CRISPR-medieret genom-redigering af menneskelige svampe patogen Candida albicans

* These authors contributed equally
Genetics
 

Summary

Effektiv genom engineering af Candida albicans er afgørende for forståelsen af patogenesen og udvikling af lægemidler. Her, beskrev vi en protokol for at hurtigt og præcist redigere C. albicans genom ved hjælp af CRISPR. Protokollen giver mulighed for efterforskerne at indføre en lang række genetiske modifikationer herunder punktmutationer, indsætninger og sletninger.

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Denne metode beskriver den effektive CRISPR medieret genom-redigering af den diploide menneskelige svampe patogen Candida albicans. CRISPR-medieret genom-redigering i C. albicans kræver Cas9, guide RNA, og reparere skabelon. Et plasmid, udtryk for en gær codon optimeret Cas9 (CaCas9) er blevet genereret. Guide sekvenser direkte opstrøms fra en PAM websted (NGG) er klonet i Cas9 udtryk vektor. Reparation skabelon er derefter foretaget af primer udvidelse i vitro. Cotransformation reparation skabelon og vektor i C. albicans fører til genom-redigering. Afhængigt af den reparation skabelon anvendes, kan investigator indføre nukleotid ændringer, indrykninger eller sletninger. Som C. albicans er en diploid, lavet mutationer i begge alleler for et gen, forudsat at A og B alleler ikke havnen SNPs, der forstyrrer guide målretning eller reparere skabelon indarbejdelse. Stor gene familier kan redigeres parallelt, hvis egnet bevarede sekvenser findes i alle familiens medlemmer. C. albicans CRISPR systemet beskrevet er flankeret af FRT websteder og koder flippase. Ved induktion af flippase, er antibiotika markør (CaCas9) og guide RNA fjernet fra genomet. Dette tillader investigator skal udføre efterfølgende redigeringer af genomet. C. albicans CRISPR er en kraftfuld svampe genteknologi værktøj, og mindre ændringer i de beskrevne protokoller tillader ændring af andre svampe arter, herunder C. glabrata, N. castellii, og S. cerevisiae.

Introduction

Candida albicans er den mest udbredte menneskelige svampe patogen1,2,3. Forståelse forskelle mellem C. albicans og pattedyr Molekylærbiologi er afgørende for udviklingen af den næste generation af svampedræbende therapeutics. Dette kræver efterforskerne at være i stand til hurtigt og præcist genetisk manipulere C. albicans.

Genmanipulation af C. albicans har historisk set været udfordrende. C. albicans opretholde ikke plasmider, således alle konstruktioner skal inkorporeres i genomet. Derudover er C. albicans diploide; Derfor, når udskære et gen eller at indføre en mutation, det er vigtigt at sikre, at begge kopier har været ændret4. Derudover er nogle C. albicans loci heterozygous, yderligere komplicerer genetiske forhør5. For at genmanipulere C. albicans, er det typisk til at udføre flere runder af homologe rekombination6. Men diploide art genom og besværlige konstruere udvikling har gjort dette en potentielt kedelig proces, især hvis der kræves flere ændringer. Disse begrænsninger og medicinsk betydningen af C. albicans kræver udvikling af nye teknologier, der giver efterforskerne til lettere manipulere C. albicans genom.

Grupperet regelmæssigt interspaced korte palindromiske gentagelser (CRISPR)-medieret genom-redigering er et kraftfuldt værktøj, der giver forskere til at ændre rækkefølgen af en genom. CRISPR kræver tre komponenter: 1) den Cas9 nukleasen, der kløver target-DNA, 2) en 20 basere guide-RNA, som er rettet mod Cas9 til sekvensen af interesse, og 3) reparation skabelon DNA, der reparerer webstedet kavalergang og inkorporerer tilsigtet ændring7, 8. Når guiden bringer Cas9 til target genomet sekvens, Cas9 kræver en protospacer tilstødende motiv (PAM) sekvens (NGG) direkte opstrøms af guide sekvens til kløver DNA9. Kravet om, at både den 20 base guide og PAM sekvenser giver en høj grad af målretning specificitet og begrænser off target kavalergang.

CRISPR systemer er designet til at redigere genomer af et mangfoldigt sæt af organismer og tackle en bred vifte af problemer10. Beskrevet her er en fleksibel, effektiv CRISPR protokol for at redigere et C. albicans gen af interesse. Eksperimentet introducerer en stop codon et gen, forårsager oversættelse opsigelse. Andre redigeringer kan gøres afhængig af skabelonen reparation, der er indført. En fragment mærket med nourseothricin (Natr) indeholdende gær codon-optimeret Cas9 (CaCas9) og en guide RNA er indarbejdet i C. albicans genom på et neutralt sted. Cotransformation med reparation skabelon kodning ønskede mutationen fører til reparation af kløvningen af homologe rekombination og effektiv genom-redigering. Beskrevet nedenfor er redigering af TPK2, men alle C. albicans åben læsning rammer kan målrettes flere gange af CRISPR. CRISPR systemet er flankeret af FRT websteder og kan fjernes fra C. albicans genom ved induktion af flippase kodet på CaCas9 udtryk plasmid. C. albicans CRISPR systemet muliggør efterforskere hurtigt og præcist redigere C. albicans genom11,12.

Protocol

1. identifikation og kloning af Guide RNA sekvens

  1. Identifikation af guide RNA sekvens
    1. Identificere en 5'-NGG-3' PAM sekvens tæt på hvor der indsættes stop-codon. (Figur 1A) Mærket findes alle PAM sekvenser i de første 100 basepar af TPK2 (figur 1A).
      Bemærk: Guide sekvenser målretning hver C. albicans åben behandling ramme kan findes på http://osf.io/ARDTX 11,12.
    2. Identificere frem Guide Primer_3 sekvens, som vil være 20 baser direkte opstrøms af et NGG PAM site og vil ikke indeholde mere end 5 Ts i træk. Venstreklik på base direkte opstrøms NGG og træk markøren 20 baser, derefter venstre-klik på fanen primer til at tilføje primeren.
    3. Identificere Reverse Guide Primer_3 sekvens, som vil være supplement til frem Guide sekvens.
      Bemærk: Vist er guider, der bruger PAM_3 (figur 1B).
    4. Højreklik på primeren og vælg "Kopier primer data". Indsætte sekvenserne i en tekst redigering program.
  2. Tilføje overhæng sekvenser til Forward og Reverse Guide oligos at lette kloning (tabel 1, figur 1B).
    1. Tilføje nucleotidsekvensen ATTTG til 5'-enden af den fremad Guide Primer_3 før du køber.
    2. Tilføje G til 3'-enden af den fremad Guide Primer_3 før du køber.
    3. Tilføje nucleotidsekvensen AAAAC til 5'-enden af Reverse Guide Primer_3 før du køber.
    4. Tilføje C til 3' enden af Reverse Guide Primer_3 før du køber.
  3. Fordøje CaCas9 udtryk vektor pV1524 med BsmBI.
    Bemærk: pV1524 indeholder en ampicillin (AmpRasmussen) og nourseothricin (Natr) markører. Cas9 har været codon-optimeret for C. albicans.
    1. Fordøje plasmidet ved at tilføje: 2 μg af pv1524, 5 μl af 10 x Buffer, 1 μL BsmBI og H2O til 50 μL i 1,5 mL rør. Der inkuberes ved 55 ° C i 20 min. (alternativt fordøje pv1524 for 15 min med Esp3I, en isoschizomer af BsmBI, ved 37 ° C.)
    2. Afkøle til stuetemperatur (RT) og spin for 30 s 2.348 x g at bringe kondens til bunden af røret. Fortsæt til trin 1.4 eller gemme den fordøjede plasmid ved-20 ° C.
  4. Fosfatase-treat fordøjet rygraden.
    1. Tilsæt 1 μL af kalv intestinal fosfatase (CIP) til fordøjelsen blandingen og inkuberes ved 37 ° C i 1 time.
    2. Rense den fordøjede plasmid ved hjælp af en kommercielt tilgængelig polymerase kædereaktion (PCR) rensning kit (vejledningen med kit) og elueres det i 30 μL eluering buffer (EB).
  5. Phosphorylate og bind frem Guide Primer_3 og vende Guide Primer_3.
    1. Tilsæt 0,5 μL 100 μm frem Guide Primer_3, 0,5 μL 100 μm Reverse Guide Primer_3, 5 μl af 10 x T4 ligase buffer, 1 μL af T4 polynucleotide kinase og 43 μL af H2O til en PCR rør.
    2. Tilsæt 5 μl af 10 x T4 ligase buffer, 1 μL af T4 polynucleotide kinase og 44 μL af molekylær biologi-grade H2O i et andet PCR rør.
      Bemærk: Dette vil tjene som den negative kontrol.
    3. Inkuber reaktion blandinger i en thermocycler ved 37 ° C i 30 min., derefter ved 95 ° C i 5 min.
    4. Cool blanding med den langsomste rampe hastighed til 16 ° C at anneal, oligos. Derefter placere udglødet oligo blanding på 4 ° C.
  6. Ligate den udglødet oligos i fordøjet pv1524 fra trin 1.4.3.
    1. Tilføj følgende til en PCR rør: 1 μL af 10 x T4 ligase buffer, 0,5 μl af T4 DNA ligase, 0,5 μl af udglødet oligo mix, fordøjet CIP-behandlede renset plasmid (20 – 40 ng) og H2O til en 10 μL samlede volumen.
    2. Tilføj følgende til en PCR rør: 1 μL af 10 x T4 ligase buffer, 0,5 μl af T4 DNA ligase, fordøjet CIP-behandlede renset vektor (20 – 40 ng), 1 μL af negativ kontrol blanding, og H2O op til en 10 μL samlede volumen.
    3. Inkuber begge rør i en thermocycler ved 16 ° C i 30 min, så ved 65 ° C i 10 min og derefter afkøles til 25 ° C.
  7. Omdanne kemisk kompetente Escherichia coli DH5α ved hjælp af en standard heat shock transformation protokol 5 μl af ligatur blandinger. Vælg på LB Amp/Nat medier (200 μg/mL Amp, 50 μg/mL Nat).
    Bemærk: Undladelse af at vælge pV1524 og derivater deraf på dobbelt markering medier vil resultere i tab af Nat/CaCas9/guide modul af FLP/FRT excision i bakterier.
  8. Rense plasmider fra fire transformants af miniprep, og sekvens indsættelsen sekvens med sekventering primer (tabel 1).
    Bemærk: De fleste af den tid, sekventering 4 transformants er tilstrækkelige til at identificere mindst 1 korrekte klon.
  9. Gemme plasmider, der har guide RNA sekvens klonede en enkelt gang i BsmBI skær site på-20 ° C.

2. udformning og produktion af reparation skabelon

  1. Indsætte en stop codon ved at venstreklikke på gensekvens og tilføje nukleotider, som indkode en stop codon og begrænsning fordøjelsen websted (figur 1 ctabel 1).
    Bemærk: Indsættelsen vil forstyrre PAM sekvens.
    Bemærk: En restriktion fordøjelsen site vil indgå i reparation skabelon sekvens til at lette effektiv screening af kloner (figur 1 c).
  2. Venstreklik 10 baser nedstrøms af hvor mutationen vil blive foretaget og træk markøren 60 baserer opstrøms. Venstreklik på fanen primer til at tilføje primeren. Dette vil tilføje reparation skabelon Forward_3. Venstreklik 10 baser opstrøms af hvor mutationen vil blive foretaget og træk markøren 60 baserer nedstrøms. Venstreklik på fanen primer til at tilføje primeren. Dette vil tilføje reparation skabelon Reverse 3. (Figur 1 c)
  3. Udføre primer udvidelse for at generere reparation skabelon.
    1. Der tilsættes 1,2 μL 100 μm reparation skabelon fremad primer, 1,2 μL 100 μm reparation skabelon omvendt primer, 6 μL af deoxynucleotide triphosphates (dNTP'er) (samlet koncentration 40 mM), 6 μL af bufferen, 0,6 μL af Taq-polymerase (3 enheder) og 45 μL af H2O til hver af de 4 PCR rør.
    2. Udføre primer udvidelse af kører mellem 20 og 30 runder af PCR. Eksempel udvidelse betingelser: 2 min. ved 95 ° C, (30 s ved 95 ° C, 1 min. ved 50 ° C, 1 min på 68 ° C) x 34, 10 min til 68 ° C.
    3. Kombinere indholdet af alle 4 PCR rør i 1,5 mL rør og bruge en PCR rensning kit til at rense produkter i 50 μL af H2O.
    4. Kvantificere primer udvidelse produkter for at sikre tilstrækkelig DNA ved bestemmelse af absorbans på 260 nm.
      Bemærk: Typiske endelige koncentration af primer forlængelse produkt er ~ 200 – 300 ng/µL.

3. omdannelse af C. albicans med reparation skabelon og Plasmid

  1. Gør TE/lithium acetat.
    1. Mix 10 mM Tris-Cl, 1 mM EDTA, 100 mM lithium acetat og H2O (alle stamopløsning pH 7,5) at opnå 50 mL samlede volumen.
  2. Gøre plade
    1. Bland 40% PLØK 3350, 100 mM lithium acetat, 10 mM Tris-Cl, 1 mM EDTA og H2O (alle stamopløsning pH 7,5) for at opnå 50 mL samlede volumen.
  3. Fordøje korrekt klonet plasmider fra trin 1.9.
    1. Tilføje 10 μg plasmid, 4 µL af 10 x buffer, 0,4 µL af 10 mg/mL bovint serumalbumin (BSA), 0,5 µL af KpnI, 0,5 µL af SacI og H20 til 40 µL samlede volumen i en 1,5 mL tube. Der inkuberes ved 37 ° C natten over (fig. 1 d).
  4. Vokse en overnight kultur af C. albicans SC5314, wild-type prototroph, ved 25 ° C i gær pepton dextrose suppleret med 0,27 mM Uridine (YPD + Uri), ideelt til OD600 mindre end 6.
    1. Pellet 5 OD600 enheder af celler pr. transformation af spinning i 5 min på 2.348 x g og suspendere de 5 OD600 pelleted celler i 100 µL TE/lithium acetat.
  5. Tilføj følgende til en 1,5 mL rør i den anførte rækkefølge: 1) 100 µL af celler fra trin 3.4.1, 2) 40 µL af kogt og quick-kølet laks sæd DNA (10 mg/mL), 3) 10 µg af plasmid fordøjelsen fra trin 3.3.1, 4) 6 µg af renset reparation skabelon og 5) 1 mL af pladen.
  6. Tilføj følgende til en 1,5 mL rør i den anførte rækkefølge: 1) 100 µL af celler, 2) 40 µL af kogt og quick-kølet laks sæd DNA (10 mg/mL), 3) H2O volumen lig med omdanne DNA i trin 3,5 og 4) 1 mL af pladen.
    Bemærk: Dette vil tjene som en negativ kontrol.
  7. Blandes transformationerne forsigtigt af pipettering og lad inkuberes ved 25 ° C natten over.
  8. Heat shock cellerne ved at placere dem i vandbad 44 ° C i 25 min.
  9. Spin i 5 min på 2.348 x g i en benchtop centrifuge og fjerne pladen blandingen supernatanten. Vask en gang ved tilsætning af 1 mL YPD + Uri og centrifugeres igen i 5 min på 2.348 x g.
  10. Suspendere celler i 0,1 mL af YPD + Uri og Ruger på et roller tromle eller shaker ved 25 ° C natten over.
  11. Plade på YPD + Uri med 200 μg/mL nourseothricin. Kolonier vil vises i 2-5 dage.

4. striber for enkelt kolonier

  1. Opdele en 100 mm x 15 mm petriskål i kvarte, og mærke hver kvadrant.
    1. Tryk på en af kolonierne fra transformation pladen med en steril tandstikker eller applikator og stribe på tværs af den længste side af kvadrant.
    2. Streak for enkelt kolonier ved hjælp af en aseptisk teknik og tillade kolonier til at vokse ved 30 ° C i 2 dage.

5. koloni PCR

  1. Design de fremad check primer (FCP) ~ 200 basepar opstrøms af webstedet restriktion, der blev indført og reverse check primer (RCP) ~ 300 basepar nedstrøms.
    1. Tilsættes 0,3 μl af FCP, 0,3 μl af RCP, 0,3 μl af termostabil polymerase (ExTaq 1,5 enheder), 3 μL af dNTP'er (samlet koncentration 40 mM), 3 μL ExTaq Buffer og 23 μL af H2O til en 1,5 mL tube.
      Bemærk: Tilsætning af 0,5 μL/reaktion dimethylsulfoxid (DMSO) kan forbedre PCR effektivitet.
    2. Tilføje 0,25 μL af en enkelt gær koloni fra trin 4.1.2 til blandingen fra trin 5.1.1, ved hjælp af en P10 pipette tip og pas på ikke for at forstyrre agaren.
    3. Forstærke DNA ved PCR og køre 5 μl PCR på en gel til at sikre forstærkning er vellykket, pas på ikke for at forstyrre den celle pellet i bunden af røret.

6. begrænsning fordøjelsen af kolonien PCR

  1. Tilsæt 10 μl PCR produkt (pas på ikke at ikke forstyrre den celle pellet i bunden af røret), 3 μL af bufferen, 1 μL af begrænsning enzym og 16 μL af H2O, derefter inkuberes ifølge producentens anvisninger og løse på en agarosegel at identificere tilsvarende CT genom redigeringer.
    Bemærk: Begrænsning enzymet bruges her er hjemmesiden kodet i skabelonen TPK2 specifikke reparation.

7. besparelse stammer

  1. Vokse en overnight kultur fra kolonier, der er blevet bekræftet af begrænsning fordøjelsen i YPD + Uri ved 30 ° C.
  2. Der tilsættes 1 mL af kultur og 1 mL af 50% glycerol (bringe den endelige koncentration af glycerol til 25%) til et egnet til opbevaring ved-80 ° C.
  3. Gemme de korrekte kloner ved-80 ° C.
    Bemærk: Korrekte stammer kan opbevares ved-80 ° C i mange år.

8. fjernelse af Natr markør

  1. Streak korrekte transformant på gær pepton maltose (YPMaltose) (2% maltose).
  2. Vælge en koloni fra den stribede plade og kultur gær i 48 timer ved 30 ° C i flydende YPMaltose 20 g/L maltose.
  3. Plade 200 – 400 celler på YPMaltose 20 g/L maltose og inkuberes ved 30 ° C i 24 timer.
  4. Replikere plade på YPMaltose og YPMaltose 200 μg/mL Nat.
  5. Der inkuberes ved 30 ° C i 24 timer.
    Bemærk: Kolonier, der ikke længere vokser på YPMaltose 200 μg/mL nourseothricin men vokse på YPMaltose har mistet Natr markør (CaCAS9) og guide RNA.
  6. Gem de stammer, der har mistet Natr markør (CaCAS9) og guide RNA som gjort i trin 7.1-7,3.
    Bemærk: En lignende plasmid, pV1393, bruger SAP2 i stedet for en MAL2 promotor. Vækst på YCB – BSA vil fremkalde flippase og fjernelse af Natr hvis pV1393 bruges til redigering af genet.

Representative Results

Sekvenser af guide RNA'er og reparation skabeloner, der er målrettet C. albicans TPK2, en c-AMP kinase katalytisk subunit, blev designet ud fra retningslinjerne foreslået ovenfor. Sekvenser er vist i (tabel 1, figur 1). Guide RNA'er blev klonet i CaCas9 udtryk vektorer og cotransformed med reparation skabelon i wild-type C. albicans. En EcoRI begrænsning fordøjelsen websted og stop kodon i skabelonen reparation forstyrre webstedet PAM og lette screening for korrekte mutanter (figur 1). Transformants var stribede for enkelt kolonier og screenet af kolonien PCR og begrænsning fordøjelse til indbygning af reparation skabelon (figur 2). Begrænsning fordøjelse adskiller hurtigt vildtype fra mutant sekvenser.

Oligonukleotid navn Oligonukleotid sekvensen
Fremad Guide Primer_3 ATTTGgggtgaactatttgttcgccG
Omvendt Guide Primer_3 AAAACggcgaacaaatagttcacccC
Reparation skabelon Forward_3 tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
Reparation skabelon Reverse_3 attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
Fremad Check Primer ttaaagaaacttcacatcaccaag
Reverse Check Primer actttgatagcataatatctaccat
Sekventering Primer ggcatagctgaaacttcggccc

Tabel 1: liste over oligo nukleotider anvendes til denne undersøgelse. Websteder tilføjet for kloning formål er med store bogstaver og fed i guide primer sekvenser. Sekvenser i skabelonen reparation at mutere genomisk DNA er med store bogstaver og fed.

Figure 1
Figur 1 : Diagram over guide RNA og reparation skabelondesign. (A) mærkningsbestemmelserne i alle PAM sekvenser i de første 100 nukleotider i TPK2. PAM sekvens 3 (PAM_3) er fremhævet, som er den sekvens, der anvendes i denne undersøgelse. (B) Guide RNA design ved hjælp af PAM_3. 20 base primere designet ved hjælp af SnapGene er små og blå. Ekstra baser kræves for kloning er store og grønne vist offset. (C) reparation skabelon primere, som indsætter en TAA stop codon og EcoRI site er indsat i TPK2 læsning frame. DNA, der adskiller sig fra vildtype sekvens er røde og store bogstaver. (D) eksempel på hvordan en guide er designet på den positive streng af DNA ved hjælp af PAM_4. (E) skematisk diagram over pV1524 efter kloning af guide RNA og fordøjelse med KpnI og SacI. Neut5L-5' og Neut5L-3' target vektor til webstedet Neut5L i C. albicans genom. CaENO1p er en promotor, der driver udtryk af gær-optimeret CaCas9. Natr er nourseothricin modstand kassette. CaSNR52p er promotor kørsel guide RNA udtryk (sgRNA). FRT websteder er kløvet og rekombineret af flippase (FLP) at fjerne CRISPR kassette på flippase udtryk. En skematisk svarende til (E) blev offentliggjort af Ugilt mfl. 11. venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Introduktion og bekræftelse af en stop codon og EcoRI begrænsning websted til TPK2. Primere anvendes til forstærkning er angivet i tabel 1. Wild-type og mutant sekvenser er vist nedenfor gel. Dette tal er blevet ændret fra Ugilt et al.11. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Tegneserie beskrivelse af reparation skabeloner, der genererer a sletninger og b indsætninger. Grå streger i (A) skildrer mellemliggende sekvenser ikke er til stede i reparation skabelon primere. Venligst klik her for at se en større version af dette tal.

Discussion

C. albicans CRISPR effektivt redigeringer C. albicans genom. pV1524 koder en gær codon-optimeret Cas9 og er designet således, at efterforskere kan nemt klone guide RNA sekvenser nedstrøms CaSNR52 promoter (figur 1)11. Det skal sikres, at kun en enkelt kopi af guide sekvens har været klonet i CaCas9 udtryk vektorer af sekventering, som ekstra eksemplarer vil hindre genom-redigering. Hvis flere kopier af guiden er indført konsekvent, bør en lavere koncentration af udglødet guide bruges i ligatur. Vektor og beskrevet-protokollen giver mulighed for målretning af enhver C. albicans gen. Selv om C. albicans er diploide, er kun en enkelt transformation forpligtet til at målrette begge alleler for et gen. Desuden giver processive art CRISPR-CaCas9 genom-redigering forskerne til at målrette flere medlemmer af genet familier. Mange gen familier som udskilles aspartyl proteaser (SAPS) og agglutinin-lignende sekvens proteiner (ALS) er vigtige for C. albicans virulens. CRISPR genom-redigering vil lette undersøgelsen af disse gen familier.

De protokoller, der er beskrevet ovenfor introducere en stop codon til en åben læsning ramme, hvilket resulterer i fænotypisk svarer til en null-værdi (figur 2). En lang række genetiske vekslen kan gøres ved at variere reparation skabelonen. Vrøvl, missense og tavse mutationer kan indsættes via rekombination med en passende reparation skabelon. Inkorporering af en restriktion stedet strømliner transformant screening, som dem uden skal screenes af sekventering12,13. C. albicans CRISPR kan desuden forskere til at generere indsættelser og sletninger, hvilket gør det et ideelt system til at indsætte affinitet tags, udføre promotor swaps og generere knockouts (figur 3). Screening for korrekte transformants for disse mutationer er mere besværlig, da det er nødvendigt at sekvens redigeringer for at bekræfte korrekte indarbejdelse af reparation skabeloner. Derudover kan sydlige skamplet blive nødvendigt at sikre yderligere kopier af et gen ikke er indsat flere steder i genomet. Kravet om webstedet NGG PAM steder mindre begrænsninger på områder af genomet, der kan målrettes. Udvikling af alternative CRISPR systemer, der anvender alternative nukleaser såsom Cpf1 eller variationer over Cas9 system har/vil afhjælpe mange af disse begrænsninger14. Efterforskere viden på dette tidspunkt, har disse systemer ikke endnu blevet anbragt til C. albicans.

CRISPR systemet beskrevet i ovennævnte protokol er udviklet sådan, at det kan anvendes i en bred vifte af arter, herunder Saccharomyces cerevisiae, Naumouozyma castelliiog den menneskelige patogen Candida glabrata11 . Transformation og effektiv redigering af disse gær kræver mindre ændringer til den beskrevne protokol, men rammerne for redigering disse alternative genomer er bemærkelsesværdigt ens til som beskrevet for C. albicans12. Desuden gær giver en udmærket mekanisme til at udvikle genom-redigering procedurer. I gær, når ADE2 er muteret, akkumuleres en forløber for adenin biosyntese pathway, vender cellerne røde. Denne nemt observerbare fænotype giver efterforskerne at identificere redigerede celler og hurtigt fejlfinding genom-redigering protokoller. Kombineret med omfattende Molekylærbiologi værktøjskassen tilgængelig for svampe, har protokoller til redigering mange gær arter været udviklede15,16. Sådan en bred anvendelse af genom-redigering teknologi i svampe har potentiale til at betydeligt påvirke en lang række videnskabelige discipliner.

CRISPR har væsentligt forbedret effektiviteten af genom engineering i C. albicans, men indtil CRISPR er ikke blevet brugt til at udføre genom brede skærme i C. albicans. Nuværende protokoller kræver en reparation skabelon at indføre mutationer, som den nonhomologous ende tiltræder pathway i C. albicans er ineffektive12. Generation af reparation skabelon oligos for hvert gen er en betydelig hindring for udførelsen af genome-wide skærme. Sammenløbet af nedsat omkostningerne ved DNA-syntese og forskud til CRISPR teknologier vil gøre udviklingen af sletning biblioteker mere gennemførlig. For eksempel, baner udtryk for en reparation skabelon fra CaCas9 vektor vejen for udvikling af bæredygtig plasmid biblioteker, der er målrettet alle gen11. Derudover har forbigående Candida CRISPR protokoller, der ikke kræver CaCas9 udtryk vektor indarbejde i C. albicans genom været udviklede17. Derudover steg guide udtryk stigninger genom-redigering effektivitet18. Disse og andre fremskridt til CRISPR teknologier, er afgørende for udviklingen af genome-wide skærme i C. albicans19,20,21,22.

C. albicans genom er diploid, men A og B alleler er ikke altid identiske5. Sådanne heterozogycitet giver både udfordringer og muligheder. Hvis man har til formål at målrette begge alleler, skal en PAM site, guide sekvens og reparation skabelon, der skal fungere på begge kopier af genet anvendes. Dog giver afhængig af enkelt nucleotid polymorfier i et gen, C.albicans CRISPR system efterforskerne til at målrette en enkelt allel. Sådan præcision har potentiale til at tillade efterforskere at undersøge funktionelle forskelle mellem alleler. Rettet mod specifikke alleler skal gøres forsigtigt, som tab af heterozygositet (LOH) på en allel eller af en hel kromosom er blevet observeret. Når du redigerer enkelt C. albicans alleler, man skal undersøge tilstødende DNA-sekvenser for at bestemme, hvis en klon har opretholdt en diploide SNP profil. Derudover off target effekter er ganske lav for C. albicans CRISPR, men hele genome sequencing kan anses for vigtige stammer.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Forfatterne takke Dr. Gennifer Mager for læsning og nyttige kommentarer til manuskriptet. Dette arbejde blev støttet af Ball State University laboratorium start midler og NIH-1R15AI130950-01-D.A.B.

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics