תוצאת assay טיטור. טיטור של אצווה השלישי-המעבר של MV-H-mCD3xhCD20, קידוד BTE oncolytic חצבת וירוס, בתאי Vero. לדילול טורי 10-fold בוצע על צלחת 96-ובכן, החל µL 10 של וירוס השעיה בתוך כל טוב של עמודה 1 syncytia לא היו גלויים בעמודה 7, כמצוין על-ידי אפסים. על דילול הנמוך הבא של וירוסים ההשעיה בעמודה 6, ממוצע של 6 syncytia לכל טוב נצפתה, וכתוצאה מכך כייל הסופי של 6 x 107 תא זיהומיות יחידות (ciu לקדם) לכל mL וירוסים ההשעיה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6 : שכפול קינטיקה ופעילות lytic של וירוסי חצבת רקומביננטי. (א) צעד אחד עקומות גדילה נוצרו לאחר ההדבקה של תאים Vero עם וירוס חצבת oncolytic שלא שונתה (MV) או וירוס חצבת קידוד engager תא T bispecific (MV-H-mCD3xhCD20)-MOI 1. Titers צאצאי ויראלי הוערכו ב- timepoints המיועד לאחר ההדבקה, המציין קינטיקה שכפול וירוס דומה. האמצעים סטיות תקן של שמונה דגימות (טכני ארבע משכפל כל אחד שני ביולוגי משכפל לכל timepoint) מוצגים. תא (B) הכדאיות הוערכה על סרטן המעי הגס מאתר MC38 תאים stably ביטוי אנושי carcinoembryonic אנטיגן של הקולטן MV CD46 (MC38-CEA-CD46) לאחר חיסון עם היחידה בינונית (מעושה) או המצוין לווירוסים MOI של 1. XTT תא הכדאיות assay בוצעה ב timepoints המצוין. צמצום תא הכדאיות נצפתה ב timepoints מוקדם יותר עבור וקטור שלא שונתה. ערכים של למעלה מ 100%, כפי שמחושבת עבור MV-H-mCD3xhCD20-timepoint 12 שעות, הם נצפו לעתים קרובות זמן קצר לאחר זיהום, אשר יכול להיות בגלל הלחץ הסלולר או גורמים נגזר תא להציג ההשעיה וירוס. ערכים רשע פלוס סטיות תקן של משכפל טכני 3 מוצגים עבור כל אחד timepoint. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 7
איור 7 : היעד מחייב תא על-ידי bispecific תא T engagers (BTEs) הביע של חצבת תאים הנגועים בנגיף. האדם מנטל לימפומה התא בתאי endogenously לבטא CD20 (Granta-519) היו מודגרות עם האדם אימונוגלובולינים G כדי לחסום קולטנים Fc, ואחריו הדגירה עם 2, 4, 6, 8 או 10 µL (A) של פתרון BTE מטוהרים mCD3xhCD20, בהתאמה. תאים BTE מכורך אותרו באמצעות phycoerythrin (PE)-נוגדן מצומדת מיקוד הקשורים BTE HA-התג. אחוזי תאים מוכתם בקורלציה עם BTE ריכוזים. (B) שולט על סלקטיביות וספציפיות של האיגוד. המוצגים כאן הם פקדים ניסוי עצמאית, כולל דוגמא אחת כל התאים לא מתפשט עם BTE אבל עם פילוח BTE הנוגדן בלבד (פקד עבור איגוד לא ספציפי של נוגדנים לתאי) או עם BTE הידוע כדי לאגד התאים עניין , ואחריו הדגירה עם הנוגדן פילוח BTE (בקרת חיובי) או נוגדן isotype. אם הוא זמין, תאים isogenic לא מבטא את אנטיגן מטרה להתמקד עשוי לשמש כדי להמשיך ולאמת איגוד סלקטיביות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 8
איור 8 : תאי תאי (PBMCs) מחוייב חצבת מקודד וירוס BTEs הדם הנפתח מגנטי של ציוד היקפי אנושי. התאים היו מודגרות בשתי קבוצות שונות של האדם תא T פילוח (t1, t2) או פקד ללא פילוח BTEs (n1, n2), בהתאמה. תאים BTE מכורך היו נשמרים על עמודות באמצעות beads מגנטי, מגורען, lysed. Β-אקטין ב lysates זוהה על-ידי immunoblotting. עוצמות של להקות הדגימות • תנאי מצביעים על איגוד BTE תאים יחסיות. זרימה דרך דגימות לאשר נוכחות של תאים כל הדגימות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 9
איור 9 : פעילות ציטוטוקסיות של חצבת וירוס מקודד BTEs. היעד תאים סרטניים (5 x 10³ B16-CD20-CD46 תאים לכל טוב) היו מודגרות עם תאי T מאתר ביחס של 1:50. BTEs בעבר מטוהרת מכל תגובת שיקוע של MV H-mCD3xhCD20-תאים הנגועים נוספו בריכוזים המצוין. פירוק היחסי של תאי היעד היה מוערך על ידי LDH שחרור assay לאחר ה 48 תאים חסר BTE את היעד אנטיגן (B16-CD46) שימש הפניה להעריך cytotoxicity אנטיגן ספציפי. האמצעים פלוס סטיות תקן של משכפל טכני 3 עבור דגימה מוצגים. התאים לבטא אנטיגן היעד היו במיוחד lysed באופן תלוי-ריכוז BTE. טוהר BTE המוצר והיעד אנטיגן ביטוי רמות השפעה תא ההרג. בדוגמה הנוכחית, הרג תאים מסוים 15% הושג ב ריכוז BTE יחסית גבוה של 1 µg/mL. זהו ערך אופייני עבור התקנה ניסיוני עם זמן דגירה שותף פעמים ותנאים התרבות שיוצרת תא T. הגדרות אחרות, למעלה ל- 60% הרג ספציפי הושג באמצעות BTEs מכל MV נגוע supernatants, להגיע מישור בריכוזים BTE של 100 ננוגרם למ"ל ו גבוה38. זה מצביע על כך, counter-intuitively, גבול assay הזה הוא פחות מ- 100% הרג ספציפיים, אשר יכולה להיות מוסברת על ידי קינטיקה גידול שונים בפקדיםמקסימום T לעומת דגימות תרבות משותפת. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolytic חיסוני (כלומר., שעות נוספות בשילוב עם immunomodulation) טומן בחובו הבטחה גדולה לטיפול בסרטן, בדרישה נוספת פיתוח ואופטימיזציה של וירוסים oncolytic קידוד חלבונים immunomodulatory. פרוטוקול זה מתאר שיטות כדי ליצור ולאמת כזה וקטורים עבור בדיקות עוקבות הרלוונטיים במודלים פרה, תרגום קליניים עתידיים פוטנציאל הריפוי נגד סרטן.

רבים פלטפורמות וירוס oncolytic שונים עם יתרונות ברורים הם זמינים63. בנוסף ירידה לפרטים סרטן, וקטור הבטיחות, דרישות לייצור, יעילות פירוק תאים סרטניים, אינדוקציה של תגובות חיסוניות, שיבוט קיבולת היא מפתח עבור vectorization מוצלחת של immunomodulators באמצעות oncolytic ספציפיים. למרבה הצער, ההשוואה הישירה של OVs שונים חסרים כיום, צריך להיות נרדף על מנת לזהות אפשרויות הטיפול האופטימלי עבור חולים בודדים. זה ניתן להקל על-ידי קידום פיתוח רציונאלי ובדיקות של וקטורים קידוד transgene הרומן, כפי שהודגם כאן עבור MV BTE. בהתחשב המועילות של MV (קרי, oncotropism, בטיחות, fusogenicity, immunogenicity, הכדאיות של ההנדסה הגנטית) פרוטוקול זה מתמקד וקטור oncolytic הזה, אשר ניתן להכליל עבור OV אחרים, במיוחד paramyxoviruses .

עבור בחירה הגיונית של immunomodulators שעשוי להיות רלוונטי כמו המועמד transgenes (שלב 1.1.1), הבנה מעמיקה של מחזור סרטן-חסינות הוא חיוני, ביצוע מחקר שיטתי ספרות הכרחית. בנוסף, מסכי בקנה מידה גדול, אבל יקר, יכול להוכיח יקר כדי לזהות מטרות הרומן (ראה למשל, פאטל ואח41).

לעיצוב של OVs רקומביננטי, פרופילי ביטוי הרצוי צריך להיחשב. במקרה של וירוסי RNA, ביטוי גנים הוא בשליטת על רמת ה-RNA פולימראז בהתאמה. בעת עיצוב transgene קלטות להכנסה לתוך הגנום MV (שלב 1.1.2), הימנעות רצפים הדומות MV פולימראז ג'ין התחל/הפסק אותות ו- RNA בעקבות החוק של שש ועריכה אתרי חיוני לפיתוח וקטור מוצלחת. יתר על כן, מקבילים רמות הביטוי של גנים paramyxovirus מיקום בתוך הגנום, הנובע הדרגתי הביטוי43. באופן כללי, מיקום transgene במצב במעלה מגבירה את הביטוי על חשבון שכפול מופחת. עם זאת, פרמטרים אלה תלויים גם על גודל, מבנה, או על רצף transgene בהתאמה. כתוצאה מכך, מגבלה של המתודולוגיה המתוארת בעלון פרוטוקול זה הוא הצורך לבדיקה אמפירית של עיצובים חדשניים וקטור. במקרים ספציפיים, התאמות רצף transgene או מיקום עשוי להיות נחוץ להשיג את המאפיינים הרצויים וקטור (איור 2). השוואה שיטתית של עמדות שונות עבור מחסום נוגדן מוסיף הראה תוצאות אופטימליות עבור H- ATU (נתונים שלא פורסמו). כמו BTE מוסיף יש מאפיינים דומים (גודל של אימונוגלובולינים תחומים), וקטורים MV-BTE היו משובטים באנלוגיה38.

חילוץ זיהומיות חלקיקי וירוס cDNA (שלב 2.1) עשוי לדרוש מספר נסיונות עבור כמה מבנים. התאמת מספרי הטלפון הנייד, באפשרותך למטב את הדחיסות תא syncytia גיבוש. בעוד צפיפות מסוימת הוא הכרחי עבור כפולה לתא יעיל ו היתוך של קרום התא, סימן דיכוי מפחית שכפול ויראלי. עוד יותר, ייתכן מספר החלקיקים זיהומיות לא יספיק לגרום תאים גלויים פיוז'ן. עם זאת, כמו וירוסים יכול להיות נוכח היעדר syncytia, חילוץ יכול בכל זאת להיות שנקטפו ודוגמאות מועברים לתאים מפיק טריים עבור הפצת פוטנציאליים. תרביות תאים לא יעיל עקב איכות ירודה של ה-DNA או תרביות תאים שאינם מתאימים או מפורק ריאגנטים לייצג בעיות טיפוסיות, קל יחסית להעריך, לתקן על-ידי יצירת חדש ההכנות DNA בדיקות נוגדנים שונים, בהתאמה.

הפצת וירוסים מוצלחות (שלב 2.2) תלויה בצורה מכרעת התנאים לקביעת שכפול ויראלי, פירוק תאים. באמצעות מספרי מעבר נמוך של תאים מפיק מומלץ, תאים נגועים צריך להיבדק באופן קבוע על התקדמות syncytia. התאמת מספרי הטלפון הנייד, טמפרטורות ושעות הדגירה עשוי להידרש כדי לאזן את התפשטות תאים להפצת vs. .

מגבלה קריטית של השיטה המתוארת של וירוס הייצור הוא הכנת וירוס המתלים של lysates תא גולמי. החוקרים צריכים להיות מודעים לעובדה כי ההשעיה וירוס מכיל גורמים הסלולר. חלקיקי וירוס יכול להיות מרוכזת באמצעות דחיסות צבע/סוכרוז כרית ultracentrifugation על חשבון המספר הכולל של חלקיקים זיהומיות גם פוטנציאל הגדלת ריכוזים של שרידים הסלולר. הוירוס יכול להיות גם מרוכזת של התא הנגוע supernatants, הגדלת טוהר אך להפחית את התשואה הכוללת. GMP, בקנה מידה גדול ייצור של paramyxoviruses מבוצעת בדרך כלל באמצעות שכבות מרובות של תאים מפיק נזרע על נימה נטו בריאקטורים עבור כייל מוגברת תשואות63. ניטור מדויק החלפת המדיה רציפה, סרום ללא תנאים, שלבי סינון הבאים להבטיח טוהר גבוהה של וירוס המיוצר.

הערכה של נגיפי titers (שלבים 2.3 ו- 3.1) באמצעות syncytia תיאר ספירת שיטת אינו מדויק, אבל זה קל לבצע מדויקים דיים בעת שימוש נאותה מספרים הטכניים ושכפול של. בעת הערכת בתיווך OV cytotoxicity (שלב 3.2), מגבלות של מבחני זמין צריך להיחשב. מבחני מטבולית אינם מבחינים בין תופעות cytostatic cytolytic של טיפולים ניסיוניים. כדי למדוד את cytolysis, ניתן לבצע assay שחרור לקטט דהידרוגנאז. עם זאת, שני סוגי מבחני עשויה להיות מושפעת התוכן של וירוס גלמי lysates תא גולמי (איור 6).

בידוד של חלבונים על ידי תאים הנגועים בנגיף (שלב 4.1) יכול להשתנות באופן משמעותי התשואה וטוהר, בהתאם transgene בהתאמה וירוס בשימוש, כמו גם על דיוק טכני. לפיכך, בקרת איכות של חלבון טיהור חיונית הערכת תוצאות ניסויית קשורים.

כמו תיאור ממצה של פוטנציאל מבחני פונקציונלי המכסים מגוון רחב של אפשריות immunomodulators מעבר להיקף של פרסום זה, פרוטוקול זה מתמקד ex-vivo מתודולוגיה למדידת תאית cytotoxicity (שלב 4.3). Cytotoxicity הסלולר, בעיקר על ידי תאי CD8 + T, הוא מתווך חשוב של שליטה הגידול חיסונית מוצלחת immunotherapies64. יש לזה השלכות חשובות על גישות חיסוני באמצעות נוגדנים כדי לשפר את תגובות מערכת החיסון אנטי הגידול באופן כללי, bispecific תא T engagers בפרט. הביטוי BTE המקומי על-ידי oncolytic וקטורים הניב תוצאות מבטיחות במספר מחקרים פרה, כולל ה-RNA38 ו- DNA וירוסים65,66,67,68.

עקב הגומלין המורכבים של הגידול, וירוס, transgene מוצר, המערכת החיסונית המארחת היצורים החיים, אימות של קידוד immunomodulator oncolytic המומנט בתרבות תא כפי שמתואר כאן אינה מספיקה כדי לחזות תוצאות טיפוליות. חשוב, ההערכה מבודד המוצע של פונקציות וקטור, immunomodulator, בהתאמה, הוא חיוני עבור הוכחת הרעיון אך נכשל לתאר את פוטנציאל סינרגיה ורשת לאינטרקציות מורכבות בתוך microenvironment הגידול. בדיקות רעילות וגם יעילות הרלוונטיים במודלים ויוו חיונית עוד פיתוח של הרומן וקטור recombinant בונה אבל אינה מושגת בקלות. בטיחות אימונולוגי מנוטר בקביעות פרימטים אנושיות כגון קופי מקוק, העכבר מודלים משמשים biodistribution, יעילות מנתח20,69. עם זאת, רבים של מודלים אלה יש מגבלות לגבי ביטוי וירוס רצפטורים ברקמות הפונדקאי, מתירנות המארח ולאחר כמה דיו רק לחקות הגומלין המורכבים של OV, גידול microenvironment את המערכת החיסונית. לפיכך, מדוקדקת של מודלים המתאימים הוא חובה.

טיפול MV-BTE בעבר יוערכו xenograft האנושי, העכבר syngeneic מודלים. אין transgene BTE המוצרים היו לזיהוי בנסיוב של עכברים שטופלו MV קידוד BTE38, המציין מניעה מוצלחת של חשיפה מערכתית אפילו בלי לקדם הנחתה של זן החיסון נגד וירוס באופן טבעי oncotropic. ביטוי מקומי חיונית immunomodulators מקודד OV אשר רעילים כאשר ניתנת מערכתית. במידת הצורך, ירידה לפרטים הגידול יכול להיות מוגברת על ידי מיקוד מחדש לתא השטח סמנים של בחירה-70,-71,-72 מבוסס-microRNA מבטל את מכוונת (74 73,oncotropism משופרת נבדקו על ידי רואיז וראסל75.) שינויים נוספים עשוי להיות מוצג בפני למטב וקטורים לשימושים ספציפיים טיפולית (נבדקה על ידי Miest ו- Cattaneo76), לרבות החדרת transgenes למטרות אבחון77,78 או prodrug המרה כדי למזער את תופעות הלוואי של כימותרפיה79,80הקדמה של בטיחות מתגים81, וקביעת יעד של הגידול משתית או להערכת (לדוגמה, באמצעות נוגדנים bispecific82).

מלבד השינוי הגנטי של וקטור ויראלי, משטרי בשילוב עם chimeric אנטיגן קולטן (מכונית) T cell להעביר83, כימותרפיה84,85,86, או הקרנות87, 88 , 89 נוספת להגדיל הרפרטואר של עבודה בשעות נוספות. כפי MV חסינות נפוצה מאוד, אסטרטגיות לעקוף נוגדן ניטרול פותחו, כולל החלפת מעטפה glycoproteins לאלו של paramyxoviruses קשורים90, בציפוי פולימר של חלקיקים, באמצעות נשאים תא ל לספק וירוסים, ואת ארעי החיסוני (נבדקה על ידי ראסל et al.6). פיתוח נוסף של משטרי חיסוני OV מתקדם דורש בדיקה של הבטיחות והיעילות הטיפולית במודלים של בעלי חיים המתאימים, עם חומר המטופל, ובסופו של דבר, בניסויים קליניים מבוקרים.

לאור שפע של צירופים אפשריים, בדיקה מקיפה הוא לא ריאלי. מודלים מתמטיים יכולים לסייע תעדוף של משטרי שילוב פוטנציאליים וכן שלהם בהתאמה מינון ותזמון מאת לניבוי תוצאות הטיפול סיליקו (נבדקה על ידי סנטיאגו ואח91). כאשר בדיקות efficacies של הרומן, וקטורים מעוצב בצורה רציונלית, קול המלווה המחקר translational הוא אינסטרומנטלי הבנה מעמיקה יותר של תהליכים virological ו המשמש כבסיס. דבר זה חיוני לדור של מודלים המתאימים, מידע על מטרות אפשריות נוספות, וקידום בשטח באופן כללי. לסיכום, ממקור ראשון תובנה שיטות רלוונטיות של וקטור, דור, ועיצוב אפיון במקצוע הזה להאיץ פיתוח ותמיכה חקר הריפוי לתרגום קליניים עתידיים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Engeland לספירה מופיע בתור שותף הממציא של וירוסים RNA לגבי פטנטים עבור סרטן Immunovirotherapy בבעלות אוניברסיטת היידלברג. J.P.W. Heidbuechel אין לחשוף.

Acknowledgments

שיטות אלה הוקמו בקבוצה Virotherapy בראשות פרופסור ד ר ד ר גיא Ungerechts במרכז הלאומי למחלות הגידול בהיידלברג. . אנחנו חבים לו ואת כל חברי צוות מעבדה, במיוחד ד ר טוביאס שפק, ד ר Rūta Veinalde, ג'ודית פורסטר, בירגיט Hoyler ו ג'סיקה אלברט. עבודה זו נתמכה על ידי עוד Kröner-Fresenius-Stiftung (גרנט 2015_A78 כדי Engeland לספירה) של קרן המדע הלאומית הגרמנית (DFG, להעניק EN 1119/2-1 לספירה Engeland). J.P.W. Heidbuechel מקבל מלגה על ידי הלמהולץ הבינלאומי המדרשה לחקר הסרטן.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics