Paramyxoviruses para imunomodulação Tumor-alvo: Design e avaliação Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Este protocolo descreve um fluxo de trabalho detalhado para a geração e ex vivo caracterização de vírus Oncolíticos para expressão de imunomoduladores, usando vírus de sarampo codificação participantes de célula T bispecific como exemplo. Aplicação e adaptação para outras plataformas de vetor e transgenes irão acelerar o desenvolvimento do romance immunovirotherapeutics de tradução clínica.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bem sucedida imunoterapia tem potencial para alcançar controle de tumor a longo prazo. Apesar dos sucessos clínicos recentes, ainda há uma necessidade urgente de terapias seguras e eficazes, adaptados para imune perfis individuais do tumor. Vírus Oncolíticos permitem a indução de respostas imunes de anti-tumor, bem como a expressão do gene tumor restrito. Este protocolo descreve a geração e ex vivo análise de imunomoduladores Oncolíticos vetores. Enfocando o vírus de sarampo vacina codificação participantes de célula T bispecific como exemplo, a metodologia geral pode ser adaptada para outras espécies de vírus e transgenes. O fluxo de trabalho apresentado inclui o projeto, clonagem, resgate e propagação de vírus recombinantes. Ensaios para analisar a cinética de replicação e atividade lítica do vetor, bem como a funcionalidade do imunomodulador isolado ex vivo são incluídos, facilitando assim a geração de novos agentes para o desenvolvimento em modelos pré-clínicos e, finalmente, Tradução clínica.

Introduction

Vírus Oncolíticos (OVs) estão sendo desenvolvidos como terapêutica anticâncer que especificamente replicar dentro e matar as células do tumor, deixando os tecidos saudáveis intactas. Tornou-se comum de entendimento que virotherapy Oncolíticos (OVT), na maioria dos casos, não depende unicamente da lise completa tumor por replicação eficiente e propagação do vírus, mas requer mecanismos adicionais de ação para o sucesso do tratamento, incluindo vascular e do estroma direcionamento e, importante, estimulação imune1,2,3,4. Enquanto muitos estudos iniciais de OV usado sem modificações de vírus, pesquisa atual lucrou com um biológico melhorado compreensão, biobancos de vírus que potencialmente contêm romance OVs e as possibilidades oferecidas pela engenharia genética para criar OV avançado plataformas de6,5,7.

Tendo em conta o recente sucesso da imunoterapia, imunomodulador transgenes são de particular interesse sobre a engenharia genética de OVs. Expressão alvo desses produtos do gene por células tumorais OV infectadas reduz toxicidade comparada a administração sistémica. Segmentação é conseguido usando vírus com oncoselectivity inerente ou modificando o tropismo viral8. Imunomodulação local aprimora os mecanismos de anti-tumor multi-facetada de OVT. Além disso, esta estratégia é instrumental em interrogar a interação entre vírus, células tumorais e o sistema imunológico do hospedeiro. Para este fim, este protocolo fornece um fluxo de trabalho aplicável e ajustável para projetar, clonar, resgatar, propagar e validar Oncolíticos vetores de paramixovírus (especificamente vírus do sarampo) codificação tais transgenes.

Modulação da resposta imune pode ser alcançada por uma grande variedade de produtos de transgene como alvo diferentes passos do câncer-imunidade ciclo9, incluindo a reforçar o reconhecimento do antígeno de tumor [por exemplo, antígenos tumor-associado (TAAs) ou indutores de complexo de histocompatibilidade (MHC) classe I moléculas] ao longo de maturação de células dendríticas de apoio para apresentação de antigénios eficiente (citocinas); recrutamento e ativação de células imunes desejadas como citotóxicas e auxiliar T células [quimiocinas, participantes de célula T de bispecific (BTEs)]; segmentação supressivas células tais como pilhas de T reguladoras, células supressoras mieloide-derivado, tumor-associado de macrófagos e fibroblastos associada a câncer (anticorpos, BTEs, citocinas); e prevenção da inibição de células efetoras e exaustão (inibidores de ponto de verificação). Assim, uma infinidade de agentes biológicos está disponível. Avaliação de tais vírus codificado imunomoduladores em relação a eficácia terapêutica e as sinergias possíveis, bem como a compreensão dos respectivos mecanismos é necessária melhorar a terapia do câncer.

Vírus de RNA sentido negativo single-stranded da família Paramyxoviridae caracterizam-se por várias características favoráveis ao seu uso como Oncolíticos vetores. Estes incluem um oncotropism natural, grande capacidade genômica de transgenes (mais de 5KB)10,11, eficiente propagação incluindo formação de citoplasma e alta imunogenicidade12. Portanto, plataformas OV baseadas na cinomose vírus13, caxumba vírus14, doença de Newcastle vírus15, vírus Sendai16,17, simian virus 518e Tupaia paramixovírus19 têm sido desenvolvidos. Viva mais proeminente, vacina de vírus atenuado do sarampo cepas (MV) progrediram em desenvolvimento pré-clínico e clínico20,21. Estas estirpes de vírus têm sido utilizados há décadas para a imunização de rotina com uma segurança excelente registro22. Além disso, não há nenhum risco de mutagênese insercional devido a replicação estritamente citosólica do paramyxoviruses. Um sistema de genética reversa versátil baseado em antigenômica do cDNA que permite a inserção dos transgenes em unidades adicionais de transcrição (ADO) é disponível11,23,24. Vetores de MV codificação-iodeto de sódio symporter (MV-NIS) para geração de imagens e radioterapia ou antígeno carcinoembryonic solúvel (MV-CEA) como um marcador substituto para expressão gênica viral atualmente estão sendo avaliados em ensaios clínicos (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 e NCT00408590). Administração de segura tenha sido confirmada e foram notificados casos de eficácia anti-tumoral em anteriores estudos25,26,,27,28,29, 30 (revisado por Msaouel et al.31), abrindo caminho para o vírus do sarampo Oncolíticos adicionais que foram desenvolvidos e testados pré-clínicos. MV codificação immunomodulatory moléculas alvo diversas etapas do ciclo de câncer-imunidade têm sido mostradas para atrasar o crescimento do tumor e/ou prolongar a sobrevivência em ratos, com evidências de eficácia imune-mediada e a longo prazo memória imunológica protetora em syngeneic modelos do rato. Vector-codificado transgenes incluem colônia de Granulócito-macrófago factor (GM-CSF)32,33, H. pylori neutrófilos-ativando proteína34, inibidores de checkpoint imune35, Interleucina-12 (IL-12)36, TAAs37e BTEs38, que um antígeno de superfície do tumor com CD3 cross-link e, assim, induzir a atividade antitumoral por pilhas de T policlonais, independentemente do receptor de células T especificidade e estimulação co ( A Figura 1). Os resultados promissores pré-clínicos obtidos para essas construções ainda mais esforços translacional de demanda.

Talimogene laherparepvec (T-VEC), um tipo vírus de herpes simples codificação GM-CSF, é o único Oncolíticos terapêutico aprovado pelo Estados Unidos, Food e Drug Administration (FDA) e Agência Europeia de medicamentos (EMA). O estudo de fase III levando a aprovações no final 2015 não mostrou apenas eficácia no local da injeção intra-tumoral, mas também efeitos de abscopal (ou seja, a remissão das lesões não injectada) melanoma avançado39. T-VEC entrou desde ensaios adicionais para aplicação em outras entidades do tumor (por exemplo, câncer de pele não-melanoma de, , NCT03458117; câncer de pâncreas, NCT03086642) e para avaliação de terapias de combinação, especialmente com o posto de controle imune inibidores (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 e Ribas et al.40).

Isso demonstra não apenas o potencial da imunoterapia Oncolíticos, mas também a necessidade de mais pesquisas identificar combinações superiores de OVT e imunomodulação. Projeto racional de vetores adicionais e seu desenvolvimento para testes pré-clínicos é a chave para esta empresa. Isto também vai avançar a compreensão dos mecanismos subjacentes e tem implicações para a progressão para o tratamento de câncer mais personalizado. Para este fim, esta publicação apresenta a metodologia para a modificação e o desenvolvimento do paramyxoviruses para imunoterapia específica e, mais especificamente, do vírus de sarampo Oncolíticos codificação de célula T-engajar-se anticorpos (Figura 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: [O], [P] e [M] indicar aplicáveis às subseções: OVs, em geral, (a maioria) paramyxoviruses ou MV, respectivamente. [B] indica seções específicas para BTE transgenes.

1 clonagem de Transgenes imunomodulador-codificação em vetores de vírus do sarampo

  1. [O] design Insira a sequência.
    1. [O] decidir sobre um imunomodulador de interesse com base na pesquisa de literatura ou em dados exploratórios como telas genética41 e derivam a sequência de cDNA relevantes de bancos de dados apropriados como GenBank, o arquivo de Nucleotide Europeu, ou o sistema de informação de Imunogenética internacional (IMGT).
    2. [O] Adicione recursos adicionais para a sequência do transgene (Figura 3). Uma sequência de Kozak anterior e otimização de códon espécie-específicos podem realçar a expressão. Sequências de sinal são necessárias para secreção. Incluem as sequências que codificam etiquetas de N e / ou C-terminal da proteína para a deteção e a purificação de42. Inclua sites de restrição para inserção em vetor.
      Nota: [M] unidades de transcrição adicionais (ADO) abrigando gene de polimerase MV começam e parar sinais são necessários para a expressão do transgene de genomas de MV recombinantes. Vetores de apropriado do cDNA antigenômica, controlados pelo CMV promotores e contendo ADO com sítios de restrição exclusiva para introdução de transgenes sentido positivo em posições definidas, foram desenvolvidos anteriormente11. [P] adequado posicionamento do transgene é crucial, como isso afeta a expressão viral de replicação e transgene devido o gradiente de expressão típico para paramyxoviruses43. Introdução em uma ATU perto da extremidade 3' do anti-genoma (i. e., na posição de líder ou a jusante do gene P ) geralmente resulta na expressão do transgene alta ao custo reduzida replicação viral. Aumento da replicação e menores níveis de expressão do transgene podem ser esperados quando usando o ATU a jusante do gene H . Empacotamento do genoma de vários paramyxoviruses, incluindo o vírus do sarampo, requer a ligação de seis nucleotídeos por cada de proteína do nucleocapsídeo44. Para inserção dos transgenes em tais vírus, certifique-se de que o número de nucleotídeos do genoma completo será divisível por 6. Isto também é referido como "regra de seis"45,46. Se necessário, inclua nucleotides adicionais na inserção (montante da sequência Kozak ou a jusante do codão stop) sem introduzir mudanças de quadro ou códons de parada prematura. [M] Evite sequências particulares no transgene que são semelhantes ao início de gene MV (AGGRNCMARGW) e parar os sinais (RTTAWANAAAA) e edição (AAAAAGGG) de sequências de RNA. Tais sequências de consenso foram publicadas (por exemplo, veja parques et al.47).
    3. [O] compra do oligonucleotide da sequência desejada ou monte de sequências disponíveis usando o padrão de clonagem molecular48.
      Nota: [O] para amplificação por PCR do transgene, desenha uma cartilha para a frente, incluindo o site de restrição de montante e os nucleotídeos de 15-20 primeiros de inserção e um primer reverso, incluindo os últimos 15-20 nucleotídeos da inserção seguidos a restrição a jusante local.
  2. [O] clone inserir DNA codificação do genoma viral (anti-).
    1. [O] clone a inserção em vetores de DNA ou anti-genomas de DNA de vírus de RNA por padrão molecular clonagem técnicas48 (ou seja,, enzimática restrição seguida pela ligadura de DNA).
      1. [O] Evite re-ligadura do vetor usando sites de restrição não-compatível ou por fosforilação de antes da ligadura.
      2. [O] isole o produto ligadura por eletroforese em gel de agarose e gel de subsequente purificação usando kits comercialmente disponíveis. Em geral, eficiência optimal da ligadura é alcançada em uma proporção de 3:1 molar de inserção de vector.
    2. [O] transformar o produto de ligadura em bactérias competentes adequado para recuperação eficiente de grandes plasmídeos (ou seja,, realizar o choque térmico de Escherichia coli49) e identificar clones bacterianos, abrigando o DNA correto pela colônia PCR50 .
    3. [O] isolar amplificado DNA de um único clone bacteriano usando comercialmente disponíveis kits de preparação de DNA. Confirmar a integridade genômica de digest de controle com enzimas de restrição apropriadas (por exemplo,, HindIII para genomas MV [M]). Confirme a inserção correta e integridade do transgene por sequenciamento.
      Nota: [M] para transgenes inseridos no MV H- ATU, executar Sanger sequenciando com os seguintes primers: H-9018 [para a frente da primeira demão, liga a posição do genoma de MV 9018 no H aberto lendo quadro (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (inversa da primeira demão, liga a posição de genoma MV 9249 no ORF L ): 5' CAGATAGCGAGTCCATAACGG 3'.

2. resgatando partículas de vírus de sarampo recombinante codificação imunomoduladores

  1. [O] gere partículas virais recombinantes do (anti-) genômica DNA através de transfeccao de células de produtor de vírus de acordo com o protocolo padrão para o respectivo vírus. Siga as orientações para trabalhar sob condições estéreis. Cultura de células sob capas, nomeadamente execute todas as etapas que envolvem o vírus em gabinetes de segurança biológica classe II.
    1. [M] para resgate de vírus de sarampo do cDNA23,24, placa produtor MV (macaco verde africano rim derivado Vero) células uniformemente sobre uma placa de 6 24 h antes do transfection. Semente de 2 x 105 células em 2 mL médio (DMEM modificado águia de Dulbecco) contendo 10% de soro fetal bovino (FBS) por alvéolo para alcançar a confluência de 65 a 75% no momento do transfection.
      Nota: [P] reduza o número de celular, se as células overgrow antes da formação do citoplasma induzida por vírus.
    2. [P] Transfect as células com DNA codificação os plasmideos viral auxiliar antigenoma, necessário, e, se desejado, um plasmídeo codificação um repórter fluorescente para avaliar a eficiência do transfection.
      1. [M] Mix 5 µ g de DNA recombinante, codificação do antivírus genoma sarampo, 500 ng cada de plasmídeo de expressão mamíferos codificação vírus do sarampo N e L proteínas e 100 ng cada de plasmídeos codificação proteína P e um repórter fluorescente em um volume total de 200 µ l DMEM.
      2. Adicionar 18,6 µ l de reagente de transfeccao lipossomal, misture por agredir o tubo e incubar durante 25 min à temperatura ambiente (RT).
      3. [P] substituir o medium com 1,8 mL de DMEM, 2% FBS, 50 canamicina µ g/mL (ou outros antibióticos para evitar a contaminação) por bem, em seguida, adicione a mistura de transfeccao gota a gota ao poço e agite cuidadosamente. Incube as células durante a noite a 37 ° C, 5% de CO2. Substituir o médio com 2 mL de DMEM fresco, 2% FBS e canamicina de 50 µ g/mL no dia seguinte; Repita isso quando o meio torna-se ácida.
        Atenção: [O] lidar com células e materiais de acordo com as normas de biossegurança, como o vírus podem estar presente de transfeccao através dos seguintes passos. Descarte de resíduos infecciosos (potencialmente) apropriadamente.
  2. [P] coletar e propagam as partículas de vírus.
    1. [P] observar células diariamente através de microscopia para repórter gene expressão e citoplasma formação (Figura 4). Recolher o vírus quando grande citoplasma, constituído por 20 ou mais células, é visíveis, ou quando as células tornam-se muito densas (i. e., quando eles começam a crescer em múltiplas camadas, normalmente depois de 7 a 9 dias).
      Nota: [P] se não citoplasma é observadas por uma construção de determinado vetor, isto não significa necessariamente que o resgate falhou. Como o vírus infeccioso, no entanto, podem estar presente na amostra, transferi para células frescas produtor para passagem.
    2. [P] semente aproximadamente 1,5 x 106 células de produtor em 12 mL de DMEM com 10% FBS, no cm 10 pratos 24 h antes da colheita antecipada, ou 2,5 x 106 células por 4-6 h antes da passagem do vírus para alcançar a confluência de 65-75% no momento da inoculat vírus da placa íon.
    3. [P] para coletar progênie de vírus, cuidadosamente raspar as células aderentes produtor da placa usando um raspador de célula e transferir o sobrenadante contendo células para um tubo de centrifugação. Remover os resíduos de células por centrifugação por 5 min a 2.500 x g e 4 ° C.
      Nota: Raspado de células podem ser transferidas diretamente sem centrifugação para maximizar o reporte de vírus à custa de condições suboptimal cultura e potenciais artefatos de microscopia.
      Precaução: Evite [O] derramando mídia quando raspagem de células. Minimize a formação de aerossóis.
    4. [P] prepare o inóculo misturando o sobrenadante celular livre da etapa 2.2.3 com meio livre de soro até um volume final de 4 mL. Substituir o medium em células de produtor de inóculo e incubar as células pelo menos 2 h a 37 ° C e 5% de CO2. Adicionar 6 mL de DMEM com 10% FBS e incubar as células durante a noite antes de alterar o meio para 12 mL de DMEM fresco com 10% FBS.
    5. [P] observa as células pelo menos duas vezes por dia e vírus de colheita antes da explosão do citoplasma (ou seja,, , quando o rompimento da membrana torna-se visível). Para colher a primeira passagem do vírus, remover o sobrenadante do prato, adicione 600 µ l de meio livre de soro, raspar as células com um tirante de célula e transfira para um tubo limpo.
      Nota: [M] dependendo do vírus estirpe51,52 e progressão da infecção, transferi as placas com células infectadas a 32 ° C, para facilitar a disseminação e replicação viral. Em geral, cepas Schwarz MV propagam bem a 37 ° C, enquanto a transferência de células infectadas com vírus de cepa Edmonston B para 32 ° C resulta na formação de citoplasma mais lenta mas mais títulos.
      Nota: [P] não permitem a camada de células secar durante a colheita, pois isso resultará em infectividade reduzida de partículas virais. Embora alguns vírus é perdido quando descartar o sobrenadante de células infectadas, maior concentração pode ser obtida da camada de células.
    6. [P] imediatamente congele a suspensão de vírus em nitrogênio líquido. Loja a-80 ° C durante pelo menos 24 h assegurar completa congelando. Estenda a vários dias para interromper o procedimento, se necessário.
    7. Liberação de partículas virais por descongelar a 37 ° C. Homogeneizar por num Vortex e centrifugar por 5 min a 2.500 x g e 4 ° C. Transferir os sobrenadantes para cryotubes etiquetados e loja a-80 ° C.
      Nota: [O] armazenar vírus em alíquotas tamanhos adequados para experiências posteriores, como eles são preferencialmente descongelados apenas uma vez e usados imediatamente. [P] mais congelamento-descongelamento ciclos ou armazenamento a 4 ° C ao longo de vários dias resultado em redução significativa da concentração viral.
    8. [P] um dia antes da passagem ainda mais para atingir a quantidade necessária e título, 4 x 106 células de produtor em 12 mL de DMEM com 10% de sementes FBS em pratos de 15 cm. Inocule com o vírus em uma multiplicidade de infecção (MOI) de 0,03. Infectar-se em 8 mL de meio livre de soro por placa e alterar médio para DMEM com 10% FBS depois de incubarem células pelo menos 2 h. escala acima usando placas múltiplas.
    9. Colheita como descrito no passo 2.2.5, quando o citoplasma se espalharam em toda a camada de células inteiras. Piscina as suspensões obtidas em tubos de 50 mL e processo, conforme descrito em etapas 2.2.6–2.2.7.
      Nota: [O] é fundamental verificar todas as chapas visualmente para contaminação bacteriana e fúngica antes da colheita. Em geral, verifique todas as linhas de célula regularmente para a contaminação por micoplasma ou adventícios vírus por PCR multiplex.
  3. [P] avaliar títulos virais. Determine a concentração de reservas de vírus em octuplicates por alíquota usando placas de 96 poços. Realizar a titulação das três alíquotas individuais por resgate de vírus e usar o valor médio para calcular a quantidade de suspensão de vírus para ser usado em experimentos.
    1. [P] piscina o produtor células, contagem e ajustar a 1,5 x 105 células por mL de DMEM com 10% FBS.
    2. [P] pipeta 90 µ l de DMEM com 10% FBS em cada poço de uma placa de 96 poços.
    3. [P] Adicionar 10 µ l de uma alíquota da unidade populacional de vírus para todos os 8 poços na primeira coluna da placa e homogeneiza pipetando para cima e para baixo pelo menos 10 vezes.
    4. [P] execute 10 vezes diluições em série do vírus. Transferência de 10 µ l de cada poço da primeira para a segunda coluna usando uma pipeta multicanal. Homogeneiza pipetando para cima e para baixo e use a pipeta fresco dicas para cada etapa de diluição. Descarte de 10 µ l de cada poço da última coluna.
      Nota: 12 passos de diluição serial permite a cada placa de 96 poços. [M] para vetores de MV, 8 etapas de 10 vezes as diluições são normalmente suficientes, como títulos acima de 1 x 109 unidades infecciosas de célula (ciu) /mL raramente são obtidos pelo método de propagação descrito no passo 2.2. [P] controle poços sem vírus podem ser usados para comparação e para monitorar a contaminação.
    5. [P] Adicionar 100 µ l de suspensão de células a cada poço e incubar a 37 ° C, 5% de CO2 por 48 h. garantir a ausência de aglomerados de células em suspensão para alcançar uma distribuição homogénea das células.
    6. [P] seleção para o citoplasma, usando um microscópio de luz. Contar o citoplasma em cada poço da coluna com o maior fator de diluição contendo citoplasma visível.
    7. [P] calcula o número médio de citoplasma por bem naquela coluna dividindo o número total de citoplasma por oito anos. Multiplicar essa média com o fator de diluição da coluna respectiva, começando em 102 ciu / mL para a primeira coluna53 (consulte a Figura 5 , por exemplo).

3. determinar as capacidades Replicative e citotóxicas de vetores virais codificação imunomoduladores

  1. [O] compare cinética de replicação do vírus recombinante gerado e o vetor não modificado com curvas de crescimento de uma etapa ou em várias etapas (GCs). Uma etapa GCs, progênie viral é avaliados após infecção simultânea de todas as células (teoricamente, 100% infecção). Início de GCs várias etapa em uma baixa percentagem de células infectadas a seguir várias rodadas de replicação do vírus.
    1. [M] para a análise da cinética de replicação de vírus de sarampo, 1 x 105 células Vero em 1 mL de DMEM com 10% de sementes FBS por alvéolo em placas 12-bem um dia antes da infecção. Chapa de pelo menos dois poços para cada commit de interesse como técnica é replicada.
    2. [O] infectar as células com vírus em MOI baixa para várias etapas ou em MOI alta para uma etapa GCs [M] (0,03 e 3 para replicação de MV no Vero células, respectivamente). Substituir o médio com 300 µ l de meio livre de soro contendo a respectiva quantidade de vírus e incubar a 37 ° C e 5% CO2 pelo menos 2 h. inóculo de remover, adicionar 1 mL de DMEM com 10% FBS e continuar a incubação.
    3. [P] em momentos relevantes, tais como 12, 24, 36, 48, 72 e 96 h após a infecção, colhem progênie viral por raspagem diretamente as células entram no meio. Transferir o conteúdo de cada poço para um tubo individual, snap-congelamento em nitrogênio líquido e armazenar a-80 ° C até a titulação.
      Nota: [P] amostras podem ser agrupadas neste passo para análise da concentração média.
    4. [P] recolha amostras de todos os momentos. Descongelar-se simultaneamente a 37 ° C, para avaliação da progênie viral. Vórtice e pelota restos de células por centrifugação por 5 min em 2.500 x g e 4 ° C.
    5. [P] Calcule uma concentração média de cada construção e commit como descrito acima. Lote de títulos ao longo do tempo. Comparar as curvas de crescimento de vetores com e sem transgenes inserido, com diferentes transgenes ou com transgenes inserido em posições diferentes (ver Figura 6A).
  2. [O] compare atividades líticas de vírus imunomodulador-codificação e não modificadas.
    1. [O] selecionar metodologias possíveis, incluindo medição de impedância, lactato desidrogenase (LDH) de lançamento do ensaio, ou ensaios de viabilidade celular colorimétrico baseado no metabolismo [por exemplo,, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) e 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) ensaios].
      1. [M] para analisar a citotoxidade de sarampo vetores de vírus usando o XTT do ensaio, células Vero de sementes conforme descrito na etapa 3.1.1. Incluem repetições de um controle não infectados para cada commit.
        Nota: [O] realizar ensaio XTT em momentos diferentes na mesma amostra pode limitar erros técnicos, mas a lavagem repetida e exposição ao reagente XTT afeta o número de células viáveis. Impedância fornece uma leitura alternativa para medições contínuas.
    2. [M] infectar células Vero em um MOI de 1 conforme descrito na etapa 3.1.2.
      Nota: [M] para a infecção de células-alvo menos permissivas como algumas linhas de células de tumor murino, um maior MOI de 3 ou 5 pode ser necessário.
    3. [O] em momentos de interesse (por exemplo., 12, 24, 36, 48, 72 e 96 h após a infecção) preparar a quantidade necessária de reagente XTT (i.., 300 µ l por bem mais de 10% de excesso). Evite a exposição à luz.
    4. [M] a cada commit, remova médio dos respectivos poços. Substituir por 300 µ l de reagente XTT e incubar a 37 ° C, no escuro. Coletar os sobrenadantes quando o reagente em poços de controle tornou-se vermelho profundo, que normalmente demora entre 15 min e 2h, e congelar a-20 ° C.
      Nota: [O] incubações dependem de construção de vírus, tipo de célula, densidade e efeito citopático.
    5. [O] depois de coletar todas as amostras, descongele simultaneamente. Transferir 100 µ l de cada amostra para uma placa de 96 poços e medir óptica absorvância a 450 nm, com 630 nm como comprimento de onda de referência.
    6. [O] enredo momentos (eixo x) vs. óptica absorvância das amostras em relação a controles, indicando atividade metabólica como um substituto para viabilidade celular (eixo y). Diminuindo a absorvância relativa ao longo do tempo implica citotoxicidade viral (ver Figura 6B).

4. analisar a atividade do vírus-codificado imunomoduladores secretada de células infectadas

  1. [O] isolar transgene secretada produtos expressa por células infectadas por vírus alvo.
    1. [P] deixa o produtor de vírus, as células crescem a confluência de 70% em frascos de T175.
    2. [P] remover médio de células e lavar duas vezes com 12 mL de PBS para retirar o soro. Inocular as células com o vírus em um MOI de 0,03 em 12 mL de meio livre de soro e incubar a 37 ° C e 5% de CO2 durante a noite. Substitua o medium com 12 mL de meio fresco isento de soro.
      1. [M] para vírus Edmonston B, transferi células de 37 para 32 ° C após 40 h para outro 24 h de incubação para facilitar a infecção e impedir a ruptura prematura do citoplasma. Dependendo da estirpe do vírus progressão de52 e citoplasma51,, temperaturas de incubação e tempos podem ser ajustados para a pureza e o rendimento de proteína ideal.
    3. [P] cuidadosamente colete sobrenadantes sem desmontar as células antes de explosão do citoplasma. Idealmente, citoplasma se espalharam em toda a camada de toda a célula. Sobrenadantes de piscina em tubos de 50 mL.
      Nota: [P] para eficiente purificação do produto do transgene, evitar a ruptura do citoplasma e minimizar os restos da célula ao colher os sobrenadantes de células infectadas.
    4. [P] remova restos de célula de sobrenadante por centrifugação por 5 min em 2.500 x g e a 4 ° C e a passagem através de 0,22 µm de filtros. Dependendo do volume total do filtrado, isso pode ser realizada utilizando uma seringa ou uma bomba de vácuo.
    5. [O] Isole transgene produto usando um método adequado de purificação. Purifica a proteínas com uma marca de hexa-histidina (dele) por troca cromatografia de afinidade usando Ni-NTA rotação mini colunas38 conforme descrito aqui em breve (passos 4.1.5.1–4.1.5.4).
      Nota: [O] execute todas as etapas rápido e no gelo. Pre-calma buffers e pre-cool centrifugar a 4 ° C.
      1. [O] prepare 100 mL de tampão PBS, cloreto de sódio 200 mM e imidazol em concentrações finais de 10 mM (lavagem tampão 1, WB1), 20mm (lavagem tampão 2, WB2) e 500 mM (tampão de eluição, EB). Ajuste o pH do WB1 e WB2 para 8.0 e do EB para 7.0. Dependendo da proteína a ser purificado, concentrações de imidazol podem ter que ser ajustada.
      2. [O] equilibrar colunas com 600 µ l de WB1 e centrifugar 800 x g por 2 min com uma tampa aberta.
      3. [O] carga 600 µ l de filtrado sobrenadantes para colunas. Permita a ligação de proteínas com sua Tag a matriz coluna por centrifugação a 200 x g por 5 min com uma tampa fechada. Carregamento e vinculação podem ser repetidos até um total de 300 µ g de proteína de sua marcados por coluna.
      4. [O] lavar três vezes com WB1 e uma vez com WB2, ou até que o escoamento é incolor. Adicione 600 µ l de tampão e girar a 800 x g por 2 min com a tampa aberta.
      5. [O] elute a proteína para um novo tubo através da realização de duas etapas de eluição com 300 µ l de EB e centrifugação por 2 min a 800 x g.
      6. [O] do desalt e concentrar o produto usando filtros centrífugos de acordo com o tamanho do produto. Adicione um volume de 15 mL e filtro através de centrifugação por 10min a 4.000 x gPBS. Repita até a pureza desejada e concentração é alcançada. Para aumentar a concentração de proteína, reduza o volume final de aproximadamente 200 µ l por centrifugação durante 40 min a 4.000 x g.
  2. [O] confirmar pureza e identidade do produto.
    1. [O] quantificar a quantidade de proteína total em isolados utilizando ensaios colorimétricos padrão tais como o ácido bicinchoninic (BCA) ou ensaio de Bradford54,55. [M] típicos valores podem variar de 1 a 3 µ g do transgene produto por sobrenadante mL de células infectadas.
    2. [O] para quantificação relativa dos isolados de proteína, separadas através de sódio Dodecil sulfato de eletroforese em gel de poliacrilamida (SDS-PAGE) e executar Coomassie coloração56.
    3. [O] confirme a identidade dos produtos purificados pelo immunoblotting utilizando anticorpos específicos, visando a proteína ou um peptídeo associado marca57.
    4. [O] analisar a especificidade de ligação de proteínas usando técnicas adequadas que podem incluir o ensaio imunoenzimático (ELISA) ou citometria de fluxo (ver Figura 7). Ligação de celular pode ser confirmada usando um pulldown magnético descrito recentemente ensaio38.
      Nota: [O] uso de controles apropriados. Em ensaios de ligação de celular, incluem controles negativos com células que não expressam a molécula alvo (como na Figura 9) e não-direcionamento de substitutos de proteínas (Figura 8). Em experimentos de citometria de fluxo, incluem positivo, negativo e isotipo controles (Figura 7).
      1. [O] co Incubar o alvo células e proteínas isolar para permitir a ligação. [B] para a vinculação de análise de BTEs de sangue periférico, células mononucleares (PBMC) isoladas do sangue humano58, incubar 2.5 x 106 células com 200 ng de BTE em 100 µ l de PBS com 1% FBS (tampão de ligação, BB) por 1h no gelo.
      2. [B] células de lavagem com 1 mL de BB para remover desvinculado de proteína. Centrifugar a 300 x g por 5 min, descartar o sobrenadante e ressuspender em 100 µ l de BB. Adicionar biotinilado como alvo a proteína de interesse ou uma marca de peptídeo associado e incubar no gelo por 30 min. Para BTEs com tag de hemaglutinina (HA) de gripe, uso 100 ng de anti-HA-biotina (clone 3F10).
      3. [B] lavar as células duas vezes com 1 mL de BB e Resuspenda em 80 µ l do BB. Adicionar 20 µ l de microbeads magnéticos acoplados streptavidin e incube por 15 min a 4 ° C.
      4. [B] lavagem uma vez para remover o excesso grânulos e resuspenda o pellet em 500 µ l do BB suplementado com 2 mM de EDTA (tampão de coluna, CB).
      5. [B] Isole células com colunas e um suporte magnético de acordo com o manual do provedor.
        1. [B] equilibrar permitindo 500 µ l do CB para passar através da coluna pelo fluxo de gravidade.
          Nota: [B] a coluna nunca deve secar. Pipetar cuidadosamente e desgaseificar os buffers para evitar bolhas.
        2. [B] Coloque um tubo limpo sob a coluna e aplicar a suspensão de célula/pérola para a coluna. Lave a coluna três vezes com 500 µ l de CB por lavagem. Coletar o escoamento das amostras da suspensão e de pelo menos a primeira etapa de lavagem do tubo e, em seguida, armazenar no gelo.
        3. [B] eluir células grânulo-limite retidas pelo campo magnético. Para este fim, remover a coluna do suporte magnético, coloque-o sobre um tubo limpo, adicionar 1 mL de CB e rapidamente empurre a reserva através da coluna dentro do tubo usando um desentupidor. Mantenha o tubo no gelo.
      6. [B] centrifugar tubos contendo amostras de escoamento e eluição por 20 min em 16.000 x g e 4 ° C para células de Pelotas. Descartar os sobrenadantes e lyse pilhas em um buffer de ensaio (RIPA) radioimmunoprecipitation (sugerido: 75 µ l). Execute de SDS-PAGE56.
      7. [B] execute usando um anticorpo primário adequado de immunoblotting. Anticorpos podem direcionar o produto transgene ou uma proteína celular (ex.., β-actina, Figura 8) para avaliar a vinculação de BTE-célula.
  3. [O] avalie funcionalidade imunológica de imunomoduladores isolado.
    1. [O] identifica ensaios pertinentes de acordo com as características do imunomodulador codificado. Relativamente a actividade esperada imunomodulador, métodos de avaliação de proliferação celular, migração, maturação, ativação ou citotoxicidade pode ser aplicada.
      Nota: [O] proliferação celular pode ser analisada pelo CFSE59 rotulagem ou Ki67 coloração60. Transwell ou arranhão experiências estão disponíveis para analisar a célula migração61. Maturação e ativação de células podem ser avaliadas usando protocolos de coloração adequados para os respectivos marcadores. [B] disponíveis técnicas para avaliar a citotoxicidade celular mediada por BTE incluem impedância do ensaio de lançamento de medições e cromo. Se optar por ensaio de liberação de cromo, observe as medidas de segurança ao manusear material radioativo.
    2. [B] como uma alternativa não-radioativo, a seguir descreve em detalhes como avaliar a citotoxicidade induzida por BTE, mediada por células por ensaio de liberação LDH (descrito anteriormente em breve38).
      1. [B] decidir sobre as condições para ser testado durante o experimento (consulte a Figura 9 , por exemplo). Momentos (horas, dias), as concentrações do imunomodulador (pg/mL, para µ g/mL) e efetoras para proporções de célula (E:T) alvo (entre 01:50 e 50: 1, por exemplo) podem ser variada. Sempre prepare amostras em triplica.
      2. [B] incluem amostras sem proteínas e sem células efetoras, controles para LDH espontânea de lançamento dos tipos de célula única (Tsp e Esp), um controle de Lise máxima de célula de destino (Tmáx) com detergente adicionado antes da leitura, um meio apenas o controle e um controle de volume para Tmáx.
        Nota: [B] necessários números de células-alvo e tempos de incubação podem variar. Execute testes iniciais sem células efetoras e imunomoduladores para identificar parâmetros ideais. Incluem Tsp emáximo amostras de T e controles correspondentes para avaliar momentos e números de telemóvel diferentes.
      3. [B] Isole células imunes efetoras, por exemplo, (centrifugação gradiente de densidade do sangue humano para obter PBMCs58 ) ou seleção negativa murino de pilhas de T do rato splenocytes62.
      4. [B] semente atingir células conforme item 4.3.2 (por exemplo,, 5 x 10³ por alvéolo) em uma placa de fundo U 96.
      5. [B] adicione a proteína isolada em concentrações desejadas para as respectivas amostras. Adicione células imunes efetoras em proporções desejadas. Adicione médio para um volume total de 100 µ l por bem.
      6. [B] incubar para o período de tempo determinado no passo 4.3.2, tipicamente entre 4 e 48 h (24 h para PBMCs unstimulated e 48 h para recém isoladas células T murino; tempos de incubação mais curtos podem aplicar para prestimulated células do sistema imunológico), a 37 ° C e 5% de CO2.
      7. [B] 45 minutos antes de coletar as amostras, adicionar 10 µ l de solução de Lise x 10 poços contendo Tmáx amostras e controles médias correspondentes. Continue a incubação.
      8. [B] spin para baixo as células a 250 x g durante 4 min. Transfira 50 µ l de cada sobrenadante para uma placa de 96 poços de fundo plano. Não transferência de células para evitar LDH ligados a célula.
      9. [B] prepare a solução de substrato de acordo com o fabricante. Adicionar 50 µ l de cada poço e incubar a RT no escuro por 30 min ou atémáx amostras T virar vermelho profundo.
      10. [B] adicione 50 µ l de solução de paragem em cada poço. Remova as bolhas de ar por centrifugação por 1 min a 4.000 x ge manualmente com uma agulha oca. Medir a absorvância óptica a 490 nm.
      11. [B] Calcule valores de % Lise específicas para cada amostra.
        1. [B] calcular médias de repetições de controles médios com e sem solução de Lise. Subtrai os valores obtidos de amostras experimentais e de Tmax e controles de liberação espontânea, respectivamente. Use estes valores de fundo-corrigido para cálculos ainda mais.
        2. [B] calcular médias para correção de fundo Tmáx, Tspe Esp controles. Usando esses valores de médias, a seguinte equação rende a porcentagem de Lise específica para cada amostra:

          Equation 1
        3. [B] plotar valores % específicos lise vs a concentração de proteína ou E:T relação e comparar com as amostras de controle não-alvo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

A Figura 1 ilustra o mecanismo de ação do vírus de sarampo Oncolíticos codificação bispecific célula T participantes. Um fluxograma descrevendo o fluxo de trabalho do presente protocolo é apresentado na Figura 2. A Figura 3 mostra um exemplo de um genoma do vírus de sarampo Oncolíticos modificados. Isso fornece uma representação visual das mudanças específicas aplicadas aos sarampo vírus antigenoma e particular recursos de transgenes inserido. Citoplasma induzidas pelo vírus do sarampo típico é representadas na Figura 4. Observe a densidade celular alta ao Commit de colheita o resgate (A, B), indicando que o número de células pode ser reduzido quando repetir o experimento. Tempos e - temperaturas de incubação podem ser otimizados para passagem em células Vero (C, D) para alcançar melhor propagação do citoplasma do outro lado da placa. A Figura 5 representa o resultado de um ensaio de titulação típica. Na Figura 6, as curvas de crescimento de uma etapa (A) e viabilidade celular relativo (B) após a inoculação com não modificado (MV) e codificação de BTE Oncolíticos vírus de sarampo (MV-H-mCD3xhCD20) são mostrados. Enquanto as curvas de crescimento dos vetores comparados em células Vero aparecem semelhantes, atividade lítica do transgene-codificação vírus retarda-se atrás na linha de células de tumor murino. Dados de antígeno-expressando nas células-alvo incubadas com BTEs a cinco diferentes diluições são fornecidos na Figura 7, indicando a ligação de BTE por células de forma concentração-dependente de citometria de fluxo. Figura 8 representa um exemplar immunoblot depois magnético pulldown de células associadas BTE. Pulldown com direcionamento-BTEs (n.1, n2) não deu quantidades detectáveis de células, Considerando que bandas na fração de eluição, indicativa de limite células, foram observadas para o direcionamento de amostras BTE (t1, t2). Citotoxicidade de antígeno-específicas e dependente da concentração alvo de murino células T mediada por BTE, é indicada por um ensaio de liberação LDH representante na Figura 9.

Figure 1
Figura 1 : Mecanismo de ação do vírus de sarampo Oncolíticos codificação um bispecific célula T engager (MV-BTE). Infecção de uma célula de tumor (infectado: cinza, não infectados: luz-azul) com MV-BTE é seguida de replicação viral e propagação durante todo o tumor, resultando na estimulação de Lise e imunológico de células de tumor. Simultaneamente, BTEs [consistindo de duas cadeias simples derivadas de anticorpos direcionamento CD3 em células T (amarelas) e um tumor do antigénio de superfície (azul)] são produzidos e secretados localmente pelas células infectadas por vírus. BTE-mediada do cross-linking com células tumorais induz a ativação do repouso, policlonais células T, resultando em mais matar células de tumor. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Fluxograma descrevendo o fluxo de trabalho de concepção, gerando e avaliando novos vetores virais codificação immunomodulatory transgenes. As etapas 1 a 4 refletem as respectivas seções do protocolo. Pontos de bala indicam sub-etapas e considerações relevantes. Devido à natureza empírica do procedimento, ajustes ou refinamentos podem tornar-se necessário em qualquer etapa do fluxo de trabalho. Além disso, resultados experimentais podem levar a novas hipóteses e inspirar o desenvolvimento de vetores adicionais ou tratamentos de combinação. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Representação esquemática de uma genoma do vírus do sarampo. Proteína verde fluorescente melhorada (eGFP) é codificada em uma unidade de transcrição adicionais a jusante da sequência líder (ld). N, P, M, F, H e L designam genes que codificam a cadeia de proteínas estruturais de vírus de sarampo, P proteína, proteína de matriz, proteína de fusão, proteína hemaglutinina e proteína grande (polimerase), respectivamente, que são diferencialmente expressos como visualizado acima. Um bispecific célula T engager (BTE) transgene é inserido em uma transcrição adicionais unidade (ATU) a jusante do quadro de leitura aberto H . O transgene codifica um peptídeo de líder Igκ para secreção eficiente, bem como a hemaglutinina gripe (HA) e tags de proteína hexa-histidina (dele) para a deteção e a purificação. Genes que codificam para a variável pesados (VH) e cadeia leve domínios (VL) de anticorpos direcionamento CD3 e CD20, respectivamente, estão conectados através do peptide vinculador sequências contendo glicina (G) e resíduos de serina (S). A sequência do transgene é precedida por uma sequência de Kozak. A jusante da codificação região, nucleotides adicionais foram incluídos exemplarily em conformidade com a regra de seis. A gaveta de inserção é ladeada por dois sites de restrição, permitindo a inserção no respectivo ATU. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : Citoplasma induzidas pelo vírus do sarampo. (A, B) Células Vero foram transfectadas com cDNA para resgate de vírus de sarampo recombinante codificação avançada proteína verde fluorescente (eGFP) e um bispecific T cell engager (BTE) segmentação CD3 murino e humano CD20. Presença de um sincício fluorescente (setas brancas) indica o resgate bem-sucedido de vírus infeccioso. (C, D) Vírus do sarampo foram colhidas após resgate e propagados em células Vero (passagem 1). Citoplasma grande se formaram e já está começando a estourar (setas amarelas). Imagens foram adquiridas por microscopia de fluorescência e contraste de fase (B, D) após excitação por 80 ms (A) e (C) de 100 ms. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5 : Resultado representativo de um ensaio de titulação. Titulação de um lote de terceiro-passagem de MV-H-mCD3xhCD20, um codificação de BTE Oncolíticos vírus do sarampo, em células Vero. Uma 10 vezes diluição serial foi realizada em uma placa de 96 poços, começando com 10 µ l de suspensão de vírus em cada poço da coluna 1. citoplasma não eram visíveis na coluna 7, como indicado por zeros. Para a próximo menor diluição da suspensão de vírus na coluna 6, observou-se uma média de seis citoplasma por alvéolo, resultando em uma concentração final de aproximadamente 6 x 107 células infecciosas (ciu) por mL suspensão de vírus. Clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6 : Cinética de replicação e atividade lítica de vírus de sarampo recombinante. Uma etapa (A) curvas de crescimento foram geradas após a infecção de células Vero com o vírus do sarampo não modificado Oncolíticos (MV) ou codificação um bispecific célula T engager (MV-H-mCD3xhCD20) em um MOI de 1 do vírus do sarampo. Uma concentração de progênie viral foram avaliada em momentos designados após a infecção, indicando semelhante cinética de replicação do vírus. Médias e desvios-padrão das oito amostras (técnico quatro réplicas de cada tipo de duas repetições biológicas por commit) são mostrados. (B) célula viabilidade foi avaliada em carcinoma colorrectal murino de MC38 células estàvel expressando o antígeno carcinoembryonic humano e o receptor de MV CD46 (MC38-CEA-CD46) após a inoculação com média única (simulação) ou vírus indicadas em um MOI de 1. Ensaio da viabilidade celular XTT realizou-se em momentos indicados. Observou-se redução da viabilidade celular em momentos anteriores para o vetor não modificado. Valores de mais de 100%, conforme calculado para MV-H-mCD3xhCD20 no Commit de 12 h, frequentemente são observados logo após a infecção, que pode ser devido ao estresse celular ou derivado de células fatores presentes na suspensão de vírus. Valores médios e desvios-padrão de três repetições de técnicas são mostrados para cada commit. Clique aqui para ver uma versão maior desta figura.

Figure 7
Figura 7 : Ligação de célula alvo por participantes de célula T de bispecific (BTEs) expressa de sarampo células infectadas por vírus. Linfoma de células do manto humana células endogenamente expressar CD20 (Granta-519) foram incubadas com imunoglobulina humana G para bloquear os receptores Fc, seguidos pela incubação com 2, 4, 6, 8 ou 10 µ l (A) da solução BTE mCD3xhCD20 purificado, respectivamente. BTE-limite células foram detectadas usando ficoeritrina (PE)-anticorpo conjugado visando a associada BTE HA-tag. Porcentagens de células coradas correlacionaram com concentrações de BTE. (B) controles de seletividade e especificidade de ligação. Mostrado aqui são controles de um experimento independente, incluindo uma amostra de células não incubadas com BTE mas com o anticorpo BTE-direcionamento somente (controle inespecíficos ligação de anticorpos às células) ou com um BTE que é conhecido para ligar as células de interesse , seguido de incubação com o anticorpo BTE-direcionamento (controle positivo) ou um anticorpo isotype. Se disponível, isogénicas células não expressando o antígeno alvo de escolha podem ser usadas para verificar mais seletividade de vinculação. Clique aqui para ver uma versão maior desta figura.

Figure 8
Figura 8 : Magnético pulldown de periférico humano sangue células mononucleares (PBMC) vinculadas por sarampo vírus codificado BTEs. As células foram incubadas com dois lotes diferentes do humano T célula-alvo (t1, t2) ou não-direcionamento controle BTEs (n1, n2), respectivamente. BTE-limite células foram mantidas em colunas usando esferas magnéticas, peletizadas e lysed. Β-actina em lysates foi detectada pelo immunoblotting. Intensidades das bandas nas amostras de eluição indicam relativo BTE-célula ligação. Espécimes de escoamento confirmam a presença de células em todas as amostras. Clique aqui para ver uma versão maior desta figura.

Figure 9
Figura 9 : Atividade citotóxica do sarampo vírus codificado BTEs. Tumor nas células-alvo (5 x 10³ B16-CD20-CD46 células por poço) foram incubadas com murino células T na proporção de 01:50. BTEs previamente purificados a partir do sobrenadante da MV-H-mCD3xhCD20-células infectadas por foram adicionados em concentrações indicadas. Lysis relativa das células-alvo foi avaliada por ensaio de liberação LDH após 48 h. células falta o BTE alvo antígeno (B16-CD46) servido como referência para avaliar a citotoxicidade de antígeno-específicas. Meios mais desvios-padrão de três repetições de técnicas por exemplo são mostrados. Nas células-alvo do antígeno-expressando foram especificamente lysed de forma concentração-dependente BTE. A BTE produto alvo antígeno expressão níveis influência célula matança e pureza. No presente exemplo, matança de célula específica de 15% foi conseguida em uma concentração relativamente alta de BTE de 1 µ g/mL. Este é um valor típico para tal uma instalação experimental com incubações co longa e as condições de cultura de qualidade inferior de célula T. Outras configurações, acima de 60% específica matar foi conseguido usando BTEs purificados de sobrenadantes MV-infectado, atingindo um platô em BTE as concentrações de 100 ng/mL e superior38. Isso indica que, ironicamente, o limite deste teste é inferior a 100% matança específica, que pode ser explicada pela cinética de crescimento diferente de Tmáx controles comparado com amostras de co-cultura. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolíticos imunoterapia (i. e., OVT em combinação com imunomodulação) é uma grande promessa para tratamento de câncer, exigindo ainda mais desenvolvimento e otimização de vírus Oncolíticos codificação immunomodulatory proteínas. Este protocolo descreve métodos para gerar e validar tais vetores para testes subsequentes em modelos pré-clínicos relevantes e potencial futura tradução clínica em novela terapêutica anticâncer.

Inúmeras plataformas de vírus Oncolíticos diferentes com vantagens distintas estão disponíveis63. Além de câncer especificidade, vetor de segurança, requisitos para fabricação, eficácia na lysis da pilha do tumor e indução de respostas imunes, capacidade de clonagem é chave para sucesso vetorização de imunomoduladores usando um Oncolíticos específico. Infelizmente, comparações diretas de OVs diferentes estão em falta no momento e devem ser prosseguidas a fim de identificar as opções de tratamento ideal para pacientes individuais. Isto pode ser facilitado por promover o desenvolvimento racional e testes de novos vetores transgene-codificação, como exemplificado aqui para MV-BTE. Tendo em conta as propriedades benéficas do MV (ou seja,, oncotropism, segurança, fusogenicity, imunogenicidade, viabilidade de modificação genética) este protocolo incide sobre este vetor Oncolíticos, que pode ser generalizada para outro OV, especialmente paramyxoviruses .

Para uma escolha racional de imunomoduladores potencialmente relevantes como candidato transgenes (etapa 1.1.1), uma compreensão completa do ciclo de câncer-imunidade é essencial, tornando indispensável a pesquisa sistemática da literatura. Além disso, telas em grande escala, embora dispendiosas, podem provar valiosas para identificar novos alvos (por exemplo, veja Pimentel et al.41).

Para o projeto de OVs recombinantes, perfis de expressão desejada devem ser consideradas. No caso de vírus de RNA, expressão gênica é controlada no nível do RNA pelo polymerase de respectivos. Ao projetar o transgene cassettes para inserção em genomas MV (etapa 1.1.2), evitar que se assemelham a MV polimerase gene iniciar/parar sinais e RNA edição sites e seguindo a regra de seis sequências é crucial para o desenvolvimento bem sucedido vector. Além disso, os níveis de expressão de gene paramixovírus correspondem ao posicionamento dentro do genoma, resultante de um gradiente de expressão43. Em geral, posicionamento do transgene em uma posição montante aumenta expressão em detrimento da replicação reduzida. No entanto, esses parâmetros também dependem do tamanho, estrutura e sequência do transgene respectivo. Consequentemente, uma limitação da metodologia descrita neste protocolo é a necessidade de testes empíricos de desenhos vetoriais romance. Em casos específicos, ajustes para a transgene sequência ou posicionamento pode ser necessário para atingir características de vetor desejado (Figura 2). Comparação sistemática das diferentes posições para anticorpo de ponto de verificação insere mostrou resultados optimal para o H- ATU (dados não publicados). Como inserções BTE tem propriedades comparáveis (domínios de tamanho e imunoglobulina), vetores de MV-BTE foram clonados analogamente38.

Resgate de partículas infecciosas do cDNA vírus (passo 2.1) pode exigir várias tentativas de algumas construções. Ajustar o número de células pode otimizar a densidade de células para a formação do citoplasma. Enquanto uma certa densidade é necessária para a propagação eficiente de célula para célula e fusão das membranas celulares, a inibição de contato reduz replicação viral. Além disso, o número de partículas infecciosas pode não ser suficiente para induzir a fusão celular visível. No entanto, como o vírus podem estar presentes na ausência do citoplasma, amostras de resgate, no entanto, podem ser colhidas e transferidas para células frescas produtor para a propagação de potencial. Transfecção ineficiente devido à má qualidade do DNA ou reagentes de transfecção impróprios ou degradadas representam problemas típicos que são relativamente fáceis de avaliar e remediar gerando novas preparações de DNA e testes reagentes diferentes, respectivamente.

Propagação de vírus bem sucedida (passo 2.2) depende crucialmente as condições que determinam a replicação viral e lise celular. É recomendável utilizar números de baixa passagem de células do produtor, e células infectadas precisam ser verificadas regularmente para progressão do citoplasma. Ajustando o número de células, as temperaturas e tempos de incubação podem ser necessária para equilibrar a proliferação das células propagação viral vs. .

Uma limitação crucial do método descrito de produção de vírus é a preparação de suspensões de vírus de lisados celulares bruto. Os investigadores devem estar cientes do fato de que a suspensão de vírus contém fatores celulares. Partículas de vírus podem ser concentrada através de densidade gradiente de sacarose/coxim ultracentrifugação em detrimento do número total de partículas infecciosas e também potencialmente aumento das concentrações de restos celulares. Vírus também podem ser concentrada de sobrenadantes de células infectadas, aumentando a pureza, mas reduzir o rendimento total. GMP e em grande escala a produção de paramyxoviruses geralmente é executada usando várias camadas de células de produtor semeadas em um filamento líquido em biorreatores para o título de maior rendimento63. Controlo rigoroso, troca de mídia contínua, livre de soro condições e etapas subsequentes da filtragem garantem alta pureza de vírus produzidos.

Avaliação da concentração viral (etapas 2.3 e 3.1) através da citoplasma descrita contar o método não é preciso, mas é fácil de executar e Replica suficientemente precisos quando usando números adequados de técnico. Ao avaliar a citotoxicidade mediada por OV (passo 3.2), limitações dos ensaios disponíveis precisam ser considerados. Ensaios metabólicos não fazem distinção entre efeitos citostáticos e citolíticas de tratamentos experimentais. Para medir a citólise, pode efectuar-se um ensaio de liberação LDH. No entanto, os dois tipos de ensaios podem ser afetados pelo conteúdo de preparações de vírus de lisados celulares bruto (Figura 6).

Isolamento de proteínas expressado por células infectadas por vírus (passo 4.1) pode variar muito em rendimento e pureza, dependendo do transgene respectivo e vírus utilizado, bem como a precisão técnica. Assim, o controle de qualidade de purificação de proteínas é crucial para a avaliação dos resultados experimentais relacionados.

Como uma descrição exaustiva dos ensaios funcionais potenciais, cobrindo a grande variedade de possíveis imunomoduladores está além do escopo desta publicação, este protocolo centra-se na ex vivo de metodologia para medir a citotoxicidade celular (passo 4.3). Citotoxicidade celular, especialmente por células T CD8 +, é um importante mediador do controle de tumor imunológicos em sucesso imunoterapias64. Isto tem implicações importantes para as abordagens atuais imunoterapia usando anticorpos para realçar respostas imunes de anti-tumoral em geral e participantes de célula T bispecific em particular. Expressão de BTE local por vectores Oncolíticos produziu resultados promissores em diversos estudos pré-clínicos, incluindo RNA38 e DNA vírus65,,66,67,68.

Devido as interações complexas de tumor, vírus, produto do transgene e anfitrião sistema imune em organismos vivos, validação da codificação de imunomodulador Oncolíticos vectores na cultura de pilha, como demonstrado aqui, não é suficiente para predizer os resultados terapêuticos. Importante, a avaliação proposta isolada de funções vetoriais e imunomodulador, respectivamente, é essencial para a prova de conceito mas não consegue descrever possíveis sinergias e interações complexas dentro o microambiente do tumor. Testes para toxicidade e eficácia em modelos in vivo relevantes é crucial para mais desenvolvimento do vetor recombinante romance constrói, mas não é facilmente realizado. Segurança imunológica é monitorizada regularmente em primatas não-humanos, tais como macacos e modelos de mouse são utilizados para biodistribuição e eficácia analisa20,,69. No entanto, muitos destes modelos têm limitações sobre a expressão dos receptores do vírus em tecidos do hospedeiro e a permissividade do hospedeiro, e alguns apenas insuficientemente imitam a complexa interação de OV, tumor e o microambiente imune. Assim, a consideração cuidadosa de modelos adequados é obrigatória.

Tratamento de MV-BTE anteriormente foi avaliado em xenoenxertos humano e modelos de rato syngeneic. Não BTE transgene produtos foram detectáveis no soro de ratos tratados com codificação de BTE MV38, indicando sucesso prevenção de exposição sistêmica mesmo sem mais atenuação do naturalmente vírus de estirpe de vacina oncotropic. Expressão local é crucial para imunomoduladores OV-codificado tóxicas quando administrado sistemicamente. Se necessário, a especificidade do tumor pode ser reforçada por re-direcionamento a célula de marcadores de superfície de escolha70,,71,72 e microRNA-baseado de direcionamento para reforçada oncotropism73,74 ( avaliado por Ruiz e Russell75). Modificações adicionais podem ser introduzidas para otimizar vetores para específicos usos terapêuticos (revistos por Miest e Cattaneo76), incluindo a inserção dos transgenes para fins de diagnóstico77,78 ou pró-fármaco conversão para minimizar os efeitos colaterais da quimioterapia79,80, introdução de segurança desliga-81e direcionamento do estroma do tumor ou vasculatura (por exemplo, através de de anticorpos bispecific82).

Além da modificação genética do vetor viral, regimes de combinação com o antígeno quimérico do receptor (carro) T cell transfer83, quimioterapia84,85,86ou radioterapia87, 88 , 89 ainda mais aumentar o repertório de OVT. Como imunidade MV é altamente prevalente, estratégias para contornar a neutralização do anticorpo foram desenvolvidas, incluindo troca de glicoproteínas do envelope para aqueles relacionados paramyxoviruses90, revestimento de polímero de partículas, usando as operadoras de celular para entrega o vírus e imunossupressão transitória (revisto por Russell et al.6). Desenvolvimento de regimes de imunoterapia OV avançados requer testes de segurança e eficácia terapêutica em modelos animais apropriados, com o material do paciente e, finalmente, em ensaios clínicos controlados.

Dada a multiplicidade de combinações possíveis, testes abrangentes não é viável. Modelagem matemática pode auxiliar na priorização de regimes de combinação potencial, bem como seus respectivos dosagem e agendamento prevendo os resultados do tratamento em silico (revisto por Santiago et al91). Ao testar a eficácias de romance, vetores concebidos racionalmente, som que acompanha a pesquisa translacional é instrumental para uma compreensão mais profunda dos processos subjacentes virológicos e imunológicos. Isto é crucial para a geração de modelos adequados, informações sobre mais alvos em potencial e o avanço no campo em geral. Em conclusão, em primeira mão insights relevantes métodos de desenho vetorial, geração e caracterização nesta linha de trabalho irão acelerar o desenvolvimento e apoiar a exploração de novas terapêuticas para futura tradução clínica.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.E. Engelen é listado como co-inventor de um vírus de RNA sobre patentes para câncer Immunovirotherapy propriedade da Universidade de Heidelberg. J.P.W. Heidbuechel não tem nada para divulgar.

Acknowledgments

Esses métodos foram estabelecidos no grupo Virotherapy, liderado pelo Prof Dr. Dr. Guy Ungerechts no centro nacional para doenças tumorais em Heidelberg. Estamos em dívida para com ele e todos os membros da equipe do laboratório, especialmente Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler e Jessica Albert. Este trabalho foi apoiado pela outra Kröner-Fresenius-Stiftung (Grant 2015_A78 ao C.E. Engelen) e Fundação de ciência nacional alemã (DFG, conceder EN 1119/2-1 ao C.E. Engelen). J.P.W. Heidbuechel recebe um estipêndio pela escola de pós-graduação Internacional de Helmholtz para pesquisa do câncer.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics