Etablering av Viral infeksjon og analyse av Host-Virus samhandling i Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Denne protokollen beskriver hvordan du oppretter viral infeksjon i vivo i Drosophila melanogaster bruker nano-injeksjon metoden og grunnleggende teknikker for å analysere virus vert interaksjon.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Viruset sprer seg er en viktig årsak til epidemien sykdommer. Dermed forstå samspillet mellom viruset og vert er svært viktig å utvide vår kunnskap om forebygging og behandling av virusinfeksjon. Frukt fly Drosophila melanogaster har vist seg for å være en av de mest effektive og produktive modell organismene å skjermen for antiviral faktorer og undersøke virus vert interaksjon, kraftige genetisk verktøy og høyt konservert medfødte immunsystemet signalveier. Fremgangsmåten som er beskrevet her viser en nano-injeksjon metode for å etablere viral infeksjon og indusere systemisk antiviral svar i voksen fluer. Presis kontroll av viral injeksjon dosen i denne metoden gjør det mulig for høyt eksperimentell reproduserbarhet. Protokoller som er beskrevet i denne studien omfatter utarbeidelse av fluer og viruset, injeksjon metoden, survival rate analyse, viruset belastning målingen og en antiviral veien vurdering. Innflytelse effekten av viral infeksjon av fluene bakgrunn ble nevnt her. Denne infeksjon metoden er enkel å utføre og kvantitativt repeterbare; Det kan brukes å skjermen for vert/viral faktorer virus vert samhandlingen og dissekere crosstalk mellom medfødte immunsystemet signalering og andre biologiske banene svar på virusinfeksjon.

Introduction

Emerging viral infeksjoner, spesielt av arboviruses, som den Chikungunya virus1, Dengue virus, gulfeber virus2 og Zikavirus3, har blitt en stor trussel mot folkehelsen ved forårsaker pandemier 4. dermed en bedre forståelse av virus-vert interaksjon har blitt stadig viktigere for epidemien kontroll og behandling av sykdommer hos mennesker. For dette målet, må mer hensiktsmessig og effektiv modeller opprettes undersøke mekanismene bak virusinfeksjon.

Drosophilamelanogaster (D. melanogaster), gir et kraftig system for å undersøke virus vert samhandling5,6 og har vist seg for å være en av de mest effektive modellene å studere menneskelige sykdommer7 , 8 , 9. høyt konservert antiviral signalnettverk trasé og makeløs genetisk verktøy gjør flyr en flott modell å produsere betydelige resultater med reelle konsekvenser for menneskelig antiviral studier. I tillegg fluer er enkelt og billig å opprettholde i laboratoriet og er praktisk for store screening av romanen regulatoriske forhold6,10 i viruset og vert under infeksjon.

Fire store høyt konservert antiviral veier (f.eks., RNA forstyrrelser (RNAi) veien11, JAK-STAT veien12, NF-κB veien og autophagy veien13) er godt studert i Drosophila i siste år6. RNAi veien er en bred antiviral mekanisme som kan undertrykke de fleste typer virus infeksjon6,14. Forstyrrelse av denne veien av mutasjon i gener som Dicer-2 (Dcr-2) eller Argonaute 2 (AGO2) kan føre til økt virus titer og vert dødelighet15,16,17. JAK-STAT veien har vært innblandet i kontroll av infeksjon av virus fra Dicistroviridae familien og Flaviviridae familien i insekter, f.eks., Drosophila C-viruset (DCV) flyr16 og West Nile virus (WNV) og Dengue Virus i mygg18,19. Drosophila Toll (homologe til menneskelig NF-κB veien) og immunforsvarsvikt (IMD) veier (ligner menneskelige NF-κB og TNF veien) er involvert i å forsvare virus invasjonen20,21, 22. autophagy er en annen bevarte mekanisme involvert i regulering av virusinfeksjon, som er godt preget i Drosophila23,24. Dermed identifikasjon av romanen regulatoriske forhold av disse stier og dissecting crosstalk mellom disse antiviral signalering og andre biologiske banene, som metabolisme, aldring, neural reaksjon og så videre, kan enkelt defineres i Drosophila system.

Selv om mest veletablerte viral smittsomme modeller i Drosophila er indusert av RNA virus, infeksjon av virvelløse iriserende Virus 6I (IV-6) og Kallithea virus har vist potensialet for studier av DNA virus i fluer25, 26. Videre kan viruset også endres for å tillate infeksjon i Drosophila, for eksempel influensavirus9. Dette er betydelig utvidet bruk av Drosophila screening plattformen. Her bruker vi DCV som et eksempel for å beskrive hvordan å utvikle en viral smittsomme system i Drosophila. DCV er en positiv-følelse enkelt strandet RNA virus av ca 9300 nukleotider, koding 9 proteiner27. Som en naturlig patogen av D. melanogasteranses DCV som et passende virus å studere vert fysiologiske, adferd og basale immunrespons i verten-virus samhandling og samtidig evolusjon28. I tillegg gjør sin raske dødelighet etter infeksjon i vill type fluer DCV nyttig å skjermen for motstandsdyktig eller utsatt gener i vert29.

Men er det flere aspekter av bekymring når studere virusinfeksjoner i Drosophila. For eksempel har symbiotiske bakterier Wolbachia en evne for å hemme et bredt spektra av RNA-virus spredning i Drosophila og mygg30,31,32. Nyere bevis viser en mulig mekanisme som Wolbachia blokker Sindbis (SINV) smitte gjennom oppregulering av methyltransferase Mt2 uttrykk i de vert33. I tillegg er genetisk bakgrunn av insekter også avgjørende for virusinfeksjon. Den naturlige polymorfisme i genet, pastrel (pst), bestemmer for eksempel mottakelighet for DCV infeksjon i Drosophila34,35, mens loci Ubc-E2H og CG8492 er involvert i Cricket lammelse virus (CrPV) og Flock hus (FHV) smitte, henholdsvis36.

Den bestemte måten å etablere virus vert samspillet i fluer, må velges i henhold til forskningsformål som en høy gjennomstrømming skjerm for verten cellulære komponenter i Drosophila cellen linjer37,38, muntlig infeksjon å studere gut-spesifikk antiviral reaksjon22,39,40, nål pricking41,42 eller nano-injeksjon ved å sende epithelial barrierer for å stimulere systemisk immun svar. Nano-injeksjon kan nettopp kontroll viral dose for å indusere en kontrollert antiviral reaksjon og en fysiologisk lesjon43, dermed garantere høyt eksperimentell reproduserbarhet44. I denne studien beskriver vi en nano-injeksjon metode for å studere viruset vert interaksjoner i Drosophila, fremheve betydningen av fluene bakgrunn effekter.

Protocol

Merk: Før du starter eksperimentet, linjer og fly aksjer brukes må ikke være forurenset av andre patogener, spesielt for virus som DCV, FHV, Drosophila X virus (DXV) og Avian nefritt virus (ANV). Ideelt sett brukes RNA sekvensering eller en enklere PCR-baserte ID til å oppdage forurensning10,45. Hvis forurensning oppstod, linjer og fly aksjer bør ikke brukes lenger før de er dekontaminert helt46.

1. virus og Fly tilberedning

  1. Viruset overføring og samling
    Merk: Drosophila S2 * celler brukes for DCV overføring og titrering. S2 * celle linjen stammer fra en primær kultur for sent stadium D. melanogaster embryoer. Denne cellen linjen har blitt godt beskrevet tidligere47.
    1. Vokse S2 * celler i Schneider's Drosophila Medium ved 25 ° C uten ytterligere CO2, som en løs, semi tilhenger monolayer i 10 cm celle kultur parabol, på en tetthet på 1 x 107 levedyktig celler/mL. Bruk fullstendig medium for S2 * celler: Schneider's Drosophila Medium som inneholder 10% varme inaktivert FBS, 100 enheter/mL Penicillin og 100 μg/mL Streptomycin.
      Merk: Friske celler skal viser en rund form og utstillingen homogen størrelse.
    2. Raskt tine DCV lager fra-80 ° C i en 25 ° C vannbad. Infisere S2 * celler med DCV på MOI = 0,01 umiddelbart ved direkte å legge 1 mL av virus løsning til celle kultur rettene (vekstområde: 55 cm2) med 10 mL av komplett medium for S2 * celler.
    3. Inkuber celler ved 25 ° C i 3 til 5 dager. Når viruset er klar for innsamling, celle morfologi er unormal (celle figuren ser uskarphet) og kultur medium er full av svart partikler indikativ av celle rusk.
    4. Samle hele cellen kulturen i en 15 mL tube av pipettering opp og ned og fryse-80 ° c (for opp til ett år).
      Merk: DCV kan lagres i lengre tid ved-80 ° C med minimale tap av infectivity, opp til ett år.
    5. Tine cellekultur i en 25 ° C vannbad med konstant risting og deretter virvel 6000 x g, i 15 min på 4 ° C. Samle nedbryting i et sterilt 15 mL tube og vortex. Aliquot opp til 200 μL av virus løsning per rør.
      Merk: Virus dele kan lagres i korte perioder opptil 3 dager på 4 ° C og opp til 1 år på-80 ° C. Gjentatt frysing-Tin sykluser bør unngås. Det er alltid bedre å bruke alle aliquot samtidig.
    6. Plukke 5 tilfeldige virus inneholder rør å bestemme gjennomsnittlig virus vev kultur infeksiøs dose (TCID50) ved en cytopathic virkning (CPE) analysen (1 enhet av TCID50= 0,7 plakk danner enhet [PFU]).
      Merk: CPE refererer til strukturelle endringer i vertsceller forårsaket av viral invasjon. Infisere viruset forårsaker lysis av verten cellen, eller når cellen dør uten lysis på grunn av en manglende evne til å reprodusere48.
      1. På dag 1, samle forberedt S2 * celler av pipettering. Beregne cellen. Sentrifuge celler for 300 x g for 4 min og kast nedbryting. Fortynne cellene tettheten av 1 x 106 celler/mL med komplett medium for S2 * cellene som beskrevet i trinn 1.1.1.
      2. Frø 1 x 105 S2 * celler (100 μL) per brønn til flat bunn 96-brønnen-plate (~ 30% confluency).
      3. Utføre føljetong 10 ganger fortynninger av DCV aksjer med komplett medium for S2 * celler. Legge til 50 µL fortynninger i brønnen. Legge til 50 µL av kultur medium uten virus brønnen klassifisert som kontrollen negative godt.
        Merk: For hver fortynning rente, 8 brønner ble brukt. Som den typiske DCV gir er rundt 108-109 PFU/mL, bør minst fortynning dekker ~ 10-5-10-10.
      4. På dag 4, observere CPE med lyse-feltet mikroskop med en 20 X eller 40 X mål. Klassifisere et godt der cellene utydelig og mediet er fullt av en "positiv også", og en godt som cellen morfologi er normalt som "negative vel".
      5. Mark CPE positiv eller negativ brønner med + eller-, henholdsvis. Beregne viruset TCID50 av de Reed og Muench metoden49.
    7. Kast alle forurensede materialer og hansker i dekontaminering pannen. Hvis viruset ikke når ønsket TCID50, konsentrere 100 mL virus løsning av sentrifugering 68000 x g 1t på 4 ° C.
      Merk: avhengig av målet med forsøket, en rekke doser 102 til 106 TCID50 enheter kan brukes for virusinfeksjon. Vi bruker vanligvis 3 x 106 TCID50 enheter.
    8. Forkast nedbryting og å suspendere i 1 mL av Tris-HCl buffer (10 mM, pH 7.2). Aliquot 20 μL virus løsning per rør og butikk på-80 ° C. Strikk 5 tilfeldige rør å bestemme gjennomsnittlig viruset TCID50 igjen.
  2. Fly tilberedning for infeksjon
    Merk: Symbiotiske bakterier Wolbachia kan undertrykke mange typer RNA-virusinfeksjon i insekter,30,,31,,32,,33,,41. Derfor er det viktig å tømme Wolbachia fra fluer før han studerte vert-virus infeksjon i vivo33.
    1. Forberede fly mat som inneholder tetracycline ved å legge til 400 μL 50 µg/mL tetracycline (i 70% etanol) 4 g fersk standard cornmeal fly mat (1 L mat inneholder 77.7 g av cornmeal, 32.19 g gjær, 10.6 g agar, 0.726 g CaCl2 31.62 g av sukrose, glukose, 2 g av kalium sorbate og 15 mL 5% C8H8O363.3 g). Bland godt og plasser maten på 4 ° C over natten til å fordampe etanol.
      Merk: En høy dose av etanol kan påvirke fly fruktbarhet, så ikke utelate dette trinnet.
    2. Varm mat til romtemperatur og sette nylig eclosed voksen fluer (20 kvinner og 10 menn) i ampullen. Rase fluene ved 25 ° C, 60% fukt under en vanlig lys/mørke syklus.
      Merk: Vanligvis tar det 3-4 dager for fluene å legge nok egg. For mange egg hemme Larvene utvikling og redusere tetracycline effektivitet.
    3. Samle nylig eclosed voksen fluer (innen 3 ~ 5 dager) under en lys flyt av CO2, og gjenta trinn ~ 1.2.1-1.2.2. Vanligvis kreves minst tre generasjoner for fullstendig eliminering av Wolbachia.
    4. Etter 3 generasjoner med tetracycline behandling, samle flyr 5 under en lys flyt av CO2 Wolbachia infeksjon testen. Grind fluer i 1 min med 250 μL dobbel-destillert vann (ddH2O) og noen 0,5 mm sterilt keramiske perler i en 1,5 mL tube med en homogenizer. Legge til en annen 250 μL 2 x buffer A (0,2 M Tris-HCl, pH 9.0 0,2 M EDTA; 2% SDS) til prøve og vortex.
      Merk: Siden SDS vil hindre perle bevegelsen, 1 x buffer A kan direkte brukes til å slipe fluer. Hvis fluene har røde øyne, fjerne hoder før sliping, som dette kan påvirke fargen på DNA produktet.
    5. Fryse prøvene ved-80 ° C (holde opptil ett år). Raskt tine den prøven fra-80 ° C i en 25 ° C vannbad til oppløst. Inkuber prøvene på 70 ° C i 30 min.
    6. Legge til 190 μL 5 M KOAc, vortex og Inkuber på isen i 15 minutter eller lenger.
    7. Sentrifuge eksempler på 13000 x g i 5 minutter ved romtemperatur, samle nedbryting og overføre dem til nye rør.
    8. Gjenta trinn 1.2.7 hente DNA med bedre kvalitet.
    9. Legge til 750 μL isopropanol hvert utvalg og forsiktig Inverter noen ganger hånden. Inkuber ved romtemperatur for 5 min.
    10. Sentrifuge eksempler på 13000 x g i 5 minutter ved romtemperatur og kast nedbryting. Den hvite genomisk DNA pellet vil bo på bunnen av røret.
    11. Legge til 1 mL av 70% etanol pellets, sentrifuge 13.000 x g for 5 min, og kast nedbryting. Air-Dry DNA til det blir gjennomsiktige.
    12. Oppløse DNA i 100 μL ddH2O, sjarmere DNA konsentrasjon av UV-Vis absorpsjon spectrophotometry og fortynne DNA til 100 ng/μL.
    13. Bruk 200 ng DNA for PCR reaksjonen (i en 20 μL system, se Tabellen for materiale). Utføre PCR av følgende program: 95 ° C i 15 min; 36 syklus 95 ° c for 45 s, 50 ° C for 45 s og 72 ° C i 1 min; og et endelig utvidelse trinn (72 ° C for 1 min) i en termisk cycler.
      Merk: Basert på den Wolbachia 16S rRNA, bruker følgende primerne: 5' TGAGGAAGATAATGACGG 3' (fremover) og 5' CCTCTATCCTCTTTCAACC 3' (bakover). Wsp, var primerne 5' CATTGGTGTTGGTGTTGGTG 3' (fremover) og 5' ACCGAAATAACGAGCTCCAG 3' (bakover).
    14. Analysere PCR produkter med 1% agarose gel geleelektroforese. PCR produkt Wolbachia 16S rRNA og wsp er rundt 200 bp og 600 bp, henholdsvis.
    15. Bakre Wolbachia ledig fly lager på standard cornmeal fly mat. Samle 3-5 dagers nylig eclosed mann flyr for infeksjon.
      Merk: Tetracycline behandling kan også påvirke tarmen bakterieflora komposisjon, som senere påvirker antiviral svar på verten. Vi anbefaler at alle fluer skal få samme tetracycline behandlinger. Hold Wolbachia-fri fluer vokser under standard betingelser for minst 3 generasjoner gjenopprette tarmen bakterieflora.
  3. Pastrel genotyperingteknologi
    Merk: Tilstedeværelsen av det S eller R allelet av pst genet i genetisk bakgrunnen har blitt rapportert å påvirke DCV infeksjon i Drosophila34,35. Det er nødvendig å kontrollere pst genotype, spesielt for DCV infeksjon. Det er noen SNPs i pst som kan påvirke virusinfeksjon, store SNP er 512 C/T. Temperaturgradient PCR er en rask metode for å identifisere pst genotype.
    1. Ekstra fly genomisk DNA som beskrevet ovenfor (trinn 1.2.4 - 1.2.15).
    2. Bruk 100 ng av DNA som mal, 512C primer, 5' CAGCATGGTGTCCATGAAGTC 3' (fremover) og 5' ACGTGATCAATGCTGAAAGT 3' (bakover) å oppdage R allelet, 512T primer, 5' CAGCATGGTGTCCATGAAGTT 3' (fremover) og 5' ACGTGATCAATGCTGAAAGT 3' (bakover) for å oppdage den S allelet.
    3. Angi Tm (smelting temperatur) graderingene som følger: 54 ° C, 54.7 ° C, 55,5 ° C, 58 ° C, 59,7 ° C, 62.2 ° C, 63.7 ° C og 64 ° C (45 s hver temperatur).
      Merk: 30 sykluser av PCR kjedereaksjon anbefales (20 μL system).
    4. Visualisere 100-bp PCR produktet ved 2% agarose gel geleelektroforese.

2. viral infeksjon i Drosophila

  1. Infisere flyr av nano-injeksjon og utføre overlevelse analyser.
    1. Dra kapillærene å forberede injeksjon nåler, tilbake fylle injeksjon p med olje og montere injektoren som tidligere beskrevet50.
    2. Anaesthetize flyr på puten under en lys flyt av CO2. Vaksinere flyr av intra thorax injeksjon44 av 50.6 nL virus løsning (100 PFU, fortynnet med Tris-HCl buffer, pH 7.2). Sette inn minst 3 ampuller av fluer (20 fluer per medisinglass).
      Merk: Injeksjon er tidkrevende (vanligvis 100 fluer per time) DCV replikering er svært rask, så det er veldig viktig å skrive ned nøyaktig tid på røret når etterbehandling hvert hetteglass (20 fluer). Buffer bare injeksjon er angitt som en uekte kontroll. Vanligvis, er mannlige voksne fluene foretrukket, som resultatene er mer stabil og reproduserbar enn ved bruk av kvinner siden hormonelle varianter under mating og reproduksjon kan påvirke avlesning av kvinner51.
    3. Vokse injisert fluer ved 25 ° C, 60% fuktighet under en vanlig lys/mørke syklus. Leverer fluer med fersk mat daglig og registrere antall døde flies.
    4. Utføre minst 3 biologiske gjentak og plotte overlevelse kurven.
    5. For statistisk analyse av overlevelse data, generere Kaplan-Meier overlevelse kurver ved statistisk programvare. Utfør Logg-rangering for å beregne P verdiene. Angi informasjon for hvert emne i tabellen overlevelse. Programvaren beregner prosent overlevelse på hver gang, og tomter en Kaplan-Meier overlevelse plott.
      Merk: Ikke Legg mer gjær i ampullen. Sammenlignet med uekte kontroller, DCV-infiserte flyr noen ganger har ascites og klønete, som gjør dem utsatt for klissete gjær. Det er bedre å ta mer tid poeng i innledende forsøket å finne ut en tidsramme hvor massive død vil skje for infiserte fluer. Generelt, infiserte fluene sjelden dø innen to dager, selv for Dcr-2 mutant linjene. Den Wolbachia gratis w1118 (Bloomington 5905) fly infisert med 100 PFU av DCV, er dette tidsvinduet rundt 3-5 dager legge infeksjon. Frukt fluer som dør i 0,5 innlegget injeksjon timer bør ikke bli regnet som en dødsulykke fordi de kan bli drept av nålen skade ikke av viral infeksjon.
  2. DCV laste mål ved CPE analysen
    Merk: Viral belastning måles tilsvarende Serine virus lager (trinn 1.1.6), men krever flere eksempler forberedelse (trinn 2.2.1-2.2.4).
    1. På dag 1, infisere mannlige fluer som beskrevet i trinn 2.1.1-2.1.2. Gruppere injisert fluer i grupper på 20 og holde dem vokser på fersk fly mat for tiden (typisk for 24 timer eller 3 dager). Gi fluer fersk mat daglig.
    2. På dag 2, frø Drosophila S2 * celler i en 10 cm celle kultur parabol til tettheten av ca 5 x106 til 1 x 107 celler/mL som beskrevet i trinn 1.1.1.
    3. Dag 3, samle 5 fluer (under en lys flyten av CO2) og male dem i et 1,5 mL sentrifuge rør for 30 s med 200 μL Tris buffer og keramiske perler ved hjelp av homogenizer. Lagre prøvene ved-80 ° C eller umiddelbart videre til neste trinn.
    4. Grundig vortex prøven. Bruk en 1 mL sprøyte og 0.22 μm å filtrere nedbryting slik nye 1,5 mL. Fortsett med titrering, som beskrevet i trinn 1.1.6.1-1.1.6.5.
  3. DCV Last målt ved qRT PCR
    1. På dag 1, infisere fluer som beskrevet ovenfor. Gruppe injisert mannlige fluer (20 fluer/gruppe) og vokse på fersk fly mat for ønsket tid, vanligvis i 24 timer eller 3 dager. Gi fluer fersk mat daglig.
    2. Dag 3, samle 5 fluer under en lys flyt av CO2 i en 1,5 mL tube med 200 μL lyseringsbuffer og 20 keramiske perler (diameter = 0,5 mm), male prøvene av homogenizer med høy hastighet for 30 s. Legg 800 μL ekstra lyseringsbuffer til hver tube og lagre s amples ved-80 ° C eller umiddelbart gjennomføre RNA utvinning og qRT PCR.
    3. Forberede RNase gratis tips, rør og vaskebuffer, diethylpyrocarbonate (DEPC) behandles og 0.22 µm membran-filtrert vann. Tilsett 200 μL av kloroform (≥99.5%) i prøven og kraftig riste for 15 s hånd. Inkuber i 5 minutter eller lenger ved romtemperatur før den vann fasen og organisk fasen er tydelig atskilt.
      Merk: Kloroform er ekstremt farlig, og må håndteres med forsiktighet. Gjør ikke vortex utvalget, vil øke risikoen for DNA forurensning.
    4. Sentrifuger eksempler på 13000 x g i 15 min på 4 ° C.
    5. Samle 400 μL nedbryting og overføre nedbryting til nye rør. Bland med samme volum isopropanol (≥ 99,5%), forsiktig Inverter prøvene for 20 ganger for hånd og deretter bunnfall i 10 min eller lenger ved romtemperatur.
      Merk: Nedbør på 20 ° C vil øke RNA avkastning.
    6. Sentrifuger eksempler på 13000 x g i 10 min på 4 ° C. Hvit RNA pellets er synlig nederst på røret.
    7. Forkaste nedbryting og legge 1 mL av 70% etanol (etanol i DEPC vann) og invertere noen ganger å vaske RNA.
    8. Sentrifuger eksempler på 13000 x g i 5 min på 4 ° C. Forkaste supernatant og tørr RNA i 5-10 min; RNA bør bli gjennomsiktig.
    9. Legge til 50 μL av DEPC vann til eksempel, pipette for par ganger og vortex.
    10. Ta 3 μL RNA for titrating RNA konsentrasjonen. Kvantifisere RNA på 260 nm. Normalt er RNA konsentrasjonen hentet av denne protokollen ca 100-500 μg/μL, som er egnet for cDNA syntese.
    11. Bruk 2 μg av for cDNA syntese. Fortynne prøve å 100 μL med ddH2O og butikk på 20 ° C.
    12. Utfører qRT PCR i henhold til produsentens instruksjoner og kjører qRT PCR.
      Merk: For cDNA syntese av DCV jobbet tilfeldig primere mye bedre enn Poly A primer i våre hender. DCV mRNA uttrykk er normalisert endogene ribosomal protein 49 (rp49) mRNA. Oligonucleotide primere brukt i denne delen: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (fremover) og 5' CACCAGGAACTTCTTGAATCCGG 3' (bakover); DCV, 5' TCATCGGTATGCACATTGCT 3' (fremover) og 5' CGCATAACCATGCTCTTCTG 3' (bakover); Vago, 5' TGCAACTCTGGGAGGATAGC 3' (fremover) og 5' AATTGCCCTGCGTCAGTTT 3' (bakover); virus-indusert RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3 (fremover) og 5' GATTACAGCTGGGTGCACAA 3' (bakover).

Representative Results

Resultatene av denne delen er innhentet etter DCV infeksjon av D. melanogaster. Figur 1 viser flytdiagram for viral infeksjon i Drosophila. Fluene er injisert intra-thoracically, og deretter prøver er samlet for måling av viral TCID50 og genom RNA nivå (figur 1). Virusinfeksjon kan indusere celle lyse og CPE er observert på 3 dager innlegget infeksjon (figur 2A). Viruset belastning målt ved CPE analysen er linje målt ved qPCR (figur 2B). Som vist i Figur 3, hemmer Wolbachia DCV infeksjon i Drosophila. WOL-16s rRNA og wsp primere brukes til å finne Wolbachia tilstedeværelse (figur 3A) og Wolbachia-gratis fluer viser betydelig redusert overlevelse etter DCV infeksjon (figur 3B). Figur 4 viser hvordan du kontrollerer pst polymorfisme av gradient PCR bestemt primere. Figur 5 viser dose avhengige effekter av DCV infeksjon i wildtype fly. Overlevelse i figur 5A og viruset Last på 3 dager innlegget infeksjon er vist i figur 5B. Figur 6 viser at DCV infeksjon kan aktivere Dcr2/RNAi og JAK/STAT antiviral signalnettverk trasé i vert52. Hvilket uttrykk reporter genet vago uttrykk for Dcr2/RNAi sti er opphøyet 3 dager innlegget infeksjon (figur 6A). JAK-STAT veien aktiveres også ved DCV infeksjon, som angis av hvilket uttrykk reporter genet vir-1 (figur 6B). Figur 7 viser at Dcr2/RNAi veien er kritisk for antiviral infeksjon i Drosophila52. DCR-2 mutant fluene har en redusert overlevelse (figur 7A) og en økt viruset belastning (figur 7B) etter DCV infeksjon.

Figure 1
Figur 1: flytdiagram for Drosophila infeksjon og virus analyse.
Etablere Drosophila infeksjon av nano-injeksjon. Skjemaet diagrammet viser at fluer er infisert intra-thoracically og at viruset belastning måles av CPE analysen og qRT PCR. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: DCV analyse.
Viruset belastning målt ved CPE analysen er linje målt ved qPCR. (A) S2 * celler er kultivert ved 25 ° C for 3 dager med et annet virus fortynning (50 μL). 1 enhet TCID50 brukte virus er 4.29 x 109 (tilsvarer 3 x 109 PFU/mL). Første panel, 10-3 fortynning; andre panelet, 10-7 fortynning; tredje panel, 10-10 fortynning; Videre panel, uten smitte. Celler i panelet én og to Vis typisk CPE positiv fenotypen (hvite piler indikerer celle rusk), og celler i tre og fire-panelet viser typisk negative fenotypen. Baren skalaen angis i tallene. (B) måling av DCV laste ved qPCR. Utfør føljetong 10 ganger fortynninger av DCV og infisere S2 * celle linjen. Den totale RNA av infiserte celler er trukket ut og qPCR utføres for å måle DCV RNA nivået. Gradient smittsomme Virusmengden (bestemmes av CPE analysen) i cellene er matchet og positivt knyttet til målingen av qPCR (r-2= 0.999). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Viral infeksjon av fluer med eller uten Wolbachia.
Wolbachia infeksjon bidrar til DCV motstand i Drosophila. (A) Wolbachia tilstedeværelse oppdages av wol-16s rRNA og wsp primere. G1, G2 og G3 representert jernmalmrfluer (Oregon-R) (Bloomington 5) behandlet av tetracycline for en, to og tre generasjoner henholdsvis. PCR produktet er rundt 200 bp (wol-16s rRNA) og 600 bp (wsp). (B) Wolbachia gratis fluene er mer følsomme for DCV infeksjon. 3-5 dagers gammel mannlig voksen fluer er injisert med 100 PFU av DCV. Wolbachia gratis flyr (heltrukket linje) viser betydelig redusert overlevelse enn Wolbachia beskyttet flyr (dash linjer) på DCV infeksjon. To forskjellige wildtype linjer, malmr og w1118, brukes for overlevelse analysen og Vis lignende resultat. Alle feilfelt representerer standardfeil (se) av minst tre uavhengige tester; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke signifikant. Kaplan-Meier (B). Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: Pastrel genotyperingteknologi av gradient PCR.
PST polymorfisme kontrolleres av gradient PCR. Gradient PCR utføres for å skille pst R (512 C) og S (512T) allelet i Drosophila voksen. TM graderinger er a: 54 ° C, b: 54.7 ° C, c: 55,5 ° C, d: 58 ° C, e: 59,7 ° C, f: 62.2 ° C, g: 63.7 ° C, h: 64 ° C.  Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: Overlevelse og DCV titer jernmalmr fluer infisert med en annen dose av DCV.
Jernmalmrfluer er injisert med tre forskjellige doser av DCV, 10 PFU/fly, 50 PFU/fly og 100 PFU/fly. (A) fluene overlevelse er betydelig lavere når infisert med høyere smittsomme doser. (B) DCV RNA nivået i hele kroppen av angitte fluer er målt ved qRT PCR på det angitte tidspunktet og normalisert for 10 PFU/fly vaksinasjon gruppen. Alle feilfelt representerer standardfeil (se) av minst tre uavhengige tester; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke signifikant. Kaplan-Meier (A) eller veis variansanalyse (B). Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: Dcr2/RNAi og JAK/STAT antiviral signalveien aktivert etter DCV infeksjon.
Jernmalmrfluer var infisert med 100 PFU av DCV. Vago (A) og vir-1 (B) mRNA uttrykt i hele kroppen er målt ved qRT PCR på angitt tid poeng innlegget infeksjon. Endring av uttrykk er normalisert for basale nivå før infeksjon. Alle feilfelt representerer standardfeil (se) av minst tre uavhengige tester; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke signifikant. Enveis ANOVA (A, B). Klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7: Dcr-2 mutant fly følsom for DCV infeksjon.
DCR-2 mutant fluer og sin genetiske kontroll w1118 fluer var infisert med 100 PFU av DCV. (A) overlevelse av Dcr-2 mangelfull fluer og vill-type (w1118) flyr legge DCV infeksjon. (B) DCV RNA nivået i hele kroppen av angitte fluer er målt ved qRT PCR 2 dager innlegget infeksjon og normalisert for w1118. Alle feilfelt representerer standardfeil (se) av minst tre uavhengige tester; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke signifikant. Kaplan-Meier (A) eller student T-test (B). Klikk her for å se en større versjon av dette tallet.

Discussion

I denne artikkelen presenterer vi en detaljert prosedyre på hvordan å etablere en viral smittsomme system i voksen Drosophila melanogaster med nano-injeksjon. Protokollene inkluderer utarbeidelse av aktuelle fly linjer og virus lager, infeksjon teknikker, evaluering av smittsomme indikatorer og måling av antivirale svaret. Selv om DCV er brukt som et eksempel på en viral patogen, er titalls ulike typer virus vellykket brukt for studier i Drosophila systemet. I tillegg har hundrevis av regulatoriske forhold, enten av virus eller på verten, identifisert gjennom store screening i fluer. Dermed denne metoden er svært tilpasningsdyktige og begrenser ikke å DCV /Drosophila interaksjon.

For å kunne overføre og høste høy titer DCV, må noen forholdsregler tas. Cellene skal være sunt, kultivert på en egnet tetthet og høstes på tid. Redusere celle kultur volumet betydelig påvirker ikke virus titer. Vanligvis 107 celler av DCV på MOI = 0,01 vil til slutt gi omtrent 108-109 TCID50 av DCV, som kan møte kravene til de fleste i vivo og i vitro eksperimenter. CPE analysen og qRT PCR analysen er beskrevet i denne protokollen for måling av viruset belastning. CPE analysen er liksom vanskelig. Riktig tettheten av cellen vaksinering og en erfaren standard av positive/negative CPE tillater en rask og vellykket CPE analysen. Dermed gir vi en enkel qRT PCR analyse her for å bestemme fortynning avskjæringspunkt i CPE analysen tidligere klarer CPE analysen.

DCV er imidlertid en svært potent virus for voksen fly og Drosophila cellen linje. Bare 100 PFU/fly vaksinering kan drepe 50% av vill fluer innen 5 dager. En overflødig infeksjon dose kan skygge betydningen mellom wild type fly og potensielle utsatt linjene. Det er viktig å bruke minst to infeksjon doser under initiering av en ny skjerm. Siden massive død Drosophila kan skje i et svært kort tidsvindu på grunn av høy lethality av DCV, anbefales det sterkt at du registrerer hvor død oftere foreløpige eksperimenter. Etter DCV infeksjon har noen flyr noen ganger ascites syndrom. Spesielt bør fluene som dø innen 0,5 h innlegget infeksjon ekskluderes, som kan være forårsaket av upassende nål injeksjon skade.

Smittsomme styrken på DCV er også påvirket av mange vert faktorer, som bør vurderes før et eksperiment. Wolbachia er en vertikal overføre endosymbiont som har stor innvirkning på virusinfeksjon i fluer32. Tetracycline behandling i fly mat er en vanlig brukte metoden å eliminere Wolbachia infeksjon. Men endrer denne metoden også tarmen bakterieflora komposisjon, som igjen kan påvirke antiviral svar53. Noen studier har understreket viktigheten av genetisk variasjon på virus infeksjon36, som ubc-e2h, cg8492 og pst. For eksempel har de fleste vill type fly linjer har pst S allelet og er følsomme for picorna som virus, mens de fleste mutant linjer vi testet Bloomington lager Center har pst R allelet, dermed motstandsdyktig fenotyper. Det er svært viktig å utelukke virkningen av pst, spesielt når screening ut en motstand genet sammenligne med wild type kontroll29.

Resten nano-injeksjon å indusere systemisk virusinfeksjon, er andre metoder anvendelig å studere virusinfeksjon i fluer. Drosophila cellelinjer har vist seg å være en høy gjennomstrømming sile ut virusinfeksjon relatert vert cellulære komponenten37,38. Men blir en i vitro system alltid fulgt av et høyt antall falske positiver, når bekrefter i vivo. DCV kan også brukes for å infisere Drosophila muntlig, mens det kan bare utløse en begrenset og mildere infeksjon. Bare 20% av Larvene var smittet i 12 h og 14% dødelighet ble observert, med bare 25% flyr dødelighet i 20 dager i voksen22. Pricking fluer med 0,15-mm-diameter pins er en annen måte å sette virusinfeksjon, men det kan ikke sikre nøyaktige infeksjon dose og kvantitative repeterbarhet. Overexpressing virale proteiner av genetisk manipulasjon i fluer er en god måte å studere molekylære interactomes i vivo7. Imidlertid kan det portrettere virkeligheten i fysiologi og patologi på verten på infeksjon. I mellomtiden har nano-injeksjon metoden også ulemper, som det er ikke naturlig ruten infeksjon og kan direkte stimulerer en sterk systemet immunrespons like etter infeksjon, som forbant cuticle, den første antiviral forsvarslinje. I sum er spesifikke forskning formål og tilgjengelig eksperimentelle tilstand de avgjørende faktorene i valg blant ulike metoder.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi vil gjerne takke hele Pan lab i IPS. CAS. Vi takker Dr. Lanfeng Wang (IPS, CAS) for eksperimentell hjelp og Dr. Gonalo Cordova Steger (Springer natur), Dr. Jessica VARGAS (IPS, Paris) og Dr. Seng Zhu (IPS, Paris) for kommentarer. Dette arbeidet ble støttet av tilskudd fra strategiske prioritet forskningsprogrammet av det kinesiske vitenskapsakademi L.P (XDA13010500) og H.T (XDB29030300), National Natural Science Foundation i Kina L.P (31870887 og 31570897) og J.Y (31670909). L.P er medlem av CAS Youth innovasjon Promotion Association (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics