CRISPR-gemedieerde genoom uitgeven van het menselijke schimmel pathogeen Candida albicans

* These authors contributed equally
Genetics
 

Summary

Efficiënte genoom engineering van Candida albicans is cruciaal voor het begrijpen van de pathogenese en de ontwikkeling van therapeutics. We beschreven hier, een protocol om snel en nauwkeurig bewerken het C. albicans genoom met behulp van CRISPR. Het protocol kunnen onderzoekers om een grote verscheidenheid van genetische modificaties, met inbegrip van puntmutaties, invoegingen en verwijderingen.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Deze methode beschrijft de efficiënte CRISPR gemedieerde genoom bewerken van het diploïde menselijke schimmel pathogeen Candida albicans. Cas9, CRISPR-gemedieerde genoom bewerken in C. albicans vereist begeleiden van RNA, en herstellen van de sjabloon. Een plasmide uiting geven aan een gist-codon geoptimaliseerd Cas9 (CaCas9) is gegenereerd. Begeleiden van reeksen rechtstreeks stroomopwaarts van een PAM site (NGG) zijn gekloond in de Cas9 expressie vector. Een reparatie-sjabloon wordt dan gemaakt door primer extensie in vitro. Cotransformatie van de reparatie sjabloon en vector in C. albicans leidt tot het genoom bewerken. Afhankelijk van de reparatie-sjabloon gebruikt, kan de onderzoeker leiden tot wijzigingen van de nucleotide, invoegingen of verwijderingen. C. albicans is een diploïde, zijn mutaties gemaakt in beide allelen van een gen, mits de allelen A en B doen niet haven SNPs die interfereren met handleiding gericht op of herstellen van de opneming van de sjabloon. Multimember gen gezinnen kunnen worden bewerkt in parallel als geschikt geconserveerde sequenties in alle gezinsleden bestaat. Het systeem van de C. albicans CRISPR beschreven wordt geflankeerd door FRT sites en flippase codeert. Bij inductie van flippase, worden het antibioticum marker (CaCas9) en de gids RNA verwijderd van het genoom. Hierdoor kan de onderzoeker voor het uitvoeren van de volgende bewerkingen aan het genoom. C. albicans CRISPR is een krachtige schimmel genetische manipulatie tool, en kleine wijzigingen aan de beschreven protocollen toestaan dat de wijziging van andere schimmel plantensoorten, waaronder C. glabrata, N. castellii, en S. cerevisiae.

Introduction

Candida albicans is de meest voorkomende menselijke schimmel pathogeen1,2,3. Inzicht verschillen tussen C. albicans en zoogdieren moleculaire biologie is cruciaal voor de ontwikkeling van de volgende generatie van antischimmel therapeutics. Dit vereist de onderzoekers om snel en nauwkeurig genetisch manipuleren C. albicanste kunnen.

Genetische manipulatie van C. albicans van oudsher uitdagend. C. albicans houdt niet plasmiden, dus alle constructies moeten worden opgenomen in het genoom. Bovendien, C. albicans is diploïde; Dus, wanneer een gen uitsparen, of invoering van een mutatie, het is belangrijk ervoor te zorgen dat beide exemplaren zijn geweest gewijzigde4. Daarnaast zijn sommige C. albicans loci heterozygoot, verdere complicerende genetische ondervraging5. Om het genetisch manipuleren C. albicans, is het tekenend voor het uitvoeren van meerdere rondes van homologe recombinatie6. Echter het diploïde karakter van het genoom en de moeizame construct ontwikkeling hebben gemaakt dit een potentieel vervelend proces, vooral als er meerdere wijzigingen zijn vereist. Deze beperkingen en het medisch belang van C. albicans eisen de ontwikkeling van nieuwe technologieën waarmee onderzoekers aan het genoom C. albicans gemakkelijker te manipuleren.

Geclusterde regelmatig interspaced korte palindromische herhaalt (CRISPR)-gemedieerde genoom bewerken is een krachtig hulpmiddel waarmee onderzoekers te wijzigen van de volgorde van een genoom. CRISPR heeft drie onderdelen nodig: 1) de Cas9-nuclease die cleaves doelDNA, 2) een 20 baseren gids RNA dat zich richt op Cas9 om de opeenvolging van belang, en 3) reparatie van DNA van de sjabloon die de breukzijde reparaties en bevat de voorgenomen wijziging7, 8. Zodra de gids Cas9 naar de doel-genoom brengt, Cas9 vereist een reeks aangrenzende motief (PAM) protospacer (NGG) direct voorafgaand aan de volgorde van de gids te klieven van de DNA-9. De eis van zowel de 20 basis gids en PAM sequenties biedt een hoge mate van specificiteit targeting en beperkt af-target decollete.

CRISPR systemen zijn ontwikkeld om het genoom van een gevarieerde set van organismen te bewerken en een breed scala aan problemen10aan te pakken. Hier beschreven is een flexibele en efficiënte CRISPR protocol voor het bewerken van een C. albicans gen van belang. Het experiment introduceert een stop codon aan een gen, veroorzaakt door beëindiging van de vertaling. Andere bewerkingen kunnen plaatsvinden afhankelijk van de reparatie-sjabloon die wordt geïntroduceerd. Een fragment is voorzien van nourseothricin (Natr) die gist bevatten codon geoptimaliseerde Cas9 (CaCas9) en een gids RNA is ingebouwd in het genoom van de C. albicans op een neutrale site. Cotransformatie met de sjabloon van de reparatie codering de gewenste mutatie leidt tot reparatie van het splijten door homologe recombinatie en efficiënte genoom te bewerken. Hieronder is de redactie van TPK2, maar alle C. albicans open lezen frames kunnen meerdere keren worden gericht op de CRISPR. Het CRISPR systeem wordt geflankeerd door FRT sites en kan worden verwijderd uit het C. albicans genoom door inductie van flippase gecodeerd op de CaCas9 expressie plasmide. Het C. albicans CRISPR-systeem kunnen onderzoekers snel en nauwkeurig bewerken de C. albicans genoom11,12.

Protocol

1. inventarisering en klonen van gids RNA volgorde

  1. Identificatie van gids sequentie van het RNA
    1. Identificeren van een 5'-NGG-3' PAM reeks dicht bij waar de stop codon wordt ingevoegd. (Figuur 1A) Label zijn allemaal PAM sequenties gevonden in de eerste 100 basenparen van TPK2 (figuur 1A).
      Opmerking: Gids sequenties gericht op elk frame van de open lezing C. albicans kunnen worden gevonden op http://osf.io/ARDTX 11,12.
    2. Identificeren van de opeenvolging van vooruit gids Primer_3, die de 20 worden zal basen direct stroomopwaarts van een NGG PAM site en bevat niet meer dan 5 Ts in een rij. Klik met de linkermuisknop op de base direct stroomopwaarts van de NGG en sleep de cursor 20 baseert, dan links-klik op het tabblad primer om toe te voegen van de primer.
    3. Identificeren van de opeenvolging van de Reverse gids Primer_3, die de aanvulling op de reeks vooruit gids worden zal.
      Opmerking: Weergegeven zijn gidsen die gebruikmaken van PAM_3 (figuur 1B).
    4. Met de rechtermuisknop op de primer en selecteer "primer gegevens kopiëren". Plak de sequenties in een tekstverwerkingsprogramma.
  2. Overhang sequenties aan Forward en Reverse gids oligos om klonen (tabel 1, figuur 1B) toevoegen.
    1. Voeg de nucleotide-volgorde ATTTG aan het einde 5' van de vooruit gids Primer_3 vóór de aankoop.
    2. Voeg G aan de 3' einde van de vooruit gids Primer_3 vóór de aankoop.
    3. De nucleotide-volgorde AAAAC aan het einde 5' van de Guide Reverse Primer_3 toevoegen vóór de aankoop.
    4. C aan het einde 3' van de Guide Reverse Primer_3 toevoegen vóór de aankoop.
  3. Digest CaCas9 expressie vector pV1524 met BsmBI.
    Opmerking: pV1524 bevat een ampicilline (Ampr) en nourseothricin (Natr) markers. Cas9 geweest codon-geoptimaliseerd voor C. albicans.
    1. Het plasmide verteren door toe te voegen: 2 μg van pv1524, 5 μl van 10 x Buffer, 1 μL van BsmBI en H2O tot en met 50 μl in een 1,5 mL-buis. Incubeer bij 55 ° C gedurende 20 minuten (u kunt ook het verteren van pv1524 voor 15 min met Esp3I, een isoschizomer van BsmBI, bij 37 ° C.)
    2. Koel aan kamertemperatuur (RT) en spin voor 30 s bij 2348 x g om condensatie aan de onderkant van de buis. Gaat u verder met stap 1.4 of bewaar het verteerd plasmide bij-20 ° C.
  4. Fosfatase-traktatie de verteerd ruggengraat.
    1. 1 μL van kalf intestinale fosfatase (CIP) toevoegen aan het mengsel van de spijsvertering en Incubeer bij 37 ° C gedurende 1 uur.
    2. Zuiveren het verteerd plasmide met behulp van een commercieel beschikbare polymerase kettingreactie (PCR) zuivering kit (instructies voorzien van kit) en elueer het in 30 μL van elutie buffer (EB).
  5. Phosphorylate en anneal vooruit gids Primer_3 en Reverse gids Primer_3.
    1. Voeg 0,5 μL van 100 μM vooruit gids Primer_3, 0,5 μL van 100 μM Reverse gids Primer_3, 5 μl van 10 x T4 ligase buffer, 1 μL van T4 polynucleotide kinase en 43 μL van H2O van een PCR-buis.
    2. 5 μl van 10 x T4 ligase buffer, 1 μL van T4 polynucleotide kinase en 44 μL van moleculaire biologie-grade H2O toevoegen in een tweede PCR-buis.
      Opmerking: Dit zal dienen als de negatieve controle.
    3. Incubeer de mengsels van de reactie in een thermocycler bij 37 ° C gedurende 30 minuten, dan bij 95 ° C gedurende 5 minuten.
    4. Koel het mengsel met de traagste oprit snelheid tot 16 ° C te gloeien, oligos. Plaats vervolgens het ontharde oligo-mengsel bij 4 ° C.
  6. Het afbinden van de ontharde oligos in verteerd pv1524 uit stap 1.4.3.
    1. Voeg het volgende toe tot een koker PCR: 1 μL van 10 x T4 ligase buffer, 0,5 μL van T4 DNA ligase, 0,5 μL van ontharde oligo mix, verteerd CIP-behandelde gezuiverd plasmide (20-40 ng), en H2O tot een totaal volume van 10 μL.
    2. Voeg het volgende toe tot een koker PCR: 1 μL van 10 x T4 ligase buffer, 0,5 μL van T4 DNA ligase, verteerd CIP-behandelde gezuiverde vector (20-40 ng), 1 μL van de negatieve controle mengsel, en H2O tot een totaal volume van 10 μL.
    3. Incubeer beide buizen in een thermocycler bij 16 ° C gedurende 30 minuten, dan bij 65 ° C gedurende 10 min en vervolgens afkoelen tot 25 ° C.
  7. 5 μl van het mengsel afbinding omvormen chemisch bevoegde Escherichia coli DH5α met behulp van een standaard hitte protocol voor de transformatie van de schok. Selecteer op LB Amp/Nat-media (200 μg/mL Amp, 50 μg/mL Nat).
    Opmerking: Falen om te selecteren pV1524 en derivaten daarvan op dubbele selectie media zal resulteren in verlies van Nat/CaCas9/handleiding module door FLP/FRT besnijdenis bij bacteriën.
  8. Zuiveren van plasmiden van vier transformants door miniprep, en het volgnummer van de volgorde van invoeging van sequencing primer (tabel 1).
    Opmerking: De meeste van de tijd, volgorde van 4 transformants volstaat om te identificeren van ten minste 1 juiste kloon.
  9. Opslaan van plasmiden hebben de gids RNA volgorde gekloond een enkele keer in de BsmBI gesneden site bij-20 ° C.

2. ontwerpen en generatie van reparatie sjabloon

  1. Invoegen van een stop codon door links te klikken in de germinale genetische identiteit en het toevoegen van nucleotiden die coderen van een stop codon en beperking spijsvertering website (Figuur 1 ctabel 1).
    Opmerking: De invoeging zullen verstoren de PAM-reeks.
    Opmerking: Een beperkingsplaats voor de spijsvertering zal worden opgenomen in de sjabloon reparatie te vergemakkelijken van efficiënte screening van klonen (Figuur 1 c).
  2. Klik met de linkermuisknop 10 grondslagen stroomafwaarts van waar de mutatie zal worden aangebracht en sleep die de cursor 60 stroomopwaarts baseert. Klik met de linkermuisknop op het tabblad primer om toe te voegen van de primer. Dit zal het toevoegen van reparatie sjabloon Forward_3. Klik met de linkermuisknop 10 bases stroomopwaarts waar de mutatie zal worden gemaakt en sleep die de cursor 60 stroomafwaarts baseert. Klik met de linkermuisknop op het tabblad primer om toe te voegen van de primer. Dit zal reparatie Template Reverse 3 toevoegen. (Figuur 1 c)
  3. Primer extensie voor het genereren van de sjabloon reparatie uitvoeren.
    1. Voeg 1.2 l 100 μm reparatie sjabloon voorwaartse primer, 1.2 μL van 100 μm reparatie sjabloon omgekeerde primer, 6 μL van deoxynucleotide trifosfaat (dNTPs) (total concentratie 40 mM), 6 μL van de buffer, 0.6 μL van Taq polymerase (3 eenheden) en 45 μL van H2O aan elk van de 4 PCR buizen.
    2. Primer extensie door tussen de 20 en 30 rondes van PCR uitvoeren Voorbeeld uitbreiding voorwaarden: 2 min bij 95 ° C, (30 bij 95 ° C, 1 min bij 50 ° C, 1 min. bij 68 ° C s) x 34, 10 min bij 68 ° C.
    3. Inhoud van alle 4 PCR buizen in een tube van 1,5 mL combineren en gebruik te maken van een PCR zuivering kit voor het zuiveren van producten in 50 μl van H2O.
    4. Kwantificeren van de primer extensie producten om te zorgen voor voldoende DNA door het bepalen van de absorptie bij 260 nm.
      Opmerking: Typische eindconcentratie van de primer extensie product is ~ 200-300 ng/µL.

3. de transformatie van C. albicans met reparatie Template en plasmide

  1. Zorg TE/lithium acetaat.
    1. Mix 10 mM Tris-Cl, 1 mM EDTA, 100 mM lithium acetaat en H2O (alle stockoplossing pH 7.5) om het totale volume van 50 mL.
  2. Maken van plaat
    1. Meng 40% PEG 3350, 100 mM lithium acetaat, 10 mM Tris-Cl, 1 mM EDTA en H2O (alle stockoplossing pH 7.5) om het totale volume van 50 mL.
  3. Verteren correct gekloond uit stap 1.9 plasmiden.
    1. Toevoegen van 10 μg plasmide, 4 µL van 10 x buffer, 0.4 µL van 10 mg/mL bovien serumalbumine (BSA), 0,5 µL van KpnI 0.5 µL van SacI en H20 tot 40 µL totale volume in een buis 1,5 mL. Incubeer bij 37 ° C's nachts (Figuur 1 d).
  4. Een overnachting cultuur van C. albicans SC5314, wild-type prototroph, bij 25 ° C in Gist-pepton dextrose aangevuld met 0,27 mM Uridine (YPD + Uri), ideaal voor OD600 minder dan 6 groeien.
    1. 5 OD600 eenheden van cellen per transformatie door spinnen voor 5 min bij 2348 x g pellet en de 5 OD600 Ingehuld cellen in 100 µL TE/lithium acetaat op te schorten.
  5. Voeg het volgende toe een 1,5 mL-buis in de volgorde: 1) 100 µL van cellen uit stap 3.4.1, 2) 40 µL van gekookte en gekoelde snelle zalm sperma DNA (10 mg/mL), 3) 10 µg plasmide spijsvertering uit stap 3.3.1 4) 6 µg van gezuiverde reparatie sjabloon en 5) 1 mL van de plaat.
  6. Voeg het volgende toe een 1,5 mL-buis in de volgorde: 1) 100 µL van cellen, 2) 40 µL van gekookte en gekoelde snelle zalm sperma DNA (10 mg/mL), 3) H2O volume gelijk is aan die van het transformeren van DNA in stap 3.5, en 4) 1 mL van de plaat.
    Opmerking: Dit zal dienen als een negatieve controle.
  7. Meng de transformaties zachtjes door pipetteren en laat na een nacht bebroeden bij 25 ° C.
  8. Warmte schok de cellen door ze te plaatsen in een waterbad 44 ° C gedurende 25 minuten.
  9. Spin voor 5 min bij 2348 x g in een benchtop centrifuge en verwijder het supernatant plaat-mengsel. Wassen eenmaal door toevoeging van 1 mL van YPD + Uri en Centrifugeer nogmaals gedurende 5 minuten aan 2348 x g.
  10. Opschorten van de cellen in 0,1 mL van YPD + Uri en incubeer op een roller trommel of shaker bij 25 ° C's nachts.
  11. Plaat op YPD + Uri met 200 μg/mL nourseothricin. Kolonies verschijnt in 2-5 dagen.

4. de strepen voor enkele kolonies

  1. Verdeel een 100 x 15 mm petrischaal in kwartalen en elk kwadrant een label.
    1. Raak één van de kolonies van de transformatie-plaat met een steriel tandenstoker of applicator en streep over de langste zijde van het Kwadrant.
    2. Strijk voor enkele kolonies met een aseptische techniek en laat de kolonies groeien bij 30 ° C gedurende 2 dagen.

5. PCR van de kolonie

  1. De voorwaartse selectievakje primer (FCP) ~ 200 basenparen stroomopwaarts van de beperkingsplaats dat werd geïntroduceerd en de omgekeerde selectievakje primer (RCP) ~ 300 basenparen stroomafwaarts ontwerpen.
    1. Toevoegen van 0,3 μl van FCP, 0,3 μl van RCP, 0,3 μl van thermostable polymerase (ExTaq 1.5 eenheden), 3 μL van dNTPs (total concentratie 40 mM), 3 μL van ExTaq Buffer en 23 μL van H2O tot een 1,5 mL koker.
      Opmerking: Toevoeging van 0,5 μL/reactie dimethylsulfoxide (DMSO) kan PCR efficiency verbeteren.
    2. 0,25 μL van een kolonie van één gist uit stap 4.1.2 toevoegen aan het mengsel uit stap 5.1.1, met behulp van een P10 pipette uiteinde en verzorgen niet te verstoren de agar.
    3. Versterken van DNA door PCR en 5 μl van het PCR draaien op een gel om versterking is succesvol, verzorgen niet te verstoren de pellet van de cel aan de onderkant van de buis.

6. beperkingsspijsvertering van PCR van de kolonie

  1. Voeg 10 μl van het PCR product (verzorgen niet te storen niet de cel pellet aan de onderkant van de buis), 3 μL van de buffer 1 μL van restrictie-enzym en 16 μL van H2O, dan broeden volgens de instructies van de fabrikant en lossen op een agarose gel te identificeren corre CT genoom bewerkingen.
    Opmerking: De restrictie-enzym gebruikt hier is de site gecodeerd in de TPK2 specifieke reparatie sjabloon.

7. opslaan stammen

  1. Groeien van een overnachting cultuur van koloniën die werden bevestigd door beperkingsspijsvertering in YPD + Uri bij 30 ° C.
  2. Voeg 1 mL van de cultuur en 1 mL 50% glycerol (om de uiteindelijke concentratie van glycerol 25%) tot een koker geschikt voor opslag bij-80 ° C.
  3. Opslaan van de juiste klonen bij-80 ° C.
    Opmerking: Juiste stammen kunnen worden opgeslagen bij-80 ° C voor vele jaren.

8. verwijdering van Natr Marker

  1. De juiste transformant streak op Gist-pepton maltose (YPMaltose) (2% maltose).
  2. Kies een kolonie van de gestreepte plaat en cultuur van de gist gedurende 48 uur bij 30 ° C in vloeibare YPMaltose 20 g/L maltose.
  3. Plaat 200-400 cellen op YPMaltose 20 g/L maltose en Incubeer bij 30 ° C gedurende 24 uur.
  4. Repliceren de plaat op YPMaltose en YPMaltose 200 μg/mL Nat.
  5. Incubeer bij 30 ° C gedurende 24 uur.
    Opmerking: Koloniën die niet langer groeien op YPMaltose 200 μg/mL nourseothricin maar groeien op YPMaltose de Natr markering (CaCAS9) hebben verloren en begeleiden van RNA.
  6. Sla de soorten die de Natr marker (CaCAS9) en handleiding RNA zoals gedaan in stappen 7,1-7.3 hebben verloren.
    Opmerking: Een soortgelijke plasmide, pV1393, gebruikt de SAP2 in tegenstelling tot de promotor van een MAL2 . Groei op YCB – BSA zal induceren flippase en verwijdering van Natr als pV1393 wordt gebruikt voor het bewerken van het gen.

Representative Results

Sequenties van gids RNAs en reparatie sjablonen die gericht zijn op C. albicans TPK2, een c-AMP kinase katalytische subeenheid, zijn ontworpen volgens de hierboven voorgestelde richtlijnen. Reeksen worden weergegeven in (tabel 1, Figuur 1). Gids RNAs werden gekloond in expressievectoren CaCas9 en cotransformed met reparatie sjabloon in wild-type C. albicans. Een EcoRI beperkingsplaats voor de spijsvertering en stop codonen in de sjabloon reparatie verstoren de PAM-site en vergemakkelijken van screening voor juiste mutanten (Figuur 1). Transformants waren streaked voor enkele kolonies en gescreend door kolonie PCR en beperking spijsvertering voor opneming van de reparatie-sjabloon (Figuur 2). Wild-type onderscheidt beperkingsspijsvertering snel van mutant sequenties.

Oligonucleotide naam Oligonucleotide volgorde
Voorwaartse gids Primer_3 ATTTGgggtgaactatttgttcgccG
Omgekeerde gids Primer_3 AAAACggcgaacaaatagttcacccC
Reparatie sjabloon Forward_3 tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
Reparatie sjabloon Reverse_3 attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
Voorwaartse Check Primer ttaaagaaacttcacatcaccaag
Omgekeerde Check Primer actttgatagcataatatctaccat
Sequencing Primer ggcatagctgaaacttcggccc

Tabel 1: lijst van oligo nucleotiden gebruikt voor deze studie. Sites die zijn toegevoegd voor het klonen van doeleinden zijn gekapitaliseerd en vet in de gids primer sequenties. Sequenties in de reparatie-sjabloon die muteren van de genomic DNA zijn gekapitaliseerd en vet.

Figure 1
Figuur 1 : Diagram van gids RNA en reparatie sjabloonontwerp. (A) labelen van alle de PAM sequences in de eerste 100 nucleotiden van TPK2. PAM reeks 3 (PAM_3) wordt gemarkeerd, want dat is de volgorde gebruikt in deze studie. (B) gids RNA ontwerpen met behulp van PAM_3. 20 basis inleidingen ontworpen met behulp van SnapGene zijn blauwe hoofdletters en kleine letters. Extra grondslagen die nodig zijn voor het klonen zijn hoofdletters en groen weergegeven offset. (C) reparatie sjabloon inleidingen die een TAA stop codon en EcoRI site invoegt in de TPK2 lezen frame worden ingevoegd. DNA die van de volgorde van de wild-type verschilt is rood en hoofdletters. (D) voorbeeld van hoe een gids is ontworpen op de positieve bundel van DNA met behulp van PAM_4. (E) schematisch diagram van de pV1524 na het klonen van de gids RNA en de spijsvertering met KpnI en SacI. Neut5L-5' en Neut5L-3' target van de vector naar de site van de Neut5L in het genoom van C. albicans . CaENO1p is de promotor die uitdrukking van de gist-geoptimaliseerde CaCas9drijft. NATr is de nourseothricin weerstand cassette. CaSNR52p is de promotor rijden gids RNA expressie (sgRNA). FRT sites zijn gekloofd en gerecombineerde door flippase (FLP) de cassette CRISPR op flippase-expressie verwijderen. Een schematische vergelijkbaar met (E) werd gepubliceerd door Vyas et al. 11. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Inleiding en bevestiging van een stop codon en EcoRI beperkingsplaats naar TPK2. Inleidingen gebruikt voor amplificatie zijn vermeld in tabel 1. Wild-type en mutant sequenties staan hieronder de gel. Dit cijfer is gewijzigd van Vyas et al.11. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Beschrijving van reparatie-sjablonen die (A) (B) ingevoegde en genereren zal cartoon. Grijze streepjes in (A) verbeelden tussenliggende sequenties niet aanwezig zijn in de reparatie sjabloon inleidingen. Klik hier voor een grotere versie van dit cijfer.

Discussion

C. albicans CRISPR efficiënt bewerkt het C. albicans genoom. pV1524 codeert een gist Cas9 codon-geoptimaliseerd en is zodanig ontworpen dat onderzoekers gemakkelijk gids RNA-sequenties stroomafwaarts van de CaSNR52 promotor (Figuur 1)11 klonen kunnen. Er moet voor worden gezorgd dat slechts een exemplaar van de reeks van de gids heeft gekloond in CaCas9 expressievectoren door sequencing, zoals extra kopieën genoom bewerken belemmeren zal. Als meerdere kopieën van de gids zijn consequent geïntroduceerd, moet een lager de concentratie van de ontharde gids gebruikt in afbinding. De vector en het protocol beschreven toestaan targeting van elk gen C. albicans . Hoewel C. albicans diploïde, moet alleen een interne transformatie richten op beide allelen van een gen. Bovendien kan de processive aard van het bewerken van CRISPR-CaCas9-genoom onderzoekers richten op meerdere leden van gene gezinnen. Veel gene gezinnen zoals de secreted aspartyl proteasen (SAPS) en de volgorde van de agglutinin-achtige eiwitten (ALS) zijn belangrijk voor C. albicans virulentie. CRISPR genoom bewerken vergemakkelijkt onderzoek van deze gene-families.

De protocollen die hierboven beschreven wordt een stop codon kennismaken door een open leesraam, resulterend in de fenotypische equivalent van een null (Figuur 2). Een breed scala aan genetische afwisseling kan worden gemaakt door het variëren van de reparatie-sjabloon. Onzin, missense en stille mutaties kunnen worden ingevoegd via recombinatie met een passende reparatie-sjabloon. Opneming van een beperkingsplaats stroomlijnt transformant screening, zoals degenen zonder moeten worden gescreend door de sequencing van12,,13. Daarnaast is C. albicans CRISPR kan onderzoekers genereren invoegingen en verwijderingen, waardoor het een ideaal systeem affiniteit tags invoegen, het uitvoeren van de promotor swaps, en het genereren van uitsparingen (Figuur 3). Screening voor de juiste transformants voor deze mutaties is meer moeizaam, want het is noodzakelijk om de volgorde van de bewerkingen ter bevestiging van de correcte integratie van de reparatie-sjablonen. Zuidelijke vlek mogelijk bovendien noodzakelijk zijn om extra kopieën van een gen niet op extra locaties in het genoom zijn ingevoegd. De eis van de NGG PAM-site plaatst lichte beperkingen op de regio's van het genoom die kunnen worden gericht. De ontwikkeling van alternatieve CRISPR-systemen die gebruikmaken van alternatieve nucleasen zoals Cpf1 of variaties op de Cas9 systeem hebben/zal verlichten veel van deze beperkingen14. Bij de onderzoekers weten op dit moment hebben deze systemen nog niet vereffend met C. albicans.

Het systeem van de CRISPR zoals beschreven in het bovenstaande protocol heeft ontwikkeld, zodat het kan worden toegepast in een breed scala van soorten waaronder Saccharomyces cerevisiae, Naumouozyma castelliien de menselijke pathogenen Candida glabrata11 . Transformatie en efficiënte bewerking van deze gist vereist lichte wijzigingen in het protocol beschreven, maar het kader voor het bewerken van deze alternatieve genoom is opvallend vergelijkbaar met die beschreven voor C. albicans12. Bovendien, gist bieden een uitstekend mechanisme te ontwikkelen genoom bewerken van procedures. In gist, wanneer ADE2 is gemuteerd, accumuleert een voorloper van de adenine biosynthese pathway, draaien de cellen rood. Deze gemakkelijk waarneembare fenotype kan onderzoekers bewerkte cellen opsporen en snel oplossen genoom protocollen bewerken. Gecombineerd met de uitgebreide moleculaire biologie-werkset beschikbaar voor schimmels, protocollen voor het bewerken van talrijke gist soorten geweest ontwikkelde15,16. Een brede toepassing van genoom bewerken technologie in schimmels heeft de potentie om beduidend beïnvloeden een breed scala aan wetenschappelijke disciplines.

CRISPR heeft sterk verbeterde de efficiëntie in C. albicansingenieurswetenschappen genoom, maar tot op heden CRISPR niet is gebruikt voor het uitvoeren van genoom-brede schermen in C. albicans. Huidige protocollen vereisen een reparatie-sjabloon in te voeren van mutaties, zoals het nonhomologous einde traject meedoen met C. albicans inefficiënt12 is. De generatie van reparatie sjabloon oligos voor elk gen is een belangrijke belemmering voor de uitvoering van genoom-brede schermen. De samenvloeiing van verminderde kosten voor DNA-synthese en voorschotten aan CRISPR technologieën zal ontwikkeling van schrapping bibliotheken meer haalbaar maken. Bijvoorbeeld, effent uitdrukking van een sjabloon van de reparatie van de CaCas9-vector de weg voor de ontwikkeling van duurzame plasmide bibliotheken die gericht zijn op elke gen11. Bovendien, voorbijgaande Candida CRISPR protocollen die geen CaCas9 expressie vector nemen in het C. albicans genoom vereisen geweest ontwikkelde17. Daarnaast verhoogd gids expressie verhogingen genoom efficiëntie18bewerken. Deze en andere vorderingen op CRISPR technologieën, zijn cruciaal voor de ontwikkeling van genoom-brede schermen in C. albicans19,20,21,22.

Het genoom van C. albicans diploïde, maar A en B allelen niet altijd identiek5. Dergelijke heterozygoten biedt zowel mogelijkheden als uitdagingen. Als men wil richten op beide allelen, moeten een PAM site gids volgorde en reparatie-sjabloon die op beide kopieën van het gen inwerken zal worden gebruikt. Echter kunnen afhankelijk van één nucleotide polymorphisms in een gen aanwezig, het C.albicans CRISPR-systeem onderzoekers te richten op een één allel. Dergelijke precisie heeft het potentieel om onderzoekers te onderzoeken van functionele verschillen tussen allelen. Gericht op specifieke allelen moet zorgvuldig gebeuren, zoals verlies van heterozygoten (LOH) op een allel of van een gehele chromosoom heeft waargenomen. Bij het bewerken van één C. albicans allelen, men moet onderzoeken aangrenzende opeenvolgingen van DNA om te bepalen als een kloon een diploïde SNP-profiel onderhoudt. Daarnaast af-target effecten zijn vrij laag voor C. albicans CRISPR, maar hele genoom sequencing kan worden beschouwd voor de belangrijkste stammen.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs Dr. Gennifer Mager dank voor lezing en nuttige opmerkingen op het manuscript. Dit werk werd gesteund door Ball State University laboratorium opstarten middelen en NIH-1R15AI130950-01 tot en met D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics