ТРИФОСФАТЫ опосредованной редактирование генома человека грибкового патогена Candida albicans

* These authors contributed equally
Genetics
 

Summary

Эффективное генома техники Candida albicans имеет решающее значение для понимания патогенеза и развитию терапевтических средств. Здесь мы описали протокол быстро и точно редактировать с помощью ТРИФОСФАТЫ генома C. albicans . Протокол позволяет следователям представить широкий спектр генетических модификаций, включая точечные мутации, вставок и удалений.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Этот метод описывает эффективного изменения генома ТРИФОСФАТЫ опосредованной диплоидных человека грибкового патогена Candida albicans. ТРИФОСФАТЫ опосредованной генома редактирования в C. albicans требует Cas9, руководство РНК и ремонт шаблон. Плазмиды, выражая дрожжи кодоном оптимизированный Cas9 (CaCas9) был создан. Руководство последовательности прямо вверх по течению от PAM сайта (НЭС) копируются в векторные выражения Cas9. Шаблон ремонт затем производится грунтовка расширение в пробирке. Cotransformation ремонт шаблон и вектора в C. albicans приводит к изменения генома. В зависимости от ремонта шаблон, используемый следователь может ввести нуклеотидов изменения, вставки или удаления. Как C. albicans диплоидные, мутации, сделанные в обе аллели гена, при том условии, что A и B аллелей не гавань SNPs, которые вмешиваться с гидом ориентации или восстановить шаблон включения. Источника гена семей могут редактироваться параллельно, если подходит сохранение последовательности существуют в всех членов семьи. C. albicans ТРИФОСФАТЫ системы, описываемой в окружении FRT мест и кодирует Флиппазы. После индукции Флиппазы антибиотик маркер (CaCas9) и руководство РНК, удаляются из генома. Это позволяет следователю для выполнения последующие изменения в геноме. C. albicans ТРИФОСФАТЫ инструмент мощный грибковых генной инженерии, и незначительных изменений описанные протоколы позволяют модификации других грибковых видов, включая C. glabrata, н. castellii и S. cerevisiae.

Introduction

Candida albicans является наиболее распространенных человеческих грибкового патогена1,2,3. Понимание различий между C. albicans и млекопитающих молекулярной биологии имеет решающее значение для разработки следующего поколения противогрибковой терапии. Это требует детективов, чтобы иметь возможность быстро и точно генетически манипулировать C. albicans.

Генетические манипуляции C. albicans исторически была сложной. C. albicans не поддерживать плазмид, таким образом все конструкции должны быть включены в геноме. Кроме того C. albicans диплоидных; Поэтому когда выбивания ген или введения мутации, важно обеспечить, чтобы обе копии были изменены4. Кроме того некоторые C. albicans локусов гетерозиготных, еще более усложняют генетических допроса5. Генетически манипулировать C. albicans, это типичный для выполнения нескольких раундов гомологичная рекомбинация6. Однако диплоидный характер генома и кропотливого конструкции развития сделали это потенциально утомительный процесс, особенно если несколько изменений не требуется. Эти ограничения и медицинское значение C. albicans требуют разработки новых технологий, позволяющих следователям более легко манипулировать геном C. albicans .

Кластерный регулярно interspaced короткие палиндром повторяется (ТРИФОСФАТЫ)-опосредованной генома редактирования является мощным инструментом, который позволяет исследователям для изменения последовательности генома. ТРИФОСФАТЫ требует трех компонентов: 1) Cas9 Нуклеаза, который расщепляет ДНАО цели, 2) 20 базы руководство РНК, использующий Cas9 последовательность интереса и 3) ремонт шаблон ДНК, что ремонт на сайте расщепления и включает предполагаемого изменения7, 8. Как только руководство приносит Cas9 последовательности генома, Cas9 требует последовательности смежных мотив (PAM) protospacer (НЭС) непосредственно вышестоящего руководства последовательности для расщеплять ДНК9. Требование для 20 базового руководства и Пэм последовательности обеспечивает высокую степень ориентации на специфику и ограничивает пробить расщепления.

ТРИФОСФАТЫ системы были разработаны для редактирования геномов набора разнообразных организмов и решать широкий спектр проблем10. Описанные здесь — это гибкий, эффективный протокол ТРИФОСФАТЫ для редактирования C. albicans ген интереса. Эксперимента вводит стоп-кодон генов, вызывающих прекращение перевода. Другие изменения могут быть сделаны в зависимости от шаблона ремонт, который вводится. Фрагмент, отмеченные nourseothricin (Natr) содержащие дрожжи кодон оптимизированный Cas9 (CaCas9) и руководство РНК включена в геном C. albicans на нейтральной территории. Cotransformation с ремонт шаблон кодирования желаемого мутация приводит к ремонт расщепления гомологичная рекомбинация и изменения эффективным генома. Описанные ниже является редактирование TPK2, но все C. albicans открытой чтении кадры могут быть объектом несколько раз ТРИФОСФАТЫ. Система ТРИФОСФАТЫ окружении FRT мест и может быть удален из генома C. albicans индукции Флиппазы, закодированных на выражение плазмида CaCas9. C. albicans ТРИФОСФАТЫ система позволяет следователям точно и быстро редактировать C. albicans генома11,12.

Protocol

1. Идентификация и клонирование руководство РНК последовательности

  1. Идентификация руководство РНК последовательности
    1. Определить 5'-НЭС-3' PAM последовательность близко к где будет вставлен стоп-кодон. (Рис. 1A) Помечены все, что Пэм последовательности находятся в первых 100 пар оснований TPK2 (Рисунок 1A).
      Примечание: Руководство последовательности ориентации каждый кадр открытом чтения C. albicans можно найти в http://osf.io/ARDTX 11,12.
    2. Определить последовательность вперед руководство Primer_3, который будет 20 базы прямо вверх по течению NGG PAM сайта и не будет содержать больше чем 5 Ts подряд. Щелкните левой кнопкой мыши на базе прямо вверх по течению NGG и перетащите курсор 20 базы, затем щелкните левой кнопкой мыши на вкладке грунтовка для добавления в грунт.
    3. Определение последовательности обратный руководство Primer_3, который станет дополнением к вперед руководство последовательности.
      Примечание: Показаны являются направляющими, которые используют PAM_3 (рис. 1B).
    4. Щелкните правой кнопкой мыши грунтовка и выберите «Копировать данные грунт». Вставьте последовательности программы для редактирования текста.
  2. Добавьте выступ последовательности вперед и обратить вспять руководство oligos для облегчения клонирования (таблица 1, рис. 1B).
    1. Добавьте нуклеотидной последовательности ATTTG к 5' концу вперед руководство Primer_3 перед покупкой.
    2. Добавление G к 3' концу вперед руководство Primer_3 перед покупкой.
    3. Добавьте нуклеотидной последовательности AAAAC к 5' концу обратный руководство Primer_3 перед покупкой.
    4. Добавление C к 3' концу обратный руководство Primer_3 перед покупкой.
  3. Дайджест CaCas9 выражение вектор pV1524 с BsmBI.
    Примечание: pV1524 содержит ампициллин (rAmp) и nourseothricin (Natr) маркеров. Cas9 был кодон оптимизированный для C. albicans.
    1. Дайджест плазмида, добавив: 2 мкг pv1524, 5 мкл 10 x буфер, 1 мкл BsmBI и H2O до 50 мкл в 1,5 мл. Инкубируйте на 55 ° C в течение 20 минут (в качестве альтернативы, дайджест pv1524 15 мин с Esp3I, isoschizomer BsmBI, при 37 ° C.)
    2. Прохладной комнатной температуре (RT) и спина для 30 s на 2348 x g довести конденсации в нижней части трубки. Перейдите к пункт 1.4 или хранить переваривается плазмида при-20 ° C.
  4. Фосфатаза лечить переваривается позвоночника.
    1. Добавить 1 мкл икры кишечной фосфатазы (CIP) в смеси пищеварение и инкубировать при 37 ° C в течение 1 ч.
    2. Очистить переваривается плазмида, использование коммерчески доступных полимеразной цепной реакции (ПЦР) очистки комплект (комплект инструкции) и элюировать в 30 мкл буфера (EB).
  5. Фосфорилировать и отжига вперед руководство Primer_3 и обратить вспять Primer_3 руководство.
    1. Добавить 0,5 мкл, 100 мкм вперед руководство Primer_3, 0.5 мкл, 100 мкм вспять руководство Primer_3, 5 мкл 10 x T4 лигаза буфера, 1 мкл T4 полинуклеотид киназы и 43 мкл H2O для ПЦР-пробирку.
    2. В второй ПЦР-пробирку добавьте 5 мкл 10 x T4 лигаза буфера, 1 мкл T4 полинуклеотид киназы и 44 мкл молекулярной биологии класса H2O.
      Примечание: Это будет служить в качестве отрицательного контроля.
    3. Инкубируйте реакция смеси в Термоциклер при 37 ° C за 30 мин, затем при 95 ° C за 5 мин.
    4. Прохладный смеси на медленные темпы рамп до 16 ° C для отжига, oligos. Затем поместите смесь отожженная oligo на 4 ° C.
  6. Перевязать отожженная oligos в усваивается pv1524 от шага 1.4.3.
    1. ПЦР-пробирку добавить следующее: 1 мкл 10 x T4 лигаза буфера, 0.5 мкл T4 ДНК лигаза, 0.5 мкл отожженная oligo смеси, переваривается, CIP-лечение очищенные плазмид (20 – 40 нг) и H2O до 10 мкл общего объема.
    2. ПЦР-пробирку добавить следующее: 1 мкл 10 x T4 лигаза буфера, 0.5 мкл T4 ДНК лигаза, переваривается CIP-лечение очищенный вектор (20 – 40 нг), 1 мкл отрицательный контроль смесь, и H2O до объема 10 мкл.
    3. Инкубировать обеих трубок в Термоциклер на 16 ° C в течение 30 мин, потом на 65 ° C для 10 мин, затем охладите до 25 ° C.
  7. Превратите 5 мкл маточных смесей химически сведущее Escherichia coli DH5α с использованием протокола преобразования стандартный тепловой шок. Выберите LB Amp/Nat СМИ (200 мкг/мл АМП, 50 мкг/мл Nat).
    Примечание: Неспособность выбрать pV1524 и его производные на двойной выбор СМИ приведет к потере Nat/CaCas9/руководство модуля путем иссечения ФЛП/FRT бактерий.
  8. Очищения плазмиды от четырех трансформантов, алкалический и последовательности вставки последовательность с последовательность праймера (Таблица 1).
    Примечание: Большую часть времени, секвенирование 4 трансформантов достаточно, чтобы определить по крайней мере 1 правильное клонирование.
  9. Сохранить плазмиды, которые руководство РНК последовательности, клонированные один раз в BsmBI, вырезать сайта при-20 ° C.

2. Проектирование и создание шаблона ремонт

  1. Вставьте стоп-кодон, щелкнув в последовательности гена и добавления нуклеотидов, которые кодируют стоп кодон и ограничение пищеварение сайта (рис. 1 cТаблица 1).
    Примечание: Вставки будет нарушить последовательность PAM.
    Примечание: На сайте пищеварение ограничения будут включены в шаблон последовательности восстановления для облегчения эффективного отбора клонов (рис. 1 c).
  2. Нажмите левую кнопку 10 баз по течению где будет производиться мутации и перетащите курсор 60 строит вверх по течению. Щелкните левой кнопкой мыши на вкладке грунтовка для добавления в грунт. Это позволит добавить ремонт шаблон Forward_3. Нажмите левую кнопку 10 основы вверх по течению где будет производиться мутации и перетащите курсор 60 баз вниз по течению. Щелкните левой кнопкой мыши на вкладке грунтовка для добавления в грунт. Это позволит добавить ремонт шаблон обратный 3. (Рис. 1 c)
  3. Выполните расширение грунтовка для создания шаблона ремонт.
    1. Добавить 1.2 мкл, 100 мкм ремонт шаблон вперед грунт, 1.2 мкл, 100 мкм ремонт шаблон обратный грунтовки, 6 мкл deoxynucleotide трифосфаты (дНТФ) (всего концентрации 40 мм), 6 мкл буфера, 0,6 мкл Taq-полимеразы (3 шт) и 45 мкл H2O для каждого из 4 PCR трубы.
    2. Выполните выдвижение праймера, между 20 и 30 раундов ПЦР. Пример расширения условий: 2 мин при 95 ° C, (30 сек при 95 ° C, 1 мин при 50 ° C, 1 мин на 68 ° C) x 34, 10 мин на 68 ° C.
    3. Объединить содержимое всех 4 трубок ПЦР в 1,5 мл трубку и использовать комплект очистки ПЦР для очистки продуктов в 50 мкл H2O.
    4. Quantitate грунтовка расширение продуктов для обеспечения достаточной ДНК путем определения поглощения на 260 Нм.
      Примечание: Типичный конечная концентрация праймера расширения продукта является ~ 200-300 нг/мкл.

3. преобразование C. albicans с ремонт шаблон и плазмиды

  1. Сделайте TE/лития ацетат.
    1. Микс 10 мм трис-Cl, ЭДТА 1 мм, 100 мм ацетат лития и H2O (все Стоковый раствор pH 7.5) для достижения общий объем 50 мл.
  2. Сделать пластина
    1. Смешайте 40% PEG 3350, ацетат лития 100 мм, 10 мм трис-Cl, 1 мм ЭДТА и H2O (все Стоковый раствор pH 7.5) для достижения общий объем 50 мл.
  3. Переварить правильно клонирования плазмиды от шага 1.9.
    1. Добавить 10 мкг плазмида, 4 мкл 10 x буфер, 0.4 мкл 10 мг/мл, бычьим сывороточным альбумином (БСА), 0.5 мкл KpnI, 0.5 мкл SacI и H20 до 40 мкл общий объем в 1.5 мл. Инкубируйте при 37 ° C ночь (рис. 1 d).
  4. Растут на ночь культуры SC5314 C. albicans , одичал типа prototroph, при 25 ° C в дрожжи Пептон Декстроза дополнена 0.27 мм уридина (YPD + Uri), в идеале ОД600 меньше, чем 6.
    1. Пелле 5 ОД600 единиц клеток на преобразования, спиннинг на 5 мин на 2348 x g и приостановить 5 ОД600 гранулированных клеток в 100 мкл TE/лития ацетат.
  5. Добавьте следующее в 1,5 мл трубку в указанном порядке: 1) 100 мкл клеток из шага 3.4.1, 2) 40 мкл вареной и быстро охлаждается спермы лосося ДНК (10 мг/мл), 3) 10 мкг, плазмида пищеварения из шага 3.3.1, 4) 6 мкг очищенный ремонт шаблона и 5) 1 мл пластины.
  6. Добавьте следующее в 1,5 мл трубку в указанном порядке: 1) 100 мкл клеток, 2) 40 мкл вареной и быстро охлаждается спермы лосося ДНК (10 мг/мл), 3) H2O тома равно трансформации ДНК в шаг 3.5 и 4) 1 мл пластины.
    Примечание: Это будет служить в качестве отрицательного контроля.
  7. Осторожно перемешать преобразований, закупорить и пусть инкубации при 25 ° C на ночь.
  8. Тепловой шок клетки, помещая их в водяной бане 44 ° C 25 мин.
  9. Спина за 5 мин на 2348 x g в центрифуге benchtop и удалить супернатант пластины смесь. Мыть раз 2348 x g, добавив 1 мл YPD + Uri и центрифуги снова за 5 мин.
  10. Приостановить клетки в 0,1 мл YPD + Uri и инкубировать на роликовых барабан или шейкер при 25 ° C на ночь.
  11. Тарелка на YPD + Uri с 200 мкг/мл nourseothricin. Колонии появится в 2 – 5 дней.

4. полосы для одного колоний

  1. 100 мм х 15 мм Петри разделить кварталы и этикетки каждого квадранта.
    1. Коснуться одной из колоний от преобразования пластины с стерильных зубочистку или аппликатор и полоса по длинной стороне квадранта.
    2. Полоса для одного колоний, с использованием асептической техники и позволяют колоний расти при 30 ° C в течение 2 дней.

5. Колония PCR

  1. Дизайн вперед проверить грунтовка (FCP) ~ 200 пар оснований вверх по течению ограничение сайта, который был представлен и обратной проверки грунтовка (RCP) ~ 300 пар оснований вниз по течению.
    1. Добавление 0,3 мкл FCP, 0,3 мкл RCP, 0,3 мкл термостабильной полимеразы (ExTaq 1.5 единиц), 3 мкл дНТФ (всего концентрации 40 мм), 3 мкл ExTaq буфер, и 23 мкл H2O в 1,5 мл трубку.
      Примечание: Добавление 0.5 мкл/реакции диметилсульфоксида (ДМСО) могут повысить эффективность ПЦР.
    2. Добавьте 0,25 мкл колонии одного дрожжей из шага 4.1.2 смесь из шага 5.1.1, с помощью кончика пипетки P10 и стараясь не нарушить агар.
    3. Усилить ДНК методом ПЦР и запустить 5 мкл ПЦР на гель для обеспечения усиления является успешным, стараясь не нарушить Пелле клеток в нижней части трубки.

6. ограничение пищеварение колонии PCR

  1. Добавить 10 мкл ПЦР продукта (стараясь не не беспокоить Пелле клеток в нижней части трубки), 3 мкл буфера, 1 мкл энзима ограничения, и 16 мкл H2O, а затем инкубировать согласно инструкции производителя и решить на геле агарозы для определения прав CT изменения генома.
    Примечание: Энзима ограничения, используемые здесь это сайт, закодированные в шаблоне определенного ремонта TPK2 .

7. Сохранение штаммов

  1. Растут на ночь культуры из колоний, которые были подтверждены пищеварение ограничения в YPD + Uri при 30 ° C.
  2. Добавьте 1 mL культуры и 1 мл 50% глицерина (в результате чего конечная концентрация глицерина до 25%) в трубку, пригодных для хранения при температуре-80 ° C.
  3. Хранить правильно клонов-80 ° c.
    Примечание: Правильные штаммы могут храниться при температуре-80 ° C на протяжении многих лет.

8. Удаление Natr маркер

  1. Правильный transformant полоска на дрожжи Пептон мальтозные (YPMaltose) (2% мальтозы).
  2. Выберите колонии с прожилками плиты и культура дрожжей для 48 ч при 30 ° C в жидких мальтоза 20 г/Л YPMaltose.
  3. Плита 200 – 400 клеток на YPMaltose 20 г/Л мальтозу и Инкубируйте на 30 ° C в течение 24 ч.
  4. Реплицировать пластину на YPMaltose и YPMaltose 200 мкг/мл Nat.
  5. Инкубируйте на 30 ° C в течение 24 ч.
    Примечание: Колонии, которые больше не растут на YPMaltose 200 мкг/мл nourseothricin, но растут на YPMaltose потеряли маркерr Nat (CaCAS9) и руководство РНК.
  6. Сохраните штаммов, которые потеряли Natr маркер (CaCAS9) и руководство РНК как сделано в шагах 7.1-7.3.
    Примечание: Подобные плазмида, pV1393, использует SAP2 отличие от MAL2 promotor. Рост на СДП-BSA будет вызывать Флиппазы и удаления Natr при pV1393 используется для редактирования гена.

Representative Results

Последовательности руководство РНК и ремонт шаблоны, которые нацелены C. albicans TPK2, c-AMP киназы каталитическая субъединица, были разработаны в соответствии с руководящими принципами, предложенных выше. Последовательности показаны (Таблица 1, рис. 1). Руководство РНК были клонированы в векторы выражения CaCas9 и cotransformed с ремонт шаблон в одичал тип C. albicans. На сайте пищеварение ограничения экоРи и остановить кодонов в шаблоне ремонт нарушить сайт PAM и содействовать скрининга для правильной мутантов (рис. 1). Трансформантов были прожилками для одного колоний и экранируется колонии PCR и ограничение пищеварение для включения ремонт шаблона (рис. 2). Пищеварение ограничения быстро отличает одичал тип от мутантов последовательности.

Имя олигонуклеотида Последовательности олигонуклеотида
Primer_3 вперед руководство ATTTGgggtgaactatttgttcgccG
Обратный Primer_3 руководство AAAACggcgaacaaatagttcacccC
Ремонт Forward_3 шаблон tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
Ремонт Reverse_3 шаблон attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
Грунтовка вперед проверить ttaaagaaacttcacatcaccaag
Обратных проверки грунт actttgatagcataatatctaccat
Секвенирование грунтовка ggcatagctgaaacttcggccc

Таблица 1: список oligo нуклеотидов, используемые для этого исследования. Сайты, добавленные для клонирования целей капитализируются и жирным шрифтом в руководстве праймера последовательностей. В шаблоне ремонт последовательности, которые мутировать геномной ДНК капитализируются и жирным шрифтом.

Figure 1
Рисунок 1 : Диаграмма руководство РНК и ремонт дизайн шаблона. (A) обозначать всех последовательностей PAM в первых 100 нуклеотидов TPK2. Пэм последовательность 3 (PAM_3) выделяется, как это последовательность, используемая в этом исследовании. (B) руководство РНК дизайн, с использованием PAM_3. строчная и синий 20 базовых грунты, разработаны с использованием SnapGene. Дополнительные основания, необходимые для клонирования прописных и зеленый показано смещения. (C) ремонт шаблон грунты, которые вставляют TAA стоп-кодон и экори сайт вставляются в TPK2 чтение фрейма. ДНК, которая отличается от дикого типа последовательности красный и прописными буквами. (D) пример как руководство предназначено на позитивные нити ДНК, используя PAM_4. (E) принципиальная схема pV1524 после клонирования руководство РНК и пищеварения с KpnI и SacI. Neut5L-5' и Neut5L-3' цель вектор на Neut5L сайт в геном C. albicans . CaENO1p является promotor, что диски, проявление оптимизирован дрожжей CaCas9. NATr является кассеты сопротивления nourseothricin. CaSNR52p является promotor вождения руководство РНК выражение (sgRNA). FRT сайты расщепляется и полноцветного Флиппазы (FLP) удаление ТРИФОСФАТЫ кассета Флиппазы выражение. Схема аналогична (E) был опубликован Vyas и др. 11. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Введение и подтверждения стоп-кодон и экори ограничение сайта TPK2. Праймеры для амплификации, перечислены в таблице 1. Одичал типа и мутантов последовательности приведены ниже геля. Эта цифра была изменена Vyas et al.11. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Мультфильм описание ремонта шаблонов, которые будут генерировать исключения (A) и (B) вставки. Серый тире в (A) изображают последовательности не присутствует в ремонт шаблон грунтовки. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Discussion

C. albicans ТРИФОСФАТЫ эффективно редактирует геном C. albicans . pV1524 кодирует дрожжи кодон оптимизированный Cas9 и разработана таким образом, что следователи могут легко клонировать руководство РНК последовательности по течению CaSNR52 промоутер (рис. 1)11. Необходимо обеспечить, что только одна копия руководство последовательности был клонирован в векторы выражения CaCas9 по виртуализации, как дополнительные копии будет препятствовать изменения генома. Если несколько копий руководства представлены последовательно, один следует снизить концентрацию отожженная руководства, используемых в перевязки. Вектор и протокол описал позволяете таргетинга любой C. albicans гена. Хотя C. albicans диплоидный, только одно преобразование требуется целевой обе аллели гена. Кроме того processive характер изменения генома ТРИФОСФАТЫ-CaCas9 позволяет исследователям ориентироваться на нескольких членов семей ген. Многие семьи ген как выделяется аспартил протеазами (ПСП) и агглютининов как последовательности белков (ALS) имеют важное значение для вирулентности C. albicans . Изменения генома ТРИФОСФАТЫ облегчит расследование этих семей ген.

Протоколы, описанные выше ввести стоп-кодон в открытом чтения рамку, результате фенотипические эквивалент null (рис. 2). Широкий спектр генетические изменения могут быть сделаны различные ремонт шаблон. Чушь, Миссенс и молчаливый мутации могут вставляться через рекомбинации с шаблоном соответствующий ремонт. Включение ограничения сайта упрощает transformant скрининг, как те без должны проверяться путем секвенирования12,13. Кроме того C. albicans ТРИФОСФАТЫ позволяет исследователям для создания вставок и удалений, что делает его идеальной системы для вставки тегов сходства, выполнения активаторных ОСП и создания нокауты (рис. 3). Скрининг для правильного трансформантов для эти мутации более трудоемкий, как это необходимо для последовательности изменения для подтверждения правильного включения шаблонов ремонт. Кроме того Южная помарка может быть необходимо убедиться, что дополнительные копии гена не были вставлены в дополнительных местах расположения в геноме. Требование на сайте NGG PAM места незначительные ограничения на регионы генома, которые могут быть направлены. Разработка альтернативных систем ТРИФОСФАТЫ, что использование альтернативных nucleases таких, как Cpf1 или вариации на системе Cas9 есть/будет облегчить многие из этих ограничений14. Для следователей знаний в настоящее время эти системы не еще не были применены к C. albicans.

ТРИФОСФАТЫ система, описанная в вышеупомянутый Протокол был разработан таким образом, что он может применяться в самых разнообразных видов, включая Saccharomyces cerevisiae, Naumouozyma castelliiи человеческий патоген Candida glabrata11 . Преобразований и эффективного редактирования этих дрожжей требует незначительные изменения в протоколе описаны, однако рамки для редактирования этих альтернативных геномов удивительно аналогична описанной для C. albicans12. Кроме того дрожжи обеспечивают отличный механизм для разработки генома редактирования процедур. В дрожжи когда ADE2 мутировал, прекурсор к путь биосинтеза аденин накапливается, поворачивая красный клетки. Это легко наблюдаемых фенотип позволяет следователям для определения измененные клетки и быстро устранять генома, редактирование протоколов. В сочетании с обширной молекулярной биологии элементов, доступных для грибов, протоколы для редактирования многочисленных видов дрожжей были развитыми15,16. Такое широкое применение генома редактирования технологии в грибов имеет потенциал, чтобы существенно повлиять на широкий спектр научных дисциплин.

ТРИФОСФАТЫ значительно повысило эффективность техники генома в C. albicans, но на сегодняшний день ТРИФОСФАТЫ не были использованы для выполнения генома широкие экраны в C. albicans. Текущие протоколы требуют ремонта шаблон для внедрения мутаций, как nonhomologous конце присоединения путь в C. albicans является неэффективным12. Поколение oligos ремонт шаблон для каждого гена является существенным барьером для исполнения генома общесистемной экранов. Слияния снижении затрат синтез ДНК и авансов ТРИФОСФАТЫ технологий сделает развитие удаления библиотек более осуществимым. Например выражение шаблона ремонт от вектора CaCas9 прокладывает путь для развития устойчивого плазмида библиотек, которые цели каждый ген11. Кроме того переходные Candida ТРИФОСФАТЫ протоколы, которые не требуют CaCas9 выражение вектор соединяются в геном C. albicans были развитые17. Кроме того увеличение руководство выражение увеличивает генома редактирования эффективности18. Эти и другие достижения ТРИФОСФАТЫ технологий, имеют решающее значение для развития всей генома экранов в C. albicans19,20,,2122.

Геном C. albicans диплоидные, но A и B аллелей не всегда являются идентичными5. Такие гетерозиготности обеспечивает как вызовы, так и возможности. Если один стремится нацелены обе аллели, должен использоваться сайт PAM, руководство последовательности и ремонт шаблон, который будет действовать на обе копии гена. Однако в зависимости от единичных нуклеотидных полиморфизмов в ген, ТРИФОСФАТЫ системы C.albicans позволяет следователи Целевой один аллель. Такая точность имеет потенциал, чтобы позволить следователей для изучения функциональных различий между аллелями. Ориентация определенных аллелей должно быть сделано тщательно, как наблюдается потеря гетерозиготности (LOH) на аллель или всей хромосомы. При редактировании одного C. albicans аллелей, один должен изучить смежные последовательности ДНК для определения, если клон поддерживает профиль диплоидных SNP. Кроме того пробить эффекты являются довольно низкими для C. albicans ТРИФОСФАТЫ, но всего генома может рассматриваться для ключевых штаммов.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Авторы благодарят доктор Gennifer Магер для чтения и полезные комментарии на рукопись. Эта работа была поддержана мяч государственного университета Лаборатория запуска фондов и низ 1R15AI130950-01-D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics