Paramyxovirusler Immunomodulation tümör hedefli için: tasarım ve değerlendirme Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Bu iletişim kuralı ex vivo karakterizasyonu immunomodulators, kızamık virüs bispecific T hücre engagers örnek olarak kodlama kullanarak ifade oncolytic virüslerin ve nesil için ayrıntılı bir iş akışı açıklar. Uygulama ve uyarlama diğer vektör platformları ve transgenes klinik çeviri için roman immunovirotherapeutics gelişimi hızlanır.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Başarılı kanserli hastalarda uzun süreli tümör kontrolü elde etmek için potansiyeli vardır. Son klinik başarılara rağmen bireysel tümör bağışıklık profillerine uygun güvenli ve etkili tedaviler için acil bir ihtiyaç kalır. Oncolytic virüs anti-tümör bağışıklık yanıtı hem de tümör sınırlanmış gen ekspresyonu indüksiyon etkinleştirin. Bu iletişim kuralı immunomodulatory oncolytic vektörler üretimi ve ex vivo analizini açıklar. Kızamık aşı virüs bispecific T hücre engagers örnek olarak kodlama odaklanan, diğer virüs türler ve transgenes genel metodoloji adapte edilebilir. Sunulan iş akışı tasarımı, klonlama, kurtarma ve rekombinant virüslerin yayılmasını içerir. Kinetik ve Yöneyin litik aktivite yanı sıra ex vivo izole Immünomodülatör işlevselliğini çözümlemek için deneyleri dahil, böylece roman ajanlar üretimi daha da geliştirilmesi preklinik modelleri için kolaylaştırmak ve sonuçta klinik çeviri.

Introduction

Oncolytic virüs (OVs) özellikle içinde çoğaltmak ve sağlıklı dokulara olduğu gibi bırakarak tümör hücrelerini öldürmek anti-kanser tedavi olarak geliştirilmektedir. Bu, şimdi bu oncolytic virotherapy (OVT), çoğu durumda anlama yaygın hale gelmiştir yalnızca tam Tümör lizis verimli yineleme ve yayılan virüs tarafından dayanmaz ancak tedavi başarı için ek mekanizmaları eylem gerektirir dahil olmak üzere vasküler ve stromal hedefleme ve daha da önemlisi, immün stimülasyon1,2,3,4. Birçok erken OV çalışma değiştirilmemiş virüs kullanılan iken, mevcut araştırma anlama, potansiyel olarak Roman OVs ve gelişmiş OV oluşturmak için genetik mühendisliği tarafından sunulan olanakları içeren virüs biobanks geliştirilmiş bir biyolojik kazançlı platformlar5,6,7.

İmmünoterapi son başarısı göz önüne alındığında, OVs. genetik mühendisliği ile ilgili özel ilgi immunomodulatory transgenes vardır Tür gen ürünlerin OV-enfekte tümör hücreleri tarafından hedeflenen ifade için sistemik yönetim karşılaştırıldığında toksisite azaltır. Hedefleme ile doğal oncoselectivity virüs kullanarak veya viral tropism8değiştirme elde edilir. Yerel immunomodulation OVT çok yönlü anti-tümör mekanizmalarının geliştirir. Ayrıca, bu virüs, tümör hücreleri ve ana bağışıklık sistemi arasında Interplay sorguya enstrümantal bir stratejidir. Bu amaçla, bu iletişim kuralını tasarlama, clone, kurtarmak, yaymak ve oncolytic paramyxovirus (özellikle kızamık virüsü) vektörel çizimler böyle transgenes kodlama doğrulamak için bir uygulanabilir ve ayarlanabilir iş akışı sağlar.

Modülasyon bağışıklık yanıtının çok çeşitli kanser-bağışıklık döngüsü9tümör antijen tanıma [Örneğin, tümör ilişkili antijenleri (TAAs) veya indükleyicileri, geliştirilmesi de dahil olmak üzere, farklı adımları hedefleme transgene ürünleri tarafından elde edilebilir MHC kompleksi (MHC) sınıf ı molekülleri] dendritik hücre olgunlaşma verimli antijen sunumu (sitokinler); destekleyen üzerinde işe alma ve istenen bağışıklık hücreleri gibi etkinleştirme sitotoksik ve yardımcı T hücreleri [kemokinler, bispecific T hücre engagers (BTEs)]; hedefleme süpresif hücreleri gibi düzenleyici T hücreleri, myeloid kaynaklı bastırıcı hücreler, makrofajlar tümör ilişkili ve kanser ilişkili fibroblastlar (antikorlar, BTEs, sitokinler); ve efektör hücre inhibisyonu ve bitkinlik (denetim noktası inhibitörleri) önlenmesi. Böylece, bir bolluk biyolojik ajanlar kullanılabilir. Bu tür virüs kodlanmış immunomodulators terapötik etkinlik ve olası sinerji ile ilgili olarak hem de kendi mekanizmaları anlama değerlendirilmesi kanser tedavisi geliştirmek gereklidir.

Negatif anlamda tek iplikçikli RNA virüsleri Paramyxoviridae ailesine oncolytic vektör olarak çeşitli özellikler bunların kullanımı için elverişli karakterizedir. Bunlar doğal oncotropism, transgenes (daha--dan 5 kb)10,11, syncytia formasyonu ve yüksek immünojenisite12gibi yayılan verimli geniş genomik kapasite bulunmaktadır. Bu nedenle, Canine distemper virüs13, kabakulak virüsü14, Newcastle hastalığı virüsü15, Sendai virüs16,17, simian virüs 518ve Tupaia paramyxovirus19 temel OV platformlar geliştirilmiştir. En belirgin, canlı zayıflatılmış kızamık virüsü aşı suşları (MV) preklinik ve klinik geliştirme20,21' ilerlemiştir. Bu virüs suşları bir mükemmel Emanet kayıt22ile rutin aşılama için yıllardır kullanılmaktadır. Ayrıca, paramyxovirusler kesinlikle sitozolik çoğaltma nedeniyle insertional mutagenesis için hiçbir risk yok. Transgenes ek transkripsiyon birimleri (ATUs) içine ekleme için sağlayan Anti-genomik cDNA dayalı bir çok yönlü ters genetik sistem mevcut11,23,24' tür. Sodyum iyodür simporter (MV-NIS) viral gen ifadesinin bir surrogate marker olarak görüntüleme ve radyoterapi veya çözünür carcinoembryonic antijen (MV-CEA) için kodlama MV vektörel çizimler klinik deneylere (NCT02962167, NCT02068794, şu anda değerlendirilen NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 ve NCT00408590). Güvenli yönetim doğruladı ve vaka anti-tümör etkinliğinin önceki çalışmalar25,26,27,28,29, rapor 30 (Msaouel et al.31tarafından gözden geçirilmiş), ek oncolytic kızamık virüs, geliştirilen ve preclinically test için önünü. Kanser-bağışıklık döngüsünün farklı adımları hedefleme molekülleri tümör büyüme gecikme ve/veya immün aracılı etkinlik ve uzun süreli koruyucu bağışıklık bellekte syngeneic için kanıt ile fareler, hayatta kalma uzatmak için gösterilen immunomodulatory kodlama MV fare modelleri. Transgenes vektör kodlamalı granülosit-makrofaj koloni uyarıcı faktör (GM-CSF)32,33, H. pylori nötrofil aktive protein34, bağışıklık denetim noktası inhibitörleri35dahil, İnterlökin-12 (IL-12)36, TAAs37ve BTEs38, hangi bir tümör bölünmelerini CD3 ile HCV ve bu nedenle anti-tümör faaliyet T hücre reseptör özgüllük ve Co stimülasyon (bakılmaksızın poliklonal T hücreleri tarafından neden Şekil 1). Bu yapıları talep daha fazla translasyonel çabaları için elde edilen umut verici preklinik sonuçları.

Talimogene laherparepvec (T-VEC), bir tür ben GM-CSF, kodlama herpes simpleks virüsü tek oncolytic tedavi Amerika Birleşik Devletleri Gıda ve İlaç Dairesi (FDA) ve Avrupa İlaç Ajansı (EMA) tarafından onaylanmış olduğunu. Onayları için geç 2015 yılında önde gelen Faz III çalışmada yalnızca gelişmiş melanom39etkinlik içi tumoral enjeksiyon, aynı zamanda abscopal etkileri (yani, remisyon sigara enjekte lezyonların) yerinde gösterilen değil. T-VEC beri ek denemeler kombinasyonu terapileri, özellikle bağışıklık denetim noktası ile değerlendirilmesi ve uygulama diğer tümör varlıklarda (örneğin, Sigara Melanom cilt kanseri, NCT03458117; pankreas kanseri, NCT03086642) için girdi inhibitörleri (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 ve Ribas et al.40).

Bu sadece da OVT ve immunomodulation üstün birleşimlerini tanımlamak daha fazla araştırma ihtiyacını oncolytic immünoterapi potansiyelini gösterir. Ek vektörel çizimler ve preklinik test etmek için geliştirme rasyonel tasarım bu girişim için anahtardır. Bu da temel mekanizmaları anlayışı ilerletmek ve daha fazla kişiselleştirilmiş kanser tedavisi doğru ilerleme için sonuçları vardır. Bu amaçla, bu yayın için değişiklik ve geliştirme için hedeflenen kanserli hastalarda paramyxovirusler ve daha ayrıntılı olarak, oncolytic kızamık virüs T hücre ilgi çekici antikorlar (Şekil 2) kodlama yöntemi sunar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Not: [O], [P] ve [alt bölümleri için geçerli göstermek M]: genel, (en) paramyxovirusler veya yalnızca, MV OVs sırasıyla. [B] bölümleri özel BTE transgenes için gösterir.

1 Immünomodülatör kodlama Transgenes kızamık virüsü vektörel çizimler klonlama

  1. [O] tasarım sıra ekleyin.
    1. [O] karar üzerinde bir Immünomodülatör edebiyat araştırma veya genetik ekranlar41 gibi keşif verileri temel ilgi ve GenBank, Avrupa nükleotit arşiv gibi uygun veritabanları ilgili cDNA sıra türetin veya Uluslararası ImMunoGeneTics bilgi sistemi (IMGT).
    2. [O] ek özellikler transgene sıra (Şekil 3) ekleyin. Bir önceki Kozak sırası ve species-specific Kodon optimizasyonu ifade geliştirebilirsiniz. Sinyal dizileri salgılanması için gereklidir. N - ve/veya C-terminal protein Etiketler algılama ve arıtma42için kodlama dizileri içerir. Vektör içine ekleme için kısıtlama siteleri içerir.
      Not: [M] MV polimeraz geni barındıran ek transkripsiyon birimleri (ATUs) başlatmak ve durdurmak sinyalleri rekombinant MV genleri ifadeden transgene için gereklidir. Uygun Anti-genomik cDNA vektörler, CMV rehberleri ve olumlu anlamda transgenes tanımlanmış pozisyonlarda, giriş için benzersiz kısıtlama sitelerle içeren ATUs tarafından kontrol daha önce11geliştirdik. [P] viral çoğaltma ve transgene ifade ifade degrade paramyxovirusler43için tipik nedeniyle etkiler yeterli transgene konumlandırma çok önemlidir. Anti-genom 3' sonuna yakın bir ATU giriş (i.e., lider konumda veya P gen aşağı akım) genel olarak sonuçları yüksek transgene ifade azaltılmış viral çoğaltma pahasına. Artan çoğaltma ve transgene ifade düzeyi düşük aşağı H gen ATU kullanırken beklenebilir. Ambalaj kızamık virüsü, dahil olmak üzere birkaç paramyxovirusler genomunun her nükleokapsid proteini44tarafından altı nükleotit bağlama gerektirir. Transgenes öyle virüs içine sokmak için komple genom nükleotit sayısı altıya kadar bölünebilir olmasını sağlamak. Bu da "kural altı"45,46anılır. Gerekiyorsa, ek nükleotit olmadan tanıtan çerçeve vardiya veya erken kodon Ekle (Kozak sırası akış yukarı veya aşağı kodonu) ekleyin. [M] MV gen başlangıç (AGGRNCMARGW) benzer ve (RTTAWANAAAA) sinyalleri ve RNA dizileri (AAAAAGGG) düzenleme durdurmak belirli transgene serilerinde kaçının. Böyle bir fikir birliği dizileri yayınlandı (örneğin, Parklar ve ark.47bakınız).
    3. [O] istenen sırayı oligonükleotid satın alabilir veya kullanılabilir dizileri standart moleküler klonlama48kullanarak birleştirin.
      Not: [O] ters yönde kısıtlama site ve ilk 15-20 nükleotit ekleme ve son 15-20 nükleotit ucun aşağı akım kısıtlaması tarafından takip de dahil olmak üzere geriye doğru bir astar gibi ileri bir astar transgene PCR amplifikasyon için Tasarla site.
  2. [O] clone sokmak içine DNA genom viral (anti-) kodlama.
    1. [O] ekleme DNA vektörel çizimler clone ya da DNA RNA virüsleri Anti-genleri standart moleküler klonlama teknikleri48 (DNA ligasyonu tarafından takip yani, enzimatik kısıtlama) tarafından.
      1. [O] uyumlu olmayan kısıtlama siteleri kullanarak veya ligasyonu önce de-fosforilasyon Yöneyin yeniden ligasyonu önlemek.
      2. [O] tüp ligasyonu ürüne göre özel Jel Elektroforez ve piyasada kitleri kullanarak sonraki jel arıtma izole et. Genel olarak, en iyi tüp ligasyonu verimliliği vektör için INSERT molar 3:1 oranında elde edilir.
    2. [O] yetkili bakteri ligasyonu üründe büyük plazmid verimli kurtarma için uygun dönüşüm (yani, Isı şok E. coli49gerçekleştirmek) ve bakteriyel klonlar doğru DNA koloni PCR50 tarafından yataklık tanımlamak .
    3. [O] izole DNA piyasada bulunan DNA hazırlık kitleri kullanarak tek bir bakteriyel klon güçlendirilmiş. Uygun enzimleri ile denetim digest tarafından genomik bütünlüğünü onaylamak (örneğin, HindIII MV genleri [M] için). Sıralama tarafından doğru ekleme ve transgene bütünlüğünü doğrulayın.
      Not: [M] MV H- ATU, eklenen transgenes Sanger gerçekleştirmek için aşağıdaki astar ile sıralama: H-9018 [ileri astar, bağlar MV genom konuma 9018 H çerçeve (ORF) okuma açık]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + ( L ORF 9249 astar, MV genom pozisyon bağlanır ters): 5' CAGATAGCGAGTCCATAACGG 3'.

2. tahlisiye rekombinant kızamık virüs parçacıkları Immunomodulators kodlama

  1. [O] rekombinant virüs parçacıkları (anti-) genomik DNA via transfection virüs yapımcı hücre göre ilgili virüs için standart iletişim kuralı oluşturmak. Steril koşullarda çalışmak için yönergeleri izleyin. Hücre kültürü altında başlıklar, özellikle Sınıf II biyolojik emanet dolapları virüs içeren tüm adımları gerçekleştirin.
    1. [M] için kurtarma kızamık virüs cDNA23,24, MV yapımcı plaka (Afrika yeşil maymun böbrek kaynaklı Vero) hücreler eşit bir tabakta 6-Peki 24 saat önce transfection. Tohum 2 x 105 2 mL % 65-75 confluency transfection anda ulaşmak için de ücret Dulbecco'nın modifiye kartal Orta (DMEM) % 10 fetal Sığır serum (FBS) içeren hücreleri.
      Not: [P] virüs kaynaklı syncytia oluşumu önce hücreleri sarmak hücre sayıları azaltın.
    2. [P] Transfect hücreleri DNA ile viral Anti-genom, gerekli yardımcı plazmid kodlama ve istenirse, bir plazmid kodlama transfection etkinliğini değerlendirmek için floresan bir muhabir.
      1. [M] Mix 5 µg rekombinant DNA kızamık virüs anti-genom, 500 kodlama her memeli ifade plazmid kodlama kızamık virüsü N ve m proteinleri ve 100 ng her P protein ve 200 µL DMEM toplam hacmi floresan bir muhabiri kodlama plazmid ng.
      2. Hemen tüp flicking tarafından karıştırın ve oda sıcaklığında (RT) 25 min için kuluçkaya liposomal transfection reaktif 18.6 µL ekleyin.
      3. [P] değiştirmek orta DMEM, % 2 FBS, 50 µg/mL sefaloridin (veya diğer antibiyotiklere kontaminasyonu önlemek için) ile 1,8 mL iyi, o zaman transfection karıştırmak dropwise kuyuya ekleyin ve dikkatle girdap. Gecede, 37 ° C, % 5 CO2hücreleri kuluçkaya. Orta ile 2 mL taze DMEM, %2 FBS ve 50 µg/mL sefaloridin ertesi gün yerine; Orta asidik hale geldiğinde bu işlemi yineleyin.
        Uyarı: [O] başa hücreleri ve biyogüvenlik düzenlemeler, malzemeleri gibi virüs transfection aşağıdaki adımlarda üzerinden mevcut olabilir. (Potansiyel olarak) bulaşıcı kaybı uygun şekilde atın.
  2. [P] toplamak ve virüs parçacıkları aktarabilirsiniz.
    1. [P] hücre günlük Mikroskopi için muhabir gen ifade ve syncytia oluşumu (Şekil 4) tarafından gözlemlemek. Hasat virüs 20 veya daha fazla hücre oluşan büyük syncytia görünür olduğunda veya hücreleri çok yoğun olunca (i.e., genellikle 7-9 gün sonra birden çok katman içinde büyümeye başladıklarında).
      Not: [P] Eğer hiçbir syncytia için verilen vektör yapı gözlenir, bu mutlaka kurtarma başarısız olduğunu anlamına gelmez. Bulaşıcı virüs yine de örnek mevcut olabilir gibi passaging için taze yapımcı hücreleri aktarın.
    2. [P] tohum yaklaşık 1.5 x 106 üretici hücreler 12 FBS, 10 cm üzerinde beklenen hasat veya 2.5 x 106 hücre başına önce 24 h yemekleri ml DMEM % 10 ile % 65-75 confluency virüs inoculat anda ulaşmak için virüs passaging önce 4-6 h plaka İyon.
    3. [P] virüs Döl toplamak için dikkatle yapisan yapımcı hücreleri kullanarak bir hücre sıyırıcı plaka scrape ve hücreleri içeren bir santrifüj tüpüne süpernatant aktarmak. Santrifüjü 2500 x g de 5 min ve 4 ° c için hücre artıkları çıkarın
      Not: Alıntı hücreleri doğrudan Santrifüjü virüs ertelenmiş suboptimal kültür koşulları ve potansiyel mikroskobu eserler pahasına en üst düzeye çıkarmak için olmadan transfer edilebilir.
      Dikkat: ne zaman hücre kazıma medya dökülmesini [O] kaçının. Aerosol oluşumu en aza indirmek.
    4. [P] inoculum boş hücre süpernatant adım 2.2.3 serum-Alerjik orta ve 4 mL son hacmi ile karıştırılarak hazır olun. Yapımcı hücreleri üzerinde orta inoculum tarafından değiştirin ve hücreler için en az 2 h 37 ° C ve % 5 CO2kuluçkaya. DMEM 6 mL % 10 ile ekleyin FBS ve gecede orta taze DMEM % 10 ile 12 ml değiştirmeden önce hücreleri kuluçkaya FBS.
    5. [P] gözlemlemek günde en az iki kez hücre ve hasat virüs syncytia patlama önce (yanizarı bozulma görünür olduğunda, ). Virüs ilk geçiş hasat için süpernatant plaka, 600 µL serum-Alerjik orta eklemek, bir hücre lifter hücrelerle kazımak ve temiz bir tüp transfer çıkarın.
      Not: [M] virüs suşu51,52 ve enfeksiyon ilerleme bağlı olarak, enfekte hücreleri ile plakalar 32 ° C için viral çoğaltma ve yayılmasını kolaylaştıracak aktarın. Genel olarak, MV Schwarz suşları 32 ° C sonuçlarında daha yavaş syncytia oluşumu ama daha yüksek titreleri Edmonston B zorlanma virüs ile enfekte hücreleri transferi sırasında 37 ° C de yaymak.
      Not: [P] Bu viral parçacıkların azaltılmış infektivite içinde yol açar gibi hasat sırasında kurumaya hücre katmanı hasarların. Bazı virüs ne zaman enfekte hücreleri süpernatant atarak kayıp olmasına rağmen daha yüksek titreleri hücre katmanı elde edilebilir.
    6. [P] hemen virüs süspansiyon sıvı azot dondur. Mağaza için ayrıntılı sağlamak en az 24 saat-80 ° C'de buz gibi. Birkaç gün için yordamı, böldüğüm için gerekirse genişletir.
    7. Viral parçacıkların 37 ° C'de çözdürme tarafından serbest bırakmak Vortexing ve santrifüj 2500 x g de 5 min ve 4 ° c için homojenize Etiketli cryotubes ve mağaza-80 ° C'de supernatants transfer
      Not: [O] virüs sonraki deneyler için yeterli aliquot boyutlarda tercihen yalnızca bir kez çözdürülen ve hemen kullanılan depolamalısınız. [P] daha fazla donma-döngüleri veya depolama viral titreleri önemli azalma birkaç gün sonucu üzerinde 4 ° C'de çözülme.
    8. [P] gerekli miktar ve titresi, elde etmek için daha fazla passaging önce bir gün 4 x 106 yapımcı hücrelerde DMEM 12 mL % 10 ile tohum FBS 15 cm yemekleri. Virüs enfeksiyonu (MOI) 0.03 çokluğu, aşılamak. 8 ml serum-Alerjik orta plaka başına bulaştırmak ve orta DMEM için % 10 ile değiştirin FBS birden çok plakaları kullanarak hücreleri en az 2 h. ölçek için kuluçka sonra.
    9. Hasat açıklandığı gibi adım 2.2.5, ne zaman syncytia bütün hücre katmanı arasında yayıldı. 50 mL tüpler ve süreç içinde elde edilen süspansiyonlar adımları 2.2.6–2.2.7 içinde açıklandığı gibi bilardo.
      Not: [O] Bu hasat önce görsel olarak bakteriyel ve mantar kirlenme için tüm plakaları kontrol etmek önemlidir. Genel olarak, tüm hücre hatları ile Mikoplazma ya da çok katmanlı PCR adventif virüslerin bulaşma için düzenli olarak kontrol edin.
  3. [P] değerlendir viral titreleri. 96-şey plakaları kullanarak aliquot başına octuplicates virüs stoklarının titreleri belirlemek. Virüs kurtarma başına üç bireysel aliquots titrasyon gerçekleştirmek ve deneylerde kullanılmak üzere virüs süspansiyon miktarını hesaplamak için ortalama değerini kullanın.
    1. [P] Yapımcı hücreleri, sayısı ve 1.5 x DMEM mL % 10 ile başına 105 hücre küçültme/büyütme havuzu FBS.
    2. [P] DMEM damlalıklı 90 µL % 10 ile FBS 96-şey plaka her kuyuya.
    3. [P] 10 µL virüs hisse senedi bir aliquot plaka ilk sütundaki tüm 8 wells ekleyin ve yukarı ve aşağı en az 10 kez pipetting tarafından iyice karıştırın.
    4. [P] virüs seri 10 kat dilutions gerçekleştirin. Her kuyudan 10 µL aktarmak çok kanallı damlalıklı kullanarak ikinci sütun için ilk. Yukarı ve aşağı pipetting tarafından iyice karıştırın ve taze damlalıklı ipuçlarını her seyreltme adım için kullanın. Son sütunun her kuyudan 10 µL atmak.
      Not: Her 96-şey plaka için 12 seri seyreltme adımları sağlar. [M] MV vektörler, 10 kat dilutions 8 adımlar genellikle yeterli, 1 x 109 hücre bulaşıcı birimleri yukarıda titreleri olarak (UKÜ) /mL nadiren elde edilir 2.2. adımda anlatılan yayma yöntemi tarafından. [P] denetim wells virüs olmadan ürününü karşılaştırma listesine ve kirlenme izlemek için kullanılabilir.
    5. [P] her şey için hücre süspansiyon, 100 µL ekleyin ve 37 ° c, % 5 CO2 48 h. hücreleri homojen dağılımı elde etmek için süspansiyon hücre kümeleri yokluğu sağlamak için kuluçkaya.
    6. [P] syncytia hafif bir mikroskop kullanarak denetle. Syncytia her iyi sütun görünür syncytia içeren en yüksek seyreltme faktörü ile saymak.
    7. [P] syncytia toplam sayısı sekiz tarafından bölerek syncytia o sütun bir kuyu başına ortalama sayısını hesaplayın. O ortalama 102 UKÜ mL için ilk sütun53 başına başlayan sütun, seyreltme faktörü ile çarpın (bkz Şekil 5 örnek olarak).

3. Viral vektörler Immunomodulators kodlama ikileştirici ve sitotoksik kapasiteleri belirleme

  1. [O] kinetik oluşturulan rekombinant virüs ve değiştirilmemiş vektör tek veya çok adımlı büyüme eğrileri (GCs) ile karşılaştırın. Tek adımlı GCs için viral Döl tüm hücrelerin (teorik olarak, % 100 enfeksiyon) eşzamanlı enfeksiyon takip değerlendirilir. Birkaç takip etmek enfekte hücreleri düşük yüzdesi çok adımlı GCs başında mermi virüs çoğaltma.
    1. [M] kızamık virüsü kinetik analizi için 1 x 105 Vero hücreleri DMEM 1 ml % 10 ile tohum FBS iyi 12-şey plakaları enfeksiyonu önce bir gün başına. Her timepoint ilgi için en az iki kuyu teknik çoğaltır plaka.
    2. [O] bulaştırmak virüs çok adım için düşük MOI veya tek adımlı GCs [M] için yüksek MOI hücrelerle (0.03 ve MV çoğaltma Vero tarih için 3 hücreleri, sırasıyla). Virüs ilgili miktarı içeren serum-Alerjik orta 300 µL ile orta yerine ve 37 ° C ve % 5 CO2 en az 2 h. Kaldır inoculum için kuluçkaya, DMEM 1 mL % 10 ile eklemek FBS ve kuluçka devam.
    3. [P] 12, 24, 36, 48, 72 ve enfeksiyon sonra 96 h gibi ilgili timepoints, viral Döl doğrudan hücre orta kazıma hasat. İçeriği her kuyudan için bireysel bir tüp aktarın, ek-sıvı azot donma ve titrasyon kadar-80 ° C'de depolayın.
      Not: [P] Çoğalt örnekleri ortalama titreleri çözümlenmesi için bu adımı havuza alınmış.
    4. [P] tüm timepoints örnekler toplamak. Aynı anda 37 ° C'de viral Döl değerlendirilmesi için çözülme. Girdap ve Pelet hücre artıkları Santrifüjü 2500 x g ve 4 ° c, 5 min için tarafından
    5. [P] her yapı ve yukarıda açıklandığı gibi timepoint ortalama titreleri hesaplayın. Titreleri zaman içinde arsa. Vektörel çizimler ve eklenen transgenes, farklı transgenes ya da transgenes farklı konumlarda takılı olmayan büyüme eğrileri incelemenizi öneririz (bkz. Şekil 6A).
  2. [O] Immünomodülatör kodlama ve unmodified virüslerin litik faaliyetleri karşılaştırın.
    1. [O] seçin empedans ölçümleri, laktat dehidrogenaz (karaciğer) dahil olmak üzere mümkün metodolojileri tahlil yayınlama veya Renkölçer hücre metabolizması tabanlı canlılık [Örneğin, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT deneyleri ) ve 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) deneyleri].
      1. [M] kızamık sitotoksisite analiz etmek için XTT kullanarak virüs vektörel çizimler tahlil, 3.1.1. adımda açıklandığı gibi tohum Vero hücreleri. Her timepoint için sigara enfekte denetiminin çoğaltır içerir.
        Not: [O] performans XTT tahlil farklı timepoints de aynı örnek üzerinde teknik hatalar sınırlayabilirsiniz, ancak tekrarlanan yıkama ve XTT reaktif maruz hücrelerin sayısını etkiler. Empedans alternatif bir okuma için sürekli ölçümler sağlar.
    2. [M] bir MOI 3.1.2. adımda açıklandığı gibi 1 Vero hücreleri enfekte.
      Not: [M] bazı fare tümör hücre hatları gibi daha az izin veren hedef hücrelerin enfeksiyonu için 3 veya 5 daha yüksek bir MOI gerekli olabilir.
    3. [O] adlı timepoints ilgi (e.g., 12, 24, 36, 48, 72 ve enfeksiyon sonra 96 h) XTT reaktifi (i.e., iyi artı % 10 fazla 300 µL) gerekli miktarda hazırlamak. Işığa maruz kaçının.
    4. [M her timepoint] Orta ilgili kuyulardan kaldırın. XTT reaktif 300 µL tarafından eski yerine koymak ve karanlıkta 37 ° C'de kuluçkaya. Reaktif kontrol Wells genellikle 15 dk ile 2 saat arasında sürer, koyu kırmızı açıldığında supernatants toplamak ve -20 ° C'de dondurmak
      Not: [O] kuluçka kez virüs yapısı, hücre tipi, yoğunluk ve cytopathic etkisi bağlıdır.
    5. [O] toplama sonra tüm örneklerini, çözülme aynı anda. Her örneğinin 100 µL bir 96-şey tabağa aktarın ve optik 450 absorbans ölçmek nm ile 630 nm olarak bir referans dalga boyu.
    6. [O] timepoints (x ekseni) vs. optik absorbans örnekleri denetimler, hücre canlılığı (y ekseni) için bir vekil olarak metabolik etkinliğini göstermek göre arsa. Zaman içinde göreli absorbans azalan viral sitotoksisite anlamına gelir (bkz. Şekil 6B).

4. virüs kodlanmış Immunomodulators salgılanan enfekte hücreleri faaliyetini çözümleme

  1. [O] ayrı tut moduyla salgılanan transgene ürünleri virüs bulaşmış hedef hücreleri tarafından dile getirdi.
    1. [P] virüs yapımcı % 70 confluency T175 şişeler içinde hücrelerin büyümesine izin verin.
    2. [P] Orta hücrelerdeki kaldırmak ve serum kaldırmak için PBS iki kez 12 mL ile yıkayın. Hücre ile virüs 0.03 12 mL serum-Alerjik orta bir MOI, aşılamak ve 37 ° C ve % 5 CO2 adlı gecede kuluçkaya. Orta ile 12 mL taze serum-Alerjik orta yerine.
      1. [M] Edmonston B virüs, hücreleri, kuluçka enfeksiyon kolaylaştırmak ve erken syncytia patlama önlemek için başka bir 24 h için 40 h sonra 32 ° C-37 aktarın. En iyi protein verim ve saflık için51,52 ve syncytia ilerleme, kuluçka sıcaklıklar ve kez virüs suşu bağlı olarak ayarlanabilir.
    3. [P] dikkatle supernatants olmadan önce syncytia patlama ayırmayı hücreleri toplamak. Syncytia en iyi şekilde, tüm hücre katmanı arasında yayıldı. 50 mL tüpler havuzu supernatants.
      Not: [P] için transgene ürün etkili arınma, syncytia patlama önlemek ve hücre artıkları enfekte hücreleri supernatants hasat zaman en aza indirmek.
    4. [P] hücre artıkları süpernatant Santrifüjü 2500 x g ve 4 ° C ve geçen, 5 min için 0,22 µm filtreler aracılığıyla kaldırın. Filtrate toplam hacmine bağlı olarak, bu bir şırınga veya bir vakum pompası kullanılarak gerçekleştirilebilir.
    5. [O] bir uygun arıtma yöntemi kullanarak transgene ürün izole et. Proteinler bir hexa-histidin (onun) etiketi ile Ni-NTA mini spin sütunları38 burada kısaca açıklandığı gibi kullanarak benzeşme Satım Kromatografi tarafından (adımları 4.1.5.1–4.1.5.4) arındırmak.
      Not: [O] hızlı ve buz üzerinde tüm adımları gerçekleştirin. Arabellekleri ve önceden serin santrifüj ile 4 ° c önceden chill
      1. [O] 20 mM (tampon 2, WB2 yıkama) ve 500 mM (elüsyon arabellek, EB) 100 mL her arabellek PBS, 200 mM sodyum klorür ve 10 mm (çamaşır tampon 1, WB1), son konsantrasyonlarda imidazole hazırlamak. PH WB1 ve WB2 8.0 ve EB 7.0 için ayarlayın. Saf bağlı olarak protein, imidazole konsantrasyonları ayarlanması gerekebilir.
      2. [O] WB1 ve açık bir kapak ile 2 min için vasıl 800 x g santrifüj 600 µL sütunlarla equilibrate.
      3. [O] sütun üzerine süzülmüş supernatants 600 µL yükleyin. Kapalı bir kapak ile 5 min için 200 x g de Santrifüjü tarafından sütun matris için O'nun öğesini proteinlerin bağlantısına izin. Yükleme ve bağlama 300 µg O'nun öğesini protein sütun başına düşen toplam tekrar edilebilir.
      4. [O] üç kez WB1 ve WB2 ile ya da akış yoluyla renksiz olana kadar bir kez ile yıkayın. Arabellek ve spin 600 µL 800 x g açık kapak ile 2 min için ekleyin.
      5. [O] protein taze bir tüpe vasıl 800 x g2 min için 300 µL EB ve Santrifüjü ile iki elüsyon adımları uygulayarak elute.
      6. [O] desalt ve ürün büyüklüğüne göre Santrifüj filtreleri kullanarak ürün konsantre. PBS hacmi 15 mL ve filtre yoluyla Santrifüjü 4.000 x gde 10 dakika için ekleyin. İstenen saflık kadar yineleyin ve konsantrasyon elde edilir. Protein konsantrasyonu artırmak için son hacim için yaklaşık 200 µL Santrifüjü 4.000 x gde 40 min için azaltın.
  2. [O] saflık ve ürün kimliğini onaylayın.
    1. [O] bicinchoninic asit (BCA) veya Bradford tahlil54,55gibi standart Renkölçer deneyleri kullanarak yalıtır toplam protein miktarını ölçmek. [M] tipik değerler 1-3 µg transgene ürün mL süpernatant enfekte hücre başına arasında olabilir.
    2. [O] için göreli miktar protein yalıtır ve yolu ile Sodyum Lauryl Sülfat polyacrylamide jel elektroforez (SDS-sayfa) ayrı ve Coomassie56boyama gerçekleştirmek.
    3. [O] belirli antikor protein veya bir ilişkili peptid etiketi57hedefleme kullanarak immunoblotting tarafından arıtılmış ürünler kimliğini onaylamak.
    4. [O] protein bağlayıcı özgüllük enzim bağlı immunosorbent assay (ELISA) içeren veya akış sitometresi uygun yöntemlerle analiz (bkz. Şekil 7). Son zamanlarda açıklanan manyetik açılan tahlil38kullanarak hücre bağlama onaylanabilir.
      Not: [O] uygun denetimleri kullanın. Hücre bağlama deneyleri, hedeflenen molekül ( Şekil 9gibi) cinsinden ifade değil hücreleri ve hedefleme-protein vekilleri (Şekil 8) ile olumsuz denetimler bulunur. Akış Sitometresi denemelerinde olumlu, dahil negatif ve izotip kontrol eder (Şekil 7).
      1. [O] ortak hedef kuluçkaya hücreleri ve protein izole bağlantısına izin için. [B] periferik kan BTEs analizini bağlama için mononükleer hücreler (PBMCs) insan kanı58, izole kuluçkaya 2.5 x 200 106 hücrelerle BTE ng PBS 100 µL % 1 içinde FBS (bağlama arabellek, BB) buz üzerinde 1 h için.
      2. [B] yıkama hücrelerle BB ilişkisiz protein kaldırmak için 1 mL. 300 x g 5 min için de santrifüj kapasitesi, süpernatant atmak ve Pelet BB 100 µL içinde resuspend. Biotinylated antikor protein ilgi veya bir ilişkili peptid etiket hedefleme ekleyin ve buz 30 dk için kuluçkaya. Grip hemagglutinin (HA) etiketi, kullanım 100 ng anti-HA-biotin (klon 3F10) ile BTEs için.
      3. [B] 1 mL BB iki kez hücrelerle yıkama ve BB 80 µL içinde resuspend. Manyetik lastikteki streptavidin birleştiğinde 20 µL ekleyin ve 4 ° C'de 15 dakika kuluçkaya
      4. [B] aşırı boncuk kaldırmak ve 2 mM EDTA (sütun arabellek, CB) ile desteklenen BB 500 µL Pelet resuspend için bir kez yıkama.
      5. [B] hücreleri sütunlar ve sağlayıcının kılavuzuna göre manyetik bir stand izole et.
        1. [B] sütunu boyunca yerçekimi akış tarafından geçmesi için CB 500 µL izin vererek equilibrate.
          Not: [B sütun hiç kuru çalıştırmanız gerekir. Damlalıklı dikkatle ve kabarcıklar önlemek için arabellekleri degas.
        2. [B] sütununun altında temiz bir tüp yerleştirin ve hücre/boncuk süspansiyon sütun için geçerlidir. Sütun CB 500 µL yıkama başına üç kez yıkayın. Örnekler süspansiyon ve en az ilk çamaşır adımda tüp akışı aracılığıyla toplamak sonra buz üzerinde depolamak.
        3. [B] boncuk bağlı hücreler tarafından manyetik alan muhafaza elute. Bu amaçla, manyetik standından sütun kaldırmak, temiz bir tüp yerleştirin, CB 1 mL ekleyin ve hızlı bir şekilde arabellek sütunu boyunca bir dalgıç kullanarak tüp içine itin. Tüp buz üzerinde tutun.
      6. [B] santrifüj tüpleri içeren akış yoluyla ve elüsyon örnekleri 16.000 x g ve hücreleri cips 4 ° C, 20 dk için. Supernatants atmak ve radioimmunoprecipitation tahlil (RIPA) arabellek hücreleri parçalayıcı (önerilen: 75 µL). SDS-sayfa56gerçekleştirin.
      7. [B] immunoblotting uygun bir birincil antikor kullanarak gerçekleştirin. Antikorlar hedef transgene ürün veya hücresel protein (e.g., β-aktin, Şekil 8) BTE hücreli bağlama değerlendirmek için.
  3. [O] izole immunomodulators immünolojik işlevselliğini değerlendirmek.
    1. [O] ilgili deneyleri kodlanmış Immünomodülatör özelliklerine göre tanımlayın. Beklenen immunomodulatory aktiviteyle ilgili geçiş, olgunlaşma, etkinleştirme veya sitotoksisite hücre çoğalması, değerlendirme yöntemleri uygulanabilir.
      Not: [O] hücre çoğalması CFSE59 etiketleme veya Ki67 boyama60tarafından çözümlenebilir. Transwell veya çizik deneyler hücre göç61analiz etmek kullanılabilir. Olgunlaşma ve Hücre aktivasyonu için ilgili işaretleri uygun boyama protokolleri kullanarak tespit edilebilir. [B] hücresel sitotoksisite BTE aracılı değerlendirmek için kullanılabilir teknikler şunlardır empedans ölçümleri ve krom yayın tahlil. Krom sürüm tahlil için gözle, radyoaktif malzeme işleme uygun güvenlik önlemleri gözlemleyebilirsiniz.
    2. [B] radyoaktif olmayan bir alternatif olarak, aşağıda ayrıntılı olarak karaciğer yayın tahlil (daha önce açıklanan kısa38) tarafından BTE kaynaklı, hücre-aracılı sitotoksisite değerlendirmek açıklar.
      1. [B] karar koşullara deneme sırasında test edilecek (örnek olarak bkz: Şekil 9 ). Timepoints (gün saat) konsantrasyonları Immünomodülatör (µg/ml pg/mL) ve efektör hedef hücre (E:T) oranları (1:50 ve 50: 1, örneğin arasında) değişmekteydi. Her zaman triplicates örneklerinde hazırlayın.
      2. [B] örnekleri olmadan protein içerir ve olmayan efektör hücreler, spontan karaciğer denetimlerinde tek hücre türleri (Tsp ve Esp), bir hedef hücre maksimum lizis denetimini (Tmax) okuma önce bir orta eklendi deterjan ile bırak Sadece kontrol ve ses kontrolü için Tmax.
        Not: [B] gerekli sayıda hedef hücreleri ve kuluçka süreleri değişiklik gösterebilir. İlk test çalıştırmalarını efektör hücreleri ve immunomodulators en uygun parametreleri belirlemek için olmadan gerçekleştirmek. Tsp ve Tmax örnekleri ve farklı hücre sayıları ve timepoints değerlendirmek için ilgili denetimleri içerir.
      3. [B] (yoğunluk gradient Santrifüjü insan kanı PBMCs58 elde etmek için) ya da fare splenocytes62fare T hücre negatif seçim tarafından Örneğin, bağışıklık efektör hücreleri izole et.
      4. [B] tohum hedef hücreleri adım 4.3.2 göre (örneğin, 5 x 10³ iyi başına) bir U-alt 96-şey plaka.
      5. [B] ilgili örnekleri için istenen konsantrasyonlarda izole protein ekleyin. Bağışıklık efektör hücreleri istenilen oranlarıyla ekleyin. Orta bir şey başına 100 µL hacmi ekleyin.
      6. [B] Incubate için belirlenen zaman dilimi içinde adım 4.3.2, tipik arasında 4 ve 48 s (24 unstimulated PBMCs için ve taze izole fare T hücreleri için; 48 saat daha kısa kuluçka süreleri için prestimulated bağışıklık hücreleri uygulayabilirsiniz s), 37 ° C ve % 5 CO2' de.
      7. [B] örnekleri, toplama önce 45 dakika 10 x lizis çözüm 10 µL Tmax örnekleri ve karşılık gelen orta denetimleri içeren wells için ekleyin. Kuluçka devam.
      8. [B] 250 x g 4 dk. Transfer 50 µL her süpernatant düz-alt 96-şey plaka için için hücreleri aşağı spin. Hücreleri hücre bağlı karaciğer önlemek için aktarılmaz.
      9. [B] üreticiye göre substrat çözeltisi hazırlamak. Her şey için 50 µL ekleyin ve RT 30 dk ya da koyu kırmızı Tmax örnekleri çevirmek kadar karanlıkta kuluçkaya.
      10. [B] 50 µL durmak eriyik için her şey ekleyin. Hava kabarcıkları Santrifüjü 1 dk 4000 x gve el ile içi boş bir iğne ile çıkarın. Ölçmek optik absorbans 490 nm.
      11. [B] her örnek % belirli lizis değerlerini hesaplamak.
        1. [B] ortalama orta denetimleri ile ve lizis çözüm olmadan çoğaltır için hesaplayın. Elde edilen değerler deneysel örnekleri ve Tmax ve spontan yayın denetimleri, sırasıyla çıkarma. Bu arka plan-düzeltilmiş değerleri daha da hesaplamalar için kullanın.
        2. [B] Ortalama arka plan-düzeltilmiş Tmax, Tspve Esp denetimler için hesaplayın. Bu ortalama değerleri kullanarak, aşağıdaki denklemi her örnek için belirli lizis yüzdesini verir:

          Equation 1
        3. [B] protein konsantrasyonu vs % belirli lizis değerleri veya E:T oranı çizmek ve hedefleme-kontrol örnekleri için karşılaştırın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 1 oncolytic kızamık virüs bispecific T hücre engagers kodlama etki mekanizması gösterilmiştir. Bu protokol iş akışı gösteren bir akış çizelgesi Şekil 2' de sunulmuştur. Şekil 3 değiştirilmiş oncolytic kızamık virüsü genom bir örneği gösterilir. Bu kızamık virüs anti-genom ve belirli özellikleri eklenen transgenes için uygulanan belirli değişiklikleri görsel bir gösterimini sağlar. Tipik kızamık virüs kaynaklı syncytia Şekil 4' te tasvir edilmektedir. Yüksek hücre yoğunluğu, cep numarası ne zaman deneme yinelenen azalabilir gösteren kurtarma (A, B), hasat timepoint unutmayın. Kuluçka sıcaklıklar ve - kez Vero hücreleri (C, D) plaka arasında geliştirilmiş yayılma syncytia ulaşmak için passaging için optimize edilmiş. Şekil 5 , tipik titrasyon tahlil sonucunu temsil eder. Şekil 6, tek adımlı büyüme eğrileri (A) ve (B) sonra aşı değiştirilmemiş (MV) ve BTE kodlama ile göreli hücre canlılığı oncolytic kızamık virüs (MV-H-mCD3xhCD20) gösterilir. Büyüme eğrileri ile karşılaştırıldığında vektörlerin Vero hücreleri üzerinde benzer görünür iken, transgene kodlama virüs litik faaliyet fare tümör hücre hattında kalıyor. Akış Sitometresi veri hücrelerinin beş farklı dilutions BTEs ile inkübe hedef antijen ifade BTE bağlama hücreleri tarafından bir konsantrasyon bağımlı şekilde gösteren Şekil 7' de sağlanır. Şekil 8 sonra BTE ilişkili hücre manyetik açılan bir örnek immunoblot temsil eder. Elüsyon kesir, ilişkili hücrelerin gösterge bantlarında BTE örnekleri (t1, t2) hedefleme için gözlendi, ancak açılan hedefleme-BTEs (n1, n2) ile hücreleri, saptanabilir miktarda vermemiştir. BTE-aracılı, hedef antijen spesifik ve konsantrasyon bağımlı sitotoksisite fare T hücrelerinin Şekil 9bir temsilcisi karaciğer yayın tahlil simgesiyle gösterilir.

Figure 1
Resim 1 : Bispecific T hücre engager (MV-BTE) kodlama oncolytic kızamık virüs etki mekanizması. Enfeksiyon tümör hücresinin (enfekte: gri, bulaşmamış: açık mavi) MV-BTE ile viral çoğaltma ve yaymak ardından tümör hücre lizis ve bağışıklık stimülasyon içinde kaynaklanan tümör boyunca. Aynı anda, [iki tek zincirlerinin CD3 T hücreleri (sarı) ve bir tümör yüzey antijeni (mavi) hedefleme antikorlar türetilen oluşan] BTEs üretilen ve yerel olarak virüs bulaşan hücreleri tarafından salgılanan. BTE aracılı tümör hücreleri ile ilişkilendirerek istirahat, daha fazla tümör hücre öldürme kaynaklanan poliklonal T hücreleri harekete geçirmek neden olmaktadır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : İş akışı tasarlama, üretme ve immunomodulatory transgenes kodlama roman viral vektörler değerlendirilmesi açıklayan akış çizelgesi. 1-4 arasındaki adımları protokol ilgili bölümlerini yansıtır. Madde işareti noktalarının ilgili dikkat edilecek noktalar ve adımlar gösterir. Yordamı deneysel doğası gereği, ayarlamalar veya ayrıntılandırmaları herhangi bir iş akışı adımında gerekli hale gelebilir. Buna ek olarak, deneysel bulgular için yeni hipotezler kurşun ve ek vektörel çizimler veya kombinasyon tedavileri geliştirilmesi ilham. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : Kızamık virüsü genom şematik gösterimi. Gelişmiş yeşil flüoresan protein (eGFP) bir ek transkripsiyon biriminde lideri (ld) dizisinin aşağı kodlanır. N, P, M, F, H ve m differentially görüntülenir olarak ifade edilir kızamık virüsü Yapısal proteinler nükleoprotein, P protein, matris protein, Füzyon protein, hemagglutinin protein ve büyük protein (polimeraz), sırasıyla, kodlama genler tayin yukarıda. Bispecific T hücre engager (BTE) transgene bir ek transkripsiyon birimi H açık okuma çerçevesi (ATU) aşağı eklenir. Transgene grip hemagglutinin (HA) yanı sıra verimli salgılanması için bir Igκ lideri peptid ve hexa-histidin (onun) protein Etiketler algılama ve arıtma için kodlar. Değişken ağır (VH) ve hafif zincir (VL) etki alanları CD3 ve CD20, sırasıyla, hedefleme antikorların kodlama genler glisin (G) ve serin (S) artıkları içeren bağlı yolu ile peptid bağlayıcı sıraları bulunmaktadır. Transgene sıra Kozak sıra ile öncesinde. Kodlama alt bölge, ek nükleotit exemplarily altı olan kural uymak için dahil edilmiştir. INSERT kaset ilgili ATU içine ekleme etkinleştirme iki kısıtlama siteleri tarafından çevrili olduğunu. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 : Kızamık virüs kaynaklı syncytia. (A, B) Vero hücreleri ile cDNA rekombinant kızamık virüs gelişmiş yeşil flüoresan protein (eGFP) ve fare CD3 ve insan CD20 hedefleyen bir bispecific T hücre engager (BTE) kodlama kurtarılması için transfected. Floresan syncytium (beyaz ok) varlığını bulaşıcı virüs kurtarma görevi gösterir. (C, D) Kızamık virüs kurtarma sonra hasat ve Vero hücreleri (Bölüm 1) yayılır. Büyük syncytia oluşturdular ve zaten patlama (sarı ok) başlıyor. Görüntüleri faz kontrast (B, D) ve floresan mikroskopi tarafından uyarma sonra 80 ms (A) ve 100 ms (C) elde. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5 : Temsilcisi titrasyon tahlil sonucu. Titrasyon üçüncü geçiş toplu işleminin MV-H-mCD3xhCD20, bir BTE kodlama oncolytic kızamık virüsü, Vero hücreleri üzerinde. 10 kat seri seyreltme 96-şey tabağa gerçekleştirildi, virüs süspansiyon sütun 1. her iyi 10 µL ile başlayan hiçbir syncytia sıfır tarafından belirtildiği gibi 7, sütununda görünür. Virüs süspansiyon 6 sütundaki sonraki en düşük seyreltme için mL virüs süspansiyon başına yaklaşık 6 x 107 hücre bulaşıcı birim (UKÜ) son bir titresi sonuçlanan altı syncytia iyi başına ortalama gözlendi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6 : Kinetik ve rekombinant kızamık virüs litik etkinlik. (A)tek adımlı büyüme eğrileri Vero hücreleri değiştirilmemiş oncolytic kızamık virüsü (MV) veya bir MOI 1 adlı bir bispecific T hücre engager (MV-H-mCD3xhCD20) kodlama kızamık virüsü ile enfeksiyon sonra oluşturulan. Viral Döl titreleri belirlenen timepoints benzer virüs kinetik belirten enfeksiyon sonra değerlendirildi. Anlamına gelir ve standart sapmalar (her iki biyolojik çoğaltır timepoint başına dört teknik çoğaltır) sekiz örnekleri gösterilir. (B) hücre canlılığı MC38 fare kolorektal karsinom değerlendirildi hücreleri stabil insan carcinoembryonic antijen ve MV reseptör CD46 ifade (MC38-CEA-CD46) aşı orta tek (sahte) veya bir MOI 1 belirtilen virüslerle ile sonra. XTT hücre canlılığı tahlil belirtilen timepoints gerçekleştirildi. Hücre canlılığı azalma, değiştirilmemiş vektör için önceki timepoints gözlendi. Değerleri üzerinden %100, 12 h timepoint, MV-H-mCD3xhCD20 için hesaplanan olarak sık sık hücresel stres nedeniyle olabilir enfeksiyon kısa bir süre sonra gözlenen veya virüs süspansiyon hücre kaynaklı etkenler mevcut. Ortalama değerleri artı standart sapmalar üç teknik çoğaltır, her timepoint için gösterilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 7
Şekil 7 : Hedef hücre bağlama bispecific T hücre engagers (BTEs) tarafından ifade kızamık virüs bulaşan hücreleri. İnsan mantle hücreli lenfoma hücreleri endogenously ifade CD20 (Granta-519) Fc reseptörü, 2, 4, 6, 8 veya 10 µL(a)saf mCD3xhCD20 BTE çözüm, kuluçka sırasıyla ardından engellemek için insan immünoglobulin ile G inkübe. BTE bağlı hücre phycoerythrin (PE) kullanarak algılandı-Konjüge antikor BTE ilişkili HA-etiket hedefleme. Yüzdeleri lekeli hücre BTE konsantrasyonları ile ilişkili. (B) denetimleri seçicilik ve özgüllük bağlama için. Denetimleri bağımsız bir deneme burada gösterilir, bir örnek her hücre de dahil olmak üzere BTE ile ama BTE hedefleme antikor sadece (kontrol hücreleri antikor belirsiz bağlama için) veya faiz hücrelere bağlamak için bilinen bir BTE ile inkübe değil , kuluçka BTE hedefleme antikor (pozitif kontrol) ya da bir izotip antikor ile izledi. Varsa, isogenic hücreleri hedef antijen tercih ifade değil daha fazla bağlama seçicilik doğrulamak için kullanılabilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 8
Şekil 8 : Manyetik açılan insan periferik kan mononükleer hücreler (PBMCs) tarafından virüs kodlanmış kızamık BTEs bağlı. Hücreleri insan T hücre hedefleme (t1, t2) veya denetimin hedefleme-BTEs (n1, n2), iki farklı toplu işleri sırasıyla inkübe. BTE bağlı hücre manyetik boncuklar kullanarak sütunlarda muhafaza, pelleted ve lysed. Β-aktin lysates içinde immunoblotting tarafından tespit edildi. Yoğunluklarda elüsyon örneklerinde gruplarından göreli BTE hücreli bağlama belirtin. Numuneler akışı aracılığıyla tüm örneklerini hücrelerde varlığını doğrulamak. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 9
Şekil 9 : Kızamık sitotoksik etkinliği virüs olarak kodlanmış BTEs. Hedef tümör hücreleri (5 x 10³ B16-CD20-CD46 hücreleri de başına) 1:50 oranında fare T hücreleri ile inkübe. Daha önce MV-H-mCD3xhCD20-enfekte hücreleri süpernatant saf BTEs belirtilen konsantrasyonlarda eklenmiştir. BTE eksik 48 h. hücreler antijen (B16-CD46) antijen spesifik sitotoksisite değerlendirmek için referans olarak hizmet hedef sonra hedef hücre göreli lizis karaciğer yayın tahlil tarafından değerlendirildi. Araç artı üç teknik çoğaltır örnek başına standart sapmalarının gösterilir. Hedef hücreler antijen ifade özellikle bir BTE konsantrasyon bağımlı şekilde lysed. BTE ürün ve hedef antijen ifade düzeyleri etkisi hücre öldürme saflığı. Mevcut örnek, bir nispeten yüksek BTE konsantrasyonu 1 µg/ml % 15 belirli hücre öldürme elde edildi. Bu uzun bir eş kuluçka kez ve suboptimal T hücre kültür koşulları ile deneysel bir kurulum için tipik bir değerdir. Diğer ayarları'nda, yukarı % 60 belirli öldürme MV-enfekte supernatants saf BTEs 100 ng/mL ve daha yüksek38BTE konsantrasyonları bir plato ulaşan kullanarak sağlanır. Bu counter-intuitively, bu tahlil sınırı % 100'den az olduğunu gösterir Tmax denetimlerde ortak kültür örnekleri için karşılaştırıldığında farklı büyüme kinetik tarafından açıklanabilir belirli öldürme. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolytic immünoterapi (i.e., immunomodulation ile birlikte OVT) kanser tedavisi, daha da geliştirilmesi ve optimizasyonu immunomodulatory protein kodlama oncolytic virüslerin talep için büyük söz sahibidir. Bu iletişim kuralı oluşturmak ve ilgili preklinik modelleri ve potansiyel gelecek klinik çeviri roman anti-kanser tedavi içine sonraki test etmek için böyle vektörel çizimler doğrulamak için yöntemler açıklanır.

Çok sayıda farklı oncolytic virüs farklı avantajlar ile kullanılabilir63platformlarına. Kanser özgüllük vektör, üretim için gereksinimleri, güvenlik etkinliğini tümör hücre lizis ve bağışıklık yanıtı indüksiyon ek olarak, kapasite klonlama belirli bir oncolytic kullanarak immunomodulators başarılı vectorization için anahtardır. Ne yazık ki, doğrudan karşılaştırmalar farklı OVs Şu anda eksik ve bireysel hasta için en uygun tedavi seçenekleri tanımlamak için takip edilmelidir. Bu rasyonel geliştirme teşvik ve Roman vektörlerinin transgene kodlama, test burada MV-BTE için olarak kolaylaştırılabilir. MV (yani, oncotropism, Emanet, fusogenicity, immünojenisite, fizibilite genetik modifikasyon) yararlı özellikleri göz önüne alındığında bu iletişim kuralı diğer OV, özellikle paramyxovirusler için genelleştirilmiş bu oncolytic vektör üzerinde duruluyor .

Aday transgenes (adım 1.1.1) olarak potansiyel olarak ilgili immunomodulators bir rasyonel seçim için kanser-bağışıklık döngüsü kapsamlı bir anlayış sistematik edebiyat araştırma vazgeçilmez yapmak esastır. Ayrıca, büyük ölçekli ekranlar, ama pahalı, roman hedefleri tanımlamak için değerli kanıtlayabilirim (örneğin, bkz: Patel vd.41).

Rekombinant OVs tasarımı için istenen ifade profilleri düşünülmelidir. RNA virüsleri söz konusu olduğunda, gen ekspresyonu RNA düzeyde ilgili polimeraz tarafından kontrol edilir. MV polimeraz geni Başlat/Durdur sinyalleri ve siteleri düzenleme ve altı kural takip RNA benzer dizileri kaçınarak transgene kaset MV genleri (adım 1.1.2) içine eklenmek tasarlarken, başarılı vektör gelişimi için önemlidir. Ayrıca, paramyxovirus gen ifade düzeyleri düşük bir ifade degrade43sonuçlanan soykırım içinde konumlandırma için karşılık gelir. Genel olarak, bir ters yönde pozisyon transgene konumlandırma pahasına sınırlı çoğaltma ifade artırır. Ancak, bu parametreleri boyutunu, yapısı ve ilgili transgene dizisi üzerinde bağlıdır. Sonuç olarak, bu protokol için açıklanan metodoloji sınırlamasından ampirik roman vektör tasarımları test etmek için ihtiyaç vardır. İçinde özel durumlarda, ayarlamalar transgene diziye veya konumlandırma istenen vektör özellikleri (Şekil 2) elde etmek gerekli olabilir. Farklı pozisyonlar için denetim noktası antikor sistematik karşılaştırılması gösterdi en iyi sonuçları H- ATU (yayınlanmamış veri) ekler. BTE ekler karşılaştırılabilir Özellikler (boyut ve immünglobulin etki alanları) gibi MV-BTE vektörel çizimler mahsum klonlanmış38.

Bulaşıcı parçacıkların virüs cDNA (adım 2.1) kurtarma bazı yapıları için çeşitli girişimlerde gerektirebilir. Cep numaralarını ayarlama hücre yoğunluğu syncytia oluşumu için en iyi duruma getirebilirsiniz. Belirli bir yoğunluk verimli hücre hücre yaymak ve hücre zarlarında füzyon için gerekli olmakla birlikte, temas inhibisyonu viral çoğaltma azaltır. Ayrıca, bulaşıcı parçacık sayısı görünür hücre füzyon ikna etmek yeterli olmayabilir. Ancak, virüs syncytia yokluğunda mevcut olabilir gibi kurtarma örnekleri yine de hasat ve taze yapımcı hücrelere potansiyel yayma için transfer. DNA kalitesiz veya uygun olmayan veya bozulmuş transfection reaktifler nedeniyle verimsiz transfection değerlendirmek ve yeni DNA ürünleri üreten ve farklı reaktifler, sırasıyla test çözmek nispeten kolay tipik sorunlar temsil eder.

Başarılı virüs yayma (adım 2.2) en önemlisi viral çoğaltma ve hücre lizis belirleme koşullara bağlıdır. Düşük geçiş numaraları yapımcı hücrelerin kullanılması önerilir ve enfekte hücreleri syncytia ilerleme için düzenli olarak kontrol edilmesi gerekir. Cep numaralarını ayarlama, sıcaklık ve kuluçka süreleri viral yayılmış vs. hücre çoğalması dengelemek için gerekli olabilir.

Bir çok önemli virüs üretim açıklanan yöntemi virüs süspansiyonlar ham hücre lysates üzerinden hazırlanması kısıtlamasıdır. Araştırmacılar virüs süspansiyon hücresel faktörler içerir bilincinde olmalıdır. Virüs parçacıkları konsantre yolu ile yoğunluk degrade/sükroz yastık ultrasantrifüj bulaşıcı parçacıklar ve hücresel artıkları da potansiyel olarak artan konsantrasyonları toplam sayısı pahasına olabilir. Virüs-ebilmek da var olmak saflık artan ama toplam azaltılması enfekte hücre supernatants, konsantre. GMP ve büyük ölçekli üretim paramyxovirusler genellikle birden çok katman Biyoreaktörler net bir filament üzerinde artan titresi verim için63numaralı seribaşı yapımcı hücre kullanarak gerçekleştirilen. Doğru izleme, sürekli ortam değişimi, serum-Alerjik koşullar ve sonraki filtrasyon adımları üretilen virüsün yüksek saflıkta emin olun.

Viral titreleri (adım 2.3 ve 3.1) yolu ile değerlendirilmesi açıklanan syncytia yöntemi sayma kesin, değil ama yapmak kolaydır ve yeterince doğru teknik yeterli sayıda kullanırken çoğaltır. OV-aracılı sitotoksisite (adım 3.2) değerlendirirken, kullanılabilir deneyleri sınırlamaları dikkate alınması gerekir. Metabolik deneyleri deneysel tedavilerinin sitostatik ve cytolytic etkileri arasında ayrım yapmamak. Cytolysis ölçmek için bir karaciğer yayın tahlil gerçekleştirilebilir. Ancak, her iki tip deneyleri virüs ürünleri ham hücre lysates (Şekil 6) üzerinden içeriğini etkilenebilir.

Yalıtım proteinlerin virüs bulaşan hücreleri (adım 4.1) tarafından büyük ölçüde verim ve saflık, ilgili transgene ve virüs kullanılan bağlı olarak hem de teknik doğruluk değişebilir. Böylece, kalite kontrol protein arınma ilgili deney sonuçlarının değerlendirilmesi için çok önemlidir.

Potansiyel fonksiyonel deneyleri mümkün immunomodulators çok çeşitli kapsayan ayrıntılı bir açıklamasını bu yayın kapsamı dışında olduğu için bu iletişim kuralını hücresel sitotoksisite (adım 4.3) ölçmek için ex vivo metodoloji odaklanır. CD8 + T hücreleri, tarafından özellikle hücresel sitotoksisite başarılı immunotherapies64immünolojik tümör kontrolünde önemli bir aracı konumundadır. Bu özellikle genel olarak anti-tümör bağışıklık yanıtı geliştirmek için antikorlar kullanarak geçerli immünoterapi yaklaşımlar ve bispecific T hücre engagers için önemli sonuçları vardır. Yerel BTE ifade oncolytic vektörler tarafından38 RNA ve DNA virüsleri65,66,67,68de dahil olmak üzere birkaç preklinik çalışmalarda umut verici sonuçlar doğurdu.

Tümör, virüs, transgene ürün ve ana bilgisayar bağışıklık sisteminde canlıların karmaşık etkileşimler nedeniyle, burada tedavi sonuçları tahmin etmek yeterli değildir gösterildiği gibi hücre kültüründe Immünomodülatör kodlama oncolytic doğrulanmasını vektörler. Önemlisi, vektör ve Immünomodülatör işlevleri, önerilen izole değerlendirilmesi sırasıyla, kavram kanıtı için önemlidir ama potansiyel sinerjiler ve karmaşık etkileşimler tümör microenvironment içinde tanımlamak başarısız olur. Toksisite ve ilgili içinde vivo modellerinde etkinliği için test daha fazla roman rekombinant vektör gelişimi oluşturur ancak değil kolayca gerçekleştirilir için çok önemlidir. İmmünolojik Emanet gibi makaklar, insan olmayan primatlarda düzenli olarak izlenir ve fare modelleri biodistribution için kullanılır ve etkinlik20,69inceliyor. Ancak, çoğu bu modellerin ana bilgisayar doku ve ana bilgisayar ahlaksızlığın virüs reseptörleri ifade ile ilgili sınırlamalar, ve bazı sadece yeterince OV, tümör ve bağışıklık microenvironment karmaşık etkileşimi taklit. Böylece, uygun modelleri dikkatli değerlendirilmesi zorunludur.

MV-BTE tedavi daha önce insan xenograft ve syngeneic fare modelleri değerlendirilmiştir. BTE transgene ürünleri BTE kodlama MV38ile tedavi farelerin serumda saptanabilir, sistemik maruz kalma başarılı önleme bile olmadan gösteren daha fazla zayıflama doğal olarak oncotropic aşı suşu virüs. Yerel ifade toksik sistemik yönetilen zaman olan OV kodlanmış immunomodulators için önemlidir. Gerekirse, tümör özgüllük yeniden seçim70,71,72 ve de-gelişmiş oncotropism73,74 () için hedefleme mikroRNA tabanlı yüzey işaretleyicileri hücresine hedefleyerek gelişmiş olabilir «««değerlendirme) Ruiz ve Russell75tarafından. Ek değişiklikler tanılma77,78 veya prodrug için transgenes ekleme de dahil olmak üzere (Miest ve Cattaneo76tarafından gözden) belirli tedavi kullanımlar için vektörel çizimler optimize etmek için tanıttı kemoterapi79,80, güvenlik giriş yan etkileri en aza indirmek için dönüşüm81ve tümör stroma veya damarlara (örneğin, üzerinden bispecific antikorlar82) hedefleme geçer.

Viral vektör genetik değişiklik dışında83,84,85,86kemoterapi veya radyoterapi87, kombinasyonu rejimlerinin chimeric antijen reseptör (araba) T hücre ile aktarım 88 , 89 daha fazla çoğaltmak OVT repertuar. MV dokunulmazlığı son derece yaygın olduğu için antikor nötralizasyon engelleyecek stratejiler, zarf glikoproteinlerin o ilgili paramyxovirusler90, için değişimi de dahil olmak üzere geliştirilmiştir polimer kaplama hücre taşıyıcılara kullanarak parçacıkların virüsler ve geçici immünosupresyon (Russell ve ark.6tarafından gözden) sunar. Daha da geliştirilmesi gelişmiş OV immünoterapi rejimleri, Emanet ve tedavi edici etkinliği hasta malzeme, uygun hayvan modellerinde ve sonuçta, kontrollü klinik çalışmalarda test gerektirir.

Olası kombinasyon bolluk göz önüne alındığında, kapsamlı test mümkün değildir. Matematiksel modelleme potansiyel kombinasyonu rejimlerinin önceliklendirilmesi yanı sıra onların anılan sıraya göre dozaj ve silis (Santiago vd.91tarafından gözden) tedavi sonuçlar oluşabileceğini tarafından planlama yardımcı olabilir. Efficacies roman sınarken, mantıklı bir şekilde tasarlanmış vektörel çizimler, translasyonel araştırma eşlik eden ses temel virolojik ve immünolojik süreçleri daha derin bir anlayış için vesile. Bu genel olarak uygun modelleri, daha fazla potansiyel hedefleri ve gelişme alanında bilgi üretimi için önemlidir. Sonuç olarak, ilk elden ilgili yöntemleri vektör tasarımı, üretimi ve karakterizasyonu Bu işimde içgörü hızlandırmak ve Roman therapeutics keşfi gelecek klinik çeviri için destek.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

CE Engeland kanser Heidelberg Üniversitesi tarafından sahip olunan Immunovirotherapy için bir patent ile ilgili olarak RNA virüsleri eş mucidi olarak listelenir. J.P.W. Heidbuechel ifşa etmek yok.

Acknowledgments

Bu yöntemler Virotherapy tümör hastalıkları Heidelberg için Prof. Dr. Dr. Guy Ungerechts Ulusal Merkezi liderliğindeki grup kuruldu. Biz onu ve laboratuvar ekibi, özellikle Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler ve Jessica Albert tüm üyeleri için borçlu bulunmaktadır. Bu eser başka Kröner-Fresenius-Stiftung tarafından desteklenmiştir (Grant 2015_A78 CE Engeland için) ve Alman Ulusal Bilim Vakfı (DFG, C.E. Engeland için EN 1119/2-1 vermek). J.P.W. Heidbuechel bir maaşa Helmholtz International Graduate School tarafından kanser araştırmaları için alır.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics