Gründung der Virusinfektion und Analyse von Host-Virus-Wechselwirkung in Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Dieses Protokoll beschreibt die Virusinfektion in Vivo in Drosophila Melanogaster mit dem Nano-Injektionsverfahren und Grundtechniken zu Virus-Wirt Interaktionen analysieren zu etablieren.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Virus verbreitet ist eine der Hauptursachen von epidemischen Krankheiten. So ist es sehr wichtig, unser Wissen der Prävention und Behandlung von viralen Infektionen verlängern, Verständnis der Interaktion zwischen dem Virus und dem Host. Die Fruchtfliege Drosophila MelanOgaster erweist sich eine effiziente und produktive Modellorganismen für antivirale Faktoren und Virus-Wirt Interaktionen aufgrund genetischer Werkzeuge und hoch konservierte angeborene Immune untersuchen Signalwege. Die hier beschriebene Vorgehensweise zeigt eine Nano-Injektion-Methode, um virale Infektion zu etablieren und systemische antivirale Reaktionen in Erwachsenen fliegen zu induzieren. Die präzise Steuerung der viralen Injektion Dosis in dieser Methode ermöglicht hohen experimentelle Reproduzierbarkeit. In dieser Studie beschriebenen Protokolle sind die Vorbereitung von fliegen und das Virus, das Injektionsverfahren, überleben Rate Analyse, die Virus-Last-Messung sowie eine antivirale Weg-Bewertung. Der Einfluss Auswirkungen einer Virusinfektion durch die fliegen Hintergrund wurden hier erwähnt. Diese Infektion-Methode ist einfach durchzuführen und quantitativ wiederholbar; Es kann für Host/virale Faktoren bei der Virus-Wirt Interaktionen auf den Bildschirm und das Übersprechen zwischen angeborenen Immunsystems Signalisierung und anderer biologischer Signalwege in Reaktion auf eine virale Infektion zu sezieren angewendet werden.

Introduction

Emerging virale Infektionen, vor allem von Arboviren, wie z. B. das Chikungunya-Virus1, das Dengue-Virus, Gelbfieber-Virus2 und ZikaVirus3, wurden eine große Bedrohung für die öffentliche Gesundheit durch Pandemien verursacht 4. dadurch ein besseres Verständnis der Virus-Wirt Interaktionen für Seuchenbekämpfung und Behandlung von viralen Erkrankungen beim Menschen immer wichtiger geworden. Für dieses Ziel müssen angemessene und effiziente Modelle hergestellt werden, um die Mechanismen, die Virus-Infektion zu untersuchen.

Die Fruchtfliege, Drosophilamelanogaster (D. Melanogaster), bietet ein leistungsfähiges System zur Untersuchung von Virus-Wirt Interaktionen5,6 und hat sich als eines der effizientesten Modelle menschlichen Viruserkrankungen7 zu studieren , 8 , 9. hoch konservierte antivirale Signalisierung Wege und unvergleichliche genetische Werkzeuge machen fliegt ein großes Modell, um signifikante Ergebnisse mit realen Auswirkungen auf antivirale Humanstudien zu produzieren. Darüber hinaus fliegen sind einfach und preiswert im Unterhalt im Labor und eignen sich für große Screening von Roman regulatorische Faktoren6,10 in das Virus und die Gastgeber während der Infektion.

Vier große hoch konservierte antivirale Wege (zB., die RNA-Interferenz (RNAi) Weg11, der JAK-STAT Signalweg12, die NF-κB-Signalweg und der Autophagie Weg13) sind gut bei Drosophila in den letzten Jahren untersucht Jahren6. Der RNAi-Weg ist eine breite antivirale Mechanismus, der meisten Arten von Virus-Infektion6,14unterdrücken kann. Störung der dieser Weg durch Mutation in den Genen wie Dicer-2 (Dcr-2) oder Argonaut 2 (AGO2) führen zu erhöhten Virus-Titer und Host Sterblichkeit15,16,17. Der JAK-STAT-Signalweg Verbindung Kontrolle der Infektion durch ein Virus aus der Familie Dicistroviridae und der Familie Flaviviridae bei Insekten, z.B.gebracht., Drosophila-C-Virus (DCV) fliegen16 und West Nil Virus (WNV) und Dengue-Virus in Mücke18,19. Die Drosophila Maut (homolog zu den menschlichen NF-κB-Signalweg) und Immunschwäche (IMD) Wege (ähnlich der menschlichen NF-κB und TNF Weg) sind beide in der Verteidigung Virus Invasion20,21, 22. Autophagie ist ein weiterer konservierten Mechanismus beteiligt an der Regulation des viralen Infektion, die sich gut in Drosophila23,24auszeichnet. So, Identifizierung von Roman regulatorische Faktoren dieser Wege und sezierenden Übersprechen zwischen diesen antivirale Signal- und anderen biologische Bahnen, wie Stoffwechsel, Altern, neuronale Reaktion und So weiter, können leicht in Drosophila einrichten System.

Obwohl die etabliertesten virale Infektionskrankheiten Modelle in Drosophila durch RNA-Viren, Infektionen durch die Wirbellosen Irisierende Virus 6I induziert werden (IV-6) und Kallithea Viren haben gezeigt, das Potential für die Untersuchung von DNA-Viren fliegen25, 26. Darüber hinaus kann das Virus auch geändert werden, um die Infektion von Drosophila, z. B. das Influenza-Virus9ermöglichen. Dies hat die Anwendung der Drosophila -Screening-Plattform erheblich erweitert. In diesem Verfahren verwenden wir DCV als Beispiel beschreiben, wie eine virale Infektionskrankheiten System in Drosophilazu entwickeln. DCV ist einen positiven Sinn einzelne gestrandeten RNA-Virus aus ca. 9300 Nukleotiden, Codierung 9 Proteine27. Als eine natürliche Erreger von D. MelanogasterDCV als geeignete Virus gilt als Host physiologische, Verhaltens- und basale Immunantwort bei Host-Virus Interaktion und Ko-Evolution28zu studieren. Darüber hinaus macht seine schnelle Sterblichkeit nach Infektion in Wildtyp fliegen DCV nützlich zum Bildschirm für resistent oder anfällig für Gene in der Host-29.

Allerdings gibt es mehrere Aspekte von Belang, wenn virale Infektionen in Drosophilastudieren. Beispielsweise haben symbiotische Bakterien Wolbachia die Fähigkeit, eine breite Spektren der RNA-Virus-Verbreitung in Drosophila und Mücke30,31,32hemmen. Den letzten Beweis zeigt einen möglichen Mechanismus welcher Wolbachia Blöcke Sindbis Virus (SINV) Infektion durch die Hochregulierung der Methyltransferase Mt2 Ausdruck in der Host-33. Darüber hinaus ist der genetische Hintergrund der Insekten auch für virale Infektion von entscheidender Bedeutung. Zum Beispiel die natürliche Polymorphismus im gen, Pastrel (pst), bestimmt die Infektanfälligkeit DCV in Drosophila34,35, während die Loci der Ubc-E2H und CG8492 Cricket-Paralyse-Virus (CrPV) und Flock Haus (FHV) Virusinfektion, bzw.36beteiligt sind.

Die besonderen Möglichkeiten, um die Virus-Wirt-Interaktion im fliegen, zu etablieren müssen laut Forschungszwecke wie eine Hochdurchsatz-Screen für Host Zellbestandteile in Drosophila Zelle Linien37,38, mündliche ausgewählt werden Infektion, Darm-spezifische antivirale Antwort22,39,40, Nadel stechen41,42 oder Nano-Injektion durch Übergabe epitheliale Barrieren um systemische Immunsystem stimulieren zu studieren Antworten. Nano-Injektion kann genau die virale Dosis um eine kontrollierte antiviralen Reaktion und eine physiologische Läsion43, induzieren steuern gewährleistet eine hohe Reproduzierbarkeit der experimentellen44. In dieser Studie beschreiben wir eine Nano-Injektion-Methode, um Virus-Wirt Interaktionen in Drosophila, unterstrichen die fliegen Hintergrundeffekte zu studieren.

Protocol

Hinweis: Vor dem Experiment starten, müssen die Zell-Linien und Fliege Aktien verwendet nicht durch andere Krankheitserreger, vor allem für Viren wie DCV, FHV, Drosophila X (DVX), und Nephritis Vogelgrippe-Virus (ANV) kontaminiert sein. Im Idealfall werden RNA Sequenzierung oder ein einfacher PCR-basierte Identifikation verwendet, um die Verschmutzung10,45zu erkennen. Wenn Kontamination stattgefunden, die Zell-Linien und Fliege Aktien sollte nicht verwendet werden nicht mehr bis sie sind völlig dekontaminiert46.

(1) Virus und Fliege Vorbereitung

  1. Virus-Vermehrung und Sammlung
    Hinweis: Drosophila S2 * Zellen sind für DCV Ausbreitung und die Titration verwendet. Die S2 * Zell-Linie wird von einer primären Kultur des späten Stadium D. Melanogaster Embryonen abgeleitet. Diese Zelllinie wurde47beschrieben.
    1. Wachsen Sie S2 * Zellen in Schneiders Drosophila Medium bei 25 ° C ohne zusätzliche CO2, als eine lose, semi-adhärente Monolayer in der Kulturschale 10 cm Zelle bei einer Dichte von 1 x 107 lebensfähige Zellen/mL. Nutzung komplette Medium für S2 * Zellen: Schneiders Drosophila Medium mit 10 % Hitze inaktiviert FBS, 100 Einheiten/mL Penicillin und 100 μg/mL Streptomycin.
      Hinweis: Sollten gesunde Zellen zeigen eine Runde Form und homogene Größe aufweisen.
    2. Tauen Sie schnell den DCV bestand von-80 ° C im Wasserbad 25 ° C auf. S2 * Zellen mit DCV am MOI infizieren = 0,01 sofort indem Sie direkt die Zelle Kultur Gerichte 1 mL der Virus-Lösung hinzufügen (Wachstumsbereich: 55 cm2) mit 10 mL der kompletten Medium für S2 * Zellen.
    3. 3 bis 5 Tage inkubieren Sie Zellen bei 25 ° C. Wenn das Virus zur Abholung bereit ist, die Zellmorphologie ist abnormal (Zellform sieht Unschärfe) und das Kulturmedium strotzt nur so von schwarzen Partikeln bezeichnend für Zellenrückstand.
    4. Sammeln Sie die ganze Zellkultur in einer 15 mL Tube durch Pipettieren rauf und runter und bei-80 ° C eingefroren (für bis zu einem Jahr).
      Hinweis: DCV kann für längere Zeit bei-80 ° C mit minimalem Verlust der Infektiosität, bis zu einem Jahr aufbewahrt werden.
    5. Auftauen der Zellkultur im Wasserbad 25 ° C mit konstanter schütteln und anschließend Zentrifugieren bei 6.000 x g, für 15 min bei 4 ° C. Den Überstand in einem sterilen 15 mL-Tube und Wirbel zu sammeln. Aliquoten bis zu 200 μL des Virus-Lösung pro Röhre.
      Hinweis: Virus Aliquote können für kurze Zeiträume von bis zu 3 Tage bei 4 ° C und bis zu 1 Jahr bei-80 ° c gelagert werden Wiederholte Frost-Tau-wechseln sollte vermieden werden. Es ist immer besser, den Aliquoten auf einmal zu verwenden.
    6. Wählen Sie 5 zufällige Virus-haltige Rohre, die durchschnittliche Virus Gewebekultur Infektionsdosis (TCID50) durch ein zytopathischer Effekt (CPE) Assay zu bestimmen (1 Einheit TCID50= 0,7 Plaque bilden Einheit [PFU]).
      Hinweis: CPE bezieht sich auf strukturelle Veränderungen in Wirtszellen durch virale Invasion verursacht. Die infizierende Virus verursacht lyse der Wirtszelle oder stirbt die Zelle ohne Lyse aufgrund einer Unfähigkeit,48zu reproduzieren.
      1. Am 1. Tag sammeln Sie bereite S2 * Zellen durch pipettieren. Zählen Sie die Anzahl von Zellen. Zellen für 300 X g für 4 min Zentrifugieren und den Überstand verwerfen. Verdünnen Sie die Zellen, die Dichte von 1 x 106 Zellen/mL mit kompletten Medium für S2 * Zellen wie in Schritt 1.1.1 beschrieben.
      2. 1 x 105 S2 Seed * Zellen (100 μl) pro Bohrloch auf der flach-Boden 96-Well-Platte (~ 30 % Konfluenz).
      3. Durchführen Sie 10-divisibel Verdünnungsreihen der DCV-Aktie mit kompletten Medium für S2 * Zellen. Fügen Sie 50 µL Verdünnungen in den Brunnen. Geben Sie 50 µL Kulturmedium ohne Virus in die der negativen Kontrolle gut eingestuft.
        Hinweis: Für jede Verdünnung wurden 8 Brunnen verwendet. Wie die typischen DCV-Rendite ca. 108-109 PFU/mL ist, sollte die Verdünnung mindestens ~ 10-5-10-10umfassen.
      4. Am 4. Tag CPE mit einem Hellfeld Mikroskop mit einem 20 X oder 40 X Objektiv zu beobachten. Einen Brunnen, in dem die Zellen verschwommen, zu klassifizieren und das Medium ist voll von Fragmenten eine "positive" und einen Brunnen, in dem die Zellmorphologie als "negative nun" normal ist.
      5. Mark CPE-positiv oder negativ-Brunnen mit + oder-, beziehungsweise. Berechnen Sie das Virus TCID50 von Reed und Münch Methode49.
    7. Entsorgen Sie alle kontaminierten Materialien und Handschuhe in der Dekontamination Pfanne. Wenn das Virus die gewünschte TCID50erreichen kann, konzentrieren Sie 100 mL-Lösung durch Zentrifugieren bei 68.000 x g für 1 h bei 4 ° C.
      Hinweis: je nach Ziel des Versuchs, eine Palette von Dosen von 102 bis 106 TCID50 Einheiten eignen sich für Virus-Infektion. In der Regel verwenden wir 3 x 106 TCID50 Einheiten.
    8. Den Überstand verwerfen und neu in 1 mL Tris-HCl-Puffer (10 mM, pH 7,2) auszusetzen. Aliquoten 20 μL des Virus-Lösung pro Rohr und Store bei-80 ° C. Wählen Sie 5 zufällige Rohre das durchschnittliche Virus TCID50 wieder zu bestimmen.
  2. Vorbereitung auf die Infektion zu fliegen
    Hinweis: Symbiotische Bakterium Wolbachia können viele Arten von RNA-Virus-Infektion in Insekten30,31,32,33,41unterdrücken. Also unbedingt Wolbachia von fliegen zu bereinigen, vor seinem Studium Host-Virus-Infektion in Vivo33.
    1. Bereiten Sie fliegen mit Tetracyclin durch Zugabe von 400 μl von 50 µg/mL Tetracyclin (in 70 % igem Ethanol zu) 4 g frische standard Maismehl fliegen Essen (1 L Lebensmittel enthält 77,7 g Maismehl, 32,19 g Hefe, 10,6 g Agar, 0,726 g CaCl2 31,62 g Saccharose, 63,3 g Glukose, 2 g Kaliumsorbat und 15 mL 5 % C8H8O3). Mischen Sie gründlich und legen Sie das Grillgut bei 4 ° C über Nacht zu Ethanol zu verdampfen.
      Hinweis: Eine hohe Dosis von Ethanol kann fliegen Fruchtbarkeit, also nicht diesen Schritt auslassen beeinträchtigen.
    2. Warmes Essen auf Raumtemperatur und neu geschlüpften fliegen (20 Frauen und 10 Männer) in das Fläschchen. Die fliegen bei 25 ° C, 60 % Luftfeuchtigkeit unter einem normalen hell/dunkel-Zyklus zu züchten.
      Hinweis: In der Regel dauert es ca. 3-4 Tage für die fliegen um genug Eier zu legen. Zu viele Eier behindern die Entwicklung der Larven und Tetracyclin Effizienz zu verringern.
    3. Sammeln neu geschlüpften fliegen (innerhalb von 3 ~ 5 Tage) unter eine leichte Strömung von CO2und wiederholen Sie Schritt ~ 1.2.1-1.2.2. In der Regel sind mindestens 3 Generationen für die Beseitigung vollständig von Wolbachiaerforderlich.
    4. Nach 3 Generationen mit Tetracyclin Behandlung sammeln Sie 5 fliegen unter eine leichte Strömung CO2 für die Wolbachia -Infektion-Test. Mahlen Sie fliegen für 1 min mit 250 μL bidestilliertem Wasser (DdH2O) und ein paar 0,5 mm steril Keramik Perlen in einem 1,5 mL Röhrchen mit einem Homogenisator. Fügen Sie eine weitere 250 μL von 2 X Puffer A (0,2 M Tris-HCl, pH 9,0; 0,2 M EDTA; 2 % SDS) auf die Probe und Wirbel.
      Hinweis: Da SDS die Wulst-Verkehr behindert wird, kann nicht 1 x Puffer A direkt zum fliegen zu mahlen. Wenn die fliegen rote Augen haben, entfernen Sie Köpfe vor dem Schleifen, da dies die Farbe der DNA Produkt beeinflussen kann.
    5. Einfrieren der Proben bei-80 ° C (halten bis zu einem Jahr). Schnell tauen die Probe von-80 ° C im Wasserbad 25 ° C bis aufgelöst. Inkubieren Sie die Proben bei 70 ° C für 30 min.
    6. Fügen Sie 190 μL von 5 M KOAc, Wirbel und inkubieren Sie auf Eis für 15 Minuten oder länger.
    7. Zentrifugieren Sie Proben bei 13.000 x g für 5 min bei Raumtemperatur, sammeln Sie den Überstand zu und übertragen Sie sie auf neue Röhren.
    8. Wiederholen Sie Schritt 1.2.7 DNA mit besserer Qualität zu erhalten.
    9. Jede Probe 750 μl Isopropanol hinzu und invertieren Sie ein paar Mal von Hand sanft zu. In 5 min bei Raumtemperatur inkubieren.
    10. Zentrifugieren Sie Proben bei 13.000 x g für 5 min bei Raumtemperatur und verwerfen Sie den überstand. Das weiße genomische DNA-Pellet wird am unteren Ende der Röhre bleiben.
    11. Die Pellets, Zentrifuge bei 13.000 x g für 5 min, 1 mL 70 % igem Ethanol hinzu und verwerfen Sie den überstand. Trocknen Sie die DNA, bis es durchsichtig wird.
    12. Lösen Sie DNA in 100 μL der DdH2O auf, Titrieren Sie DNA-Konzentration durch UV-Vis Absorption Spektralphotometrie und verdünnen Sie die DNA zu 100 ng/μl.
    13. Einsatz 200 ng DNA für die PCR-Reaktion (in einem 20 μl-System, siehe die Tabelle der Materialien). PCR durch das folgende Programm durchführen: 95 ° C für 15 min; 36-Zyklus von 95 ° C für 45 s, 50 ° C für 45 s und 72 ° C für 1 min; und eine letzte Verlängerung Schritt (72 ° C für 1 min) in einem Thermocycler.
      Hinweis: Basierend auf der Wolbachia 16 s rRNA, verwenden die folgenden Primer: 5' TGAGGAAGATAATGACGG 3' (vorwärts) und 5' CCTCTATCCTCTTTCAACC 3' (rückwärts). Für Wsp, die Primer wurden 5' CATTGGTGTTGGTGTTGGTG 3' (vorwärts) und 5' ACCGAAATAACGAGCTCCAG 3' (rückwärts).
    14. PCR-Produkte mit 1 % Agarose-Gelelektrophorese zu analysieren. Die PCR-Produkt-Größe von Wolbachia 16 s rRNA und Wsp ist rund 200 bp und 600 bp, beziehungsweise.
    15. Hintere Wolbachia frei fliegen bestand auf standard Maismehl fliegen Essen. Sammle 3 bis 5 Tagen neu geschlüpften Männchen fliegt für eine Infektion.
      Hinweis: Tetracyclin-Behandlung kann auch intestinale Mikrobiota Zusammensetzung beeinflussen die antivirale Reaktionen in den Host anschließend beeinflusst. Es wird empfohlen, alle fliegen sollten die gleichen Tetracyclin-Behandlungen erhalten. Halten Sie frei von Wolbachia fliegen wächst unter normalen Bedingungen mindestens 3 Generationen, Darm Microbiota wiederherzustellen.
  3. Pastrel Genotypisierung
    Hinweis: Das Vorhandensein von S oder R Allel des Gens pst in der genetische Hintergrund wurde gemeldet, DCV Infektion in Drosophila34,35beeinflussen. Es ist notwendig, die pst -Genotyp, speziell für DCV Infektion zu überprüfen. Es gibt wenige SNPs in PST-Datei , die Virus-Infektion beeinflussen können, die großen SNP ist 512 C/T. Der Temperaturgradient PCR ist eine schnelle Methode, pst Genotyp zu identifizieren.
    1. Extrakt fliegen genomischen DNA, wie oben (Schritt 1.2.4 - 1.2.15) beschrieben.
    2. Einsatz 100 ng DNA als Vorlage, die 512C-Grundierung, 5' CAGCATGGTGTCCATGAAGTC 3' (vorwärts) und 5' ACGTGATCAATGCTGAAAGT 3' (rückwärts) zu erkennen, das Allel R, 512T Grundierung, 5' CAGCATGGTGTCCATGAAGTT 3' (vorwärts) und 5' ACGTGATCAATGCTGAAAGT 3' (rückwärts), erkennen die S-Allel.
    3. Die Tm (Schmelztemperatur) Steigungen wie folgt festgelegt: 54 ° C, 54,7 ° C, 55,5 ° C, 58 ° C, 59,7 ° C, 62,2 ° C, 63,7 ° C und 64 ° C (45 s bei jeder Temperatur).
      Hinweis: 30 Zyklen der PCR-Ketten-Reaktion sind (20 μl System) empfohlen.
    4. Visualisieren Sie das 100-bp-PCR-Produkt von 2 % Agarose-Gelelektrophorese.

(2) Virusinfektion in Drosophila

  1. Fliegen durch Nano-Injektion zu infizieren und überleben Tests durchführen.
    1. Ziehen Sie die Kapillaren um Injektionsnadeln vorzubereiten, Rücken-Füllung die Injektion Nadel mit Öl und montieren Sie den Injektor wie oben beschrieben50.
    2. Betäuben Sie fliegen auf dem Pad unter eine leichte Strömung von CO2. Fliegen durch Intra thorakalen Injektion44 von 50,6 impfen nL von Virus-Lösung (100 PFU, verdünnt mit Tris-HCl-Puffer, pH 7,2). Mindestens 3 Fläschchen von fliegen (20 fliegen pro Fläschchen) zu injizieren.
      Hinweis: Die Injektion ist zeitaufwendig (in der Regel 100 fliegen pro Stunde) und DCV Replikation ist sehr schnell, so ist es sehr wichtig, die genaue Uhrzeit auf das Rohr einmal Abschluss jedes Fläschchen (20 fliegen) notieren. Puffer nur Injektion ist als mock-Steuerelement festgelegt. In der Regel sind die männlichen Erwachsene fliegen bevorzugt, wie Ergebnisse sind stabiler und reproduzierbarer als bei Weibchen da Hormonschwankungen während der Paarung und Fortpflanzung zum Auslesen der Weibchen51beeinflussen können.
    3. Wachsen Sie die injizierten fliegen bei 25 ° C, 60 % Luftfeuchtigkeit unter einem normalen hell/dunkel-Zyklus. Täglich versorgen Sie fliegen mit frischen Lebensmitteln zu, und notieren Sie die Anzahl der Toten chen.
    4. Mindestens 3 biologische Wiederholungen durchführen und die überleben Kurve Plotten.
    5. Generieren Sie für die statistische Auswertung der Überlebensdaten Kaplan-Meier-Survival-Kurven von Statistik-Software. Führen Sie die Log-Rank-Test um die P-Werte berechnen. Geben Sie auf dem Tisch Überleben für jedes Thema. Die Software dann berechnet Prozent überleben zu jeder Zeit und einem Kaplan-Meier-überleben-Grundstück Grundstücke.
      Hinweis: Fügen Sie keine zusätzliche Hefe in die Flasche. Im Vergleich zu mock Kontrollen, DCV-infizierten fliegen gelegentlich Aszites und sind ungeschickt, die machen sie anfällig für die klebrigen Hefe. Es ist besser zu erfassen mehr Zeitpunkte in der Vorversuch um herauszufinden, einen Zeitrahmen zu dem massiven Tod für infizierte fliegen passieren wird. In der Regel sterben die infizierten fliegen selten innerhalb der ersten zwei Tage, auch für die Dcr-2 mutierte Linien. Für die Wolbachia frei w1118 (Bloomington 5905) fliegen infiziert mit 100 PFU des DCV, ist dieses Zeitfenster rund 3-5 Tage post-Infektion. Fruchtfliegen, die innerhalb von 0,5 h Post Injektion Stunden sterben sollte nicht als ein Todesfall gezählt werden, weil sie von Nadel Verletzungen getötet werden können nicht durch eine virale Infektion.
  2. DCV laden Maßnahme von CPE-assay
    Hinweis: Viruslast ist ebenso auf der Titration der Virus Aktie (Schritt 1.1.6) gemessen, sondern erfordert zusätzliche Probenvorbereitung (Schritt 2.2.1-2.2.4).
    1. Am 1. Tag infizieren Sie männlichen fliegen wie im Schritt 2.1.1-2.1.2 beschrieben. Injizierte fliegen in Gruppen von 20-Gruppe und halten sie immer auf frische fliegen Lebensmittel für die gewünschte Zeit (in der Regel für 24 h oder 3 Tage). Bieten Sie fliegen täglich mit frischen Lebensmitteln.
    2. Am 2. Tag, seed Drosophila S2 * Zellen in einer Zelle Kulturschale 10 cm auf die Dichte von etwa 5 X106 bis 1 x 107 Zellen/mL wie in Schritt 1.1.1 beschrieben.
    3. Am 3. Tag sammeln 5 fliegen (unter eine leichte Strömung von CO2) und Mahlen sie in einem 1,5 mL Zentrifugenröhrchen für 30 s mit 200 μl Tris-Puffer und Keramik Perlen mit Homogenisator. Die Proben bei-80 ° C zu speichern oder sofort mit dem nächsten Schritt fortfahren.
    4. Gründlich Wirbel der Probe. Verwenden Sie eine 1 mL Spritze und 0,22 μm zu Filtern des Überstands auf eine neue 1,5 mL Tube. Fahren Sie mit der Titration beschriebenen Schritte 1.1.6.1-1.1.6.5.
  3. DCV-Last, die gemessen an qRT-PCR
    1. Am 1. Tag infizieren Sie fliegen wie oben beschrieben. Gruppe injizierten Männchen fliegt (20 fliegen/Gruppe) und wachsen auf frische fliegen Lebensmittel für die gewünschte Zeit, in der Regel für 24 h oder 3 Tage. Bieten Sie fliegen täglich mit frischen Lebensmitteln.
    2. Am 3. Tag sammeln 5 fliegen unter eine leichte Strömung von CO2 in der 1,5 mL Tube mit 200 μL der Lyse Puffer und 20 Keramik Perlen (Durchmesser = 0,5 mm), die Proben von Homogenisator mit hoher Geschwindigkeit für 30 S. hinzufügen 800 μl zusätzliche Lyse Puffer für jede Röhre zu mahlen und speichern die s wurde bei-80 ° C oder sofort durchführen RNA-Extraktion und qRT-PCR.
    3. Bereiten Sie RNase kostenlose Tipps, Röhren und deionisiertes, Diethylpyrocarbonate (DEPC) behandelt und 0,22 µm Membran gefiltertes Wasser. Fügen Sie 200 μl Chloroform (≥99.5 %) in der Probe und kräftig schütteln für 15 s von Hand. Inkubieren Sie für 5 Minuten oder länger bei Raumtemperatur, bis die Wasserphase und die organische Phase klar voneinander getrennt sind.
      Hinweis: Chloroform ist extrem gefährlich und muss mit Vorsicht behandelt werden. Tun Sie nicht Strudel der Probe, die erhöhen das Risiko einer Kontamination der DNA.
    4. Zentrifuge Proben bei 13.000 x g für 15 min bei 4 ° C.
    5. 400 μl des Überstandes sammeln und den Überstand auf neue Rohre übertragen. Mischen Sie mit dem gleichen Volumen Isopropanol (≥ 99.5 %), invertieren Sie sanft zu, die Proben für 20 Mal von hand und dann überstürzen Sie sich für 10 Minuten oder länger bei Zimmertemperatur.
      Hinweis: Niederschlag bei-20 ° C wird RNA Ertrag steigern.
    6. Zentrifuge Proben bei 13.000 x g für 10 min bei 4 ° C. White-RNA Pellets sind an der Unterseite des Rohres sichtbar.
    7. Verwerfen Sie den Überstand und fügen Sie 1 mL 70 % igem Ethanol (Äthanol in DEPC-Wasser) und invertieren Sie einige Male um die RNA zu waschen.
    8. Zentrifuge Proben bei 13.000 x g für 5 min bei 4 ° C. Die überstand und trockene RNA für 5-10 min zu verwerfen; RNA soll transparenter werden.
    9. Fügen Sie 50 μl DEPC-Wasser zum Beispiel, Pipette für paar Mal und Wirbel.
    10. Nehmen Sie 3 μl RNA für die RNA-Konzentration zu titrieren. Quantifizieren die RNA bei 260 nm. Normalerweise ist die RNA-Konzentration durch dieses Protokoll extrahiert ca. 100-500 μg/μL, geeignet für die cDNA-Synthese ist.
    11. Verwenden Sie 2 µg RNA für die cDNA-Synthese. Verdünnen der Probe zu 100 μL mit DdH2O und Store bei-20 ° C.
    12. Führen Sie qRT-PCR nach den Anweisungen des Herstellers aus und qRT-PCR.
      Hinweis: Für die cDNA Synthese des DCV gearbeitet zufällige Primer viel besser als Poly A Grundierung in unseren Händen. DCV mRNA Ausdruck ist auf endogene ribosomale Protein 49 (rp49) mRNA normalisiert. Oligonukleotid Primer verwendet in diesem Teil: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (vorwärts) und 5' CACCAGGAACTTCTTGAATCCGG 3' (rückwärts); DCV, 5' TCATCGGTATGCACATTGCT 3' (vorwärts) und 5' CGCATAACCATGCTCTTCTG 3' (rückwärts); Vago, 5' TGCAACTCTGGGAGGATAGC 3' (vorwärts) und 5' AATTGCCCTGCGTCAGTTT 3' (rückwärts); virusbedingte (vorwärts) RNA-1 (Vir-1) 5' GATCCCAATTTTCCCATCAA 3' und 5' GATTACAGCTGGGTGCACAA 3' (rückwärts).

Representative Results

Die Ergebnisse dieses Abschnitts sind nach der DCV Infektion von D. Melanogaster. Abbildung 1 zeigt das Flussdiagramm der viralen Infektion in Drosophila. Fliegen sind Intra thoracically injiziert, und dann sind die Proben für die Messung von viralen TCID50 und der Genom-RNA-Ebene (Abbildung 1). Virus-Infektion kann Zelle Lysis auslösen und CPE wird auf 3 Tage Post-Infektion (Abbildung 2A) beobachtet. Die Viruslast durch die CPE-Assay gemessen wird im Einklang mit qPCR (Abb. 2 b) gemessen. Wie in Abbildung 3dargestellt, hemmt Wolbachia DCV Infektion in Drosophila. Wol-16 s rRNA und Wsp Primer dienen zur Erkennung von Wolbachia Präsenz (Abbildung 3A) und Wolbachia-freie fliegen zeigen deutlich geringere Überlebensrate nach der DCV Infektion (Abb. 3 b). Abbildung 4 zeigt, wie pst -Polymorphismus von Gradienten-PCR überprüft mit spezifischen Primer. Abbildung 5 zeigt Dosis abhängige Effekte der DCV-Infektion in der Wildtyp fliegen. Die Überlebensrate in Abbildung 5A und das Virus laden 3 Tage Post-Infektion in Abbildung 5 bgezeigt wird. Abbildung 6 zeigt, dass DCV Infektion der Dcr2/RNAi und JAK/STAT antivirale Signalwege in der Host-52aktivieren kann. Die Expression der Reporter Vago Genexpression des Dcr2/RNAi-Signalwegs ist erhöhte 3 Tage Post-Infektion (Abb. 6A). Der JAK-STAT-Signalweg ist auch auf DCV-Infektion, die durch die Expression des Reporter-gen Vir-1 (Abb. 6 b) angegeben ist aktiviert. Abbildung 7 zeigt, dass die Dcr2/RNAi-Weg für antivirale Infektion in Drosophila52entscheidend. DCR-2 mutierte fliegen haben eine geringere Überlebensrate (Abb. 7A) und eine erhöhte Viruslast (Abb. 7 b) nach der DCV Infektion.

Figure 1
Abbildung 1: Flussdiagramm der Drosophila -Infektion und Virenanalyse Last.
Gründung von Drosophila -Infektion durch Nano-Injektion. Das Schema-Diagramm zeigt, dass fliegen Intra thoracically infiziert sind, und die Viruslast durch die CPE-Assay und qRT-PCR gemessen werden. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: DCV Lastanalyse.
Die Viruslast durch die CPE-Assay gemessen wird im Einklang mit qPCR gemessen. (A) S2 * Zellen bei 25 ° C für 3 Tage mit einem anderen Virus-Verdünnung (50 μL) kultiviert werden. 1 Einheit TCID50 gebrauchte Virus ist 4.29 x 109 (entspricht 3 x 109 PFU/mL). Erste Panel, 10-3 Verdünnung; zweiten Panel 10-7 Verdünnung; dritten Panel, 10-10 Verdünnung; her-panel, w/o-Infektion. Zellen in Panel 1 und 2 zeigen die typische CPE positive Phänotyp (weiße Pfeile zeigen Zellenrückstand), und Zellen in Gruppe 3 und 4 zeigen die typischen negativen Phänotyp. Die Maßstabsleiste wird in Zahlen angegeben. (B) Messung der DCV laden qPCR. Führen Sie 10-divisibel Verdünnungsreihen des DCV und infizieren Sie die S2 * Zell-Linie. Die gesamte-RNS infizierter Zellen extrahiert und qPCR wird durchgeführt, um die DCV-RNA-Ebene zu messen. Gradient infektiöse Viruslast (bestimmt durch CPE-Assay) in den Zellen zugeordnet und positiv im Zusammenhang mit der Messung von qPCR (R2= 0,999). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Virale Infektion von Fliegen mit oder ohne Wolbachia.
Wolbachia -Infektion trägt zur DCV Widerstand in Drosophila. (A) die Wolbachia Präsenz von Wol-16 s rRNA und Wsp Primern erkannt wird. G1, G2 und G3 vertreten ErzRfliegen (Oregon-R) (Bloomington 5) behandelt von Tetracyclin für ein, zwei oder drei Generationen bzw.. Die PCR-Produkt-Größe beträgt rund 200 bp (Wol-16 s rRNA) und 600 bp (Wsp). (B) Wolbachia freie fliegen sind empfindlicher auf DCV-Infektion. 3 bis 5 Tagen werden mit 100 PFU des DCV alten männlichen Erwachsene fliegen injiziert. Wolbachia frei fliegt (durchgezogene Linien) zeigen deutlich reduziert überleben als Wolbachia geschützt (Strich-Linien) auf DCV-Infektion fliegt. Zwei verschiedene Wildtyp-Linien, ErzR und w1118, dienen zum Überleben Test und ähnliches Ergebnis zeigen. Alle Fehlerbalken darzustellen Standardfehler (s.e.) von mindestens drei unabhängigen Tests; * P < 0,05, ** P < 0,01, *** P < 0,001 *** P < 0,0001, ns, nicht signifikant. Kaplan-Meier (B). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Pastrel Genotypisierung von Gradienten-PCR.
PST -Polymorphismus ist durch Gradienten-PCR überprüft. Gradienten-PCR wird durchgeführt, um die PST-Datei (512 C) R und S (512T)-Allel in Drosophila Erwachsenen unterscheiden. TM-Farbverläufe sind a: 54 ° C, b: 54,7 ° C, c: 55,5 ° C, d: 58 ° C, 59,7 ° C e:, f: 62,2 ° C, g: 63,7 ° C, h: 64 ° C.  Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Überlebensrate und DCV Titer von ErzR fliegen mit eine andere Dosis des DCV infiziert.
Erz-Rfliegen werden mit drei verschiedenen Dosen des DCV, 10 PFU/Fly, 50 PFU/fliegen und 100 PFU/fliegen injiziert. (A) die fliegen Überlebensrate ist deutlich geringer, wenn mit infektiösen Dosen infiziert. (B) der DCV RNA-Ebene im gesamten Körper der angegebenen fliegen ist durch qRT-PCR zur angegebenen Zeit gemessen und auf 10 PFU/Fliege Inokulation Gruppe normalisiert. Alle Fehlerbalken darzustellen Standardfehler (s.e.) von mindestens drei unabhängigen Tests; * P < 0,05, ** P < 0,01, *** P < 0,001 *** P < 0,0001, ns, nicht signifikant. Kaplan-Meier (A) oder einfache Anova (B). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6: Dcr2/RNAi und JAK/STAT antivirale Signalweg aktiviert nach DCV Infektion.
Erz-Rfliegen waren mit 100 PFU des DCV infiziert. Vago (A) und Vir-1 (B) mRNA in den ganzen Körper ausgedrückt werden durch qRT-PCR zur angegebenen Zeit Punkte Post Infektion gemessen. Die Änderung des Ausdrucks ist auf der basalen Ebene vor der Infektion normalisiert. Alle Fehlerbalken darzustellen Standardfehler (s.e.) von mindestens drei unabhängigen Tests; * P < 0,05, ** P < 0,01, *** P < 0,001 *** P < 0,0001, ns, nicht signifikant. Einfache ANOVA (A, B). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 7
Abbildung 7: Dcr-2 mutierte Fliege DCV Infektion anfällig.
DCR-2 Mutanten fliegt und seine genetische Kontrolle w1118 fliegen mit 100 PFU des DCV infiziert waren. (A) Überlebensraten von Dcr 2 mangelhaft fliegen und Wildtyp (w1118) fliegt post DCV Infektion. (B) DCV RNA-Ebene in den ganzen Körper der angegebenen fliegen durch qRT-PCR 2 Tage Post Infektion gemessen und auf der w1118normalisiert. Alle Fehlerbalken darzustellen Standardfehler (s.e.) von mindestens drei unabhängigen Tests; * P < 0,05, ** P < 0,01, *** P < 0,001 *** P < 0,0001, ns, nicht signifikant. Kaplan-Meier (A) oder der Student T-Test (B). Bitte klicken Sie hier für eine größere Version dieser Figur.

Discussion

In diesem Artikel präsentieren wir eine detaillierte Anleitung, wie eine virale Infektionskrankheiten System in Erwachsenen Drosophila Melanogaster mit Nano-Injektion. Die Protokolle sind die Vorbereitung der entsprechenden Fliegenschnüre und Virus bestand, Infektion Techniken, die Bewertung der infektiöse Indikatoren und die Messung der antiviralen Reaktion. Obwohl DCV als Beispiel für eine virale Erreger verwendet wird, wurden Dutzende von verschiedenen Arten von Viren erfolgreich für das Studium in Drosophila-System angewendet. Darüber hinaus wurden Hunderte von regulatorischen Faktoren, entweder des Virus oder des Wirtes, durch großangelegte Screening in fliegen identifiziert. Also, diese Methode ist sehr anpassungsfähig und beschränkt sich nicht auf DCV /Drosophila Interaktion.

Um erfolgreich zu verbreiten und hohe Titer DCV zu ernten, müssen einige Vorkehrungen getroffen werden. Zellen sollten gesund zu sein, bei einer geeigneten Dichte kultiviert und geerntet auf Zeit. Verringerung der Kultur Zellvolumen wirkt nicht deutlich Virustiter. In der Regel 107 Zellen von DCV am MOI infiziert = 0.01 wird endlich Ertrag ca. 108-109 TCID50 des DCV, die den Anforderungen der meisten in Vivo und in Vitro Experimente kann. Die CPE-Assay und qRT-PCR-Assays sind in diesem Protokoll zur Messung der Viruslast beschrieben. Die CPE-Assay ist irgendwie schwierig. Die entsprechende Dichte der Zelle Impfung und einen erfahrenen Standard der positiven/negativen CPE Diskriminierung ermöglichen eine schnelle und erfolgreiche CPE-Assay. Daher bieten wir hier einen einfache qRT-PCR-Assay um helfen zu entscheiden, die Guillotine Verdünnung in CPE-Assay vor Beherrschung der CPE-Assay.

DCV ist jedoch ein sehr potentes Virus für die Erwachsene Fliege und Drosophila -Zell-Linie. Nur 100 PFU/fliegen-Impfung kann innerhalb von 5 Tagen 50 % von wilden Fliegen töten. Eine überschüssige Infektion Dosis kann die Bedeutung zwischen den Wildtyp fliegen und potenziellen anfällig Zeilen Schatten. Es ist wichtig, mindestens zwei Infektion Dosen anzuwenden, wenn einen neuen Bildschirm zu initiieren. Seit der massiven Tod von Drosophila in einem sehr kurzzeitigem Fenster wegen der hohen Letalität von DCV passieren kann, ist die Erfassung der Tod Anzahl häufiger in Vorversuchen dringend empfohlen. Nach Infektion der DCV haben einige fliegen gelegentlich Aszites-Syndrom. Insbesondere sollte fliegen, die innerhalb von 0,5 h Post Infektion sterben ausgeschlossen werden, die möglicherweise durch unangemessene Nadel Injektion Schädigung verursacht.

Die infektiöse Stärke des DCV ist auch durch viele Host Faktoren beeinflusst, die berücksichtigt werden sollten, bevor Sie ein Experiment starten. Wolbachia ist eine vertikale Übertragung Endosymbiont, die großen Einfluss auf Virus-Infektion fliegen32hat. Tetracyclin-Behandlung in der Fliege Nahrung ist eine häufig verwendete Methode, um die Wolbachia -Infektion zu beseitigen. Diese Methode ändert jedoch auch intestinale Mikrobiota Zusammensetzung, die wiederum antiviralen Reaktion53beeinträchtigen können. Einige Studien haben die Bedeutung der genetischen Varianz auf Virus Infektion36, wie Ubc-e2h, cg8492 und pstbetont. Zum Beispiel haben die meisten Wildtyp fliegen Linien haben pst S-Allel und sind empfindlich gegen Picorna-ähnliche Viren, während die meisten mutierte Linien, die wir vom Lager entfernt Bloomington getestet pst R Allel, so haben beständig Phänotypen. Es ist sehr wichtig, um die Auswirkungen der PST-Datei, auszuschließen, vor allem beim heraus ein Resistenzgen Vergleich mit Wildtyp Kontrolle29screening.

Neben Nano-Injektion, systemische Virusinfektion zu induzieren gibt es andere Methoden, Virus-Infektion bei fliegen zu studieren. Drosophila -Zell-Linien haben sich bewährt im Zusammenhang mit einer Hochdurchsatz-Methode, um Bildschirm aus Virus-Infektion Host zellulären Komponenten37,38. Jedoch ist eine in Vitro -System immer mit einer hohen Rate falsch positiver Ergebnisse, begleitet, bei der in VivoBestätigung. DCV kann auch angewendet werden, um Drosophila mündlich, infizieren, während es nur eine eingeschränkte und mildere Infektion auslösen können. Nur 20 % der Larven, innerhalb von 12 h infiziert wurden und 14 % Mortalität beobachtet wurde, fliegt mit nur 25 % Mortalität innerhalb von 20 Tagen bei Erwachsenen22. Fliegen mit 0,15 mm Durchmesser Nadeln stechen ist eine weitere Möglichkeit, virale Infektion eingestellt aber es kann nicht die genaue Infektion Dosis und quantitative Wiederholbarkeit zu gewährleisten. Überexprimierenden virale Proteine durch genetische Manipulation im fliegen ist ein guter Weg, um molekulare Interactomes in Vivo7zu studieren. Jedoch kann es nicht die Realität der Physiologie und Pathologie in der Hostie auf Infektion darzustellen. Unterdessen hat der Nano-Injektionsverfahren auch Nachteile, wie es nicht der natürliche Weg der Infektion ist und kann direkt zu stimulieren eine starkes System Immunantwort nach Infektion, die die Kutikula, die erste antivirale Verteidigungslinie umgangen. In der Summe sind die spezifischen Zweck und verfügbaren Versuchsbedingung die entscheidenden Faktoren bei der Wahl unter verschiedenen Methoden.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Wir möchten die gesamte Pan-Labor in IPS zu danken. CAS. Wir danken Dr. Lanfeng Wang (IPS, CAS) für Dr. Seng Zhu (IPS, Paris), Dr. Jessica VARGAS (IPS, Paris) und Dr. Gonalo Cordova Steger (Springer Natur) und experimentelle Unterstützung für Kommentare. Diese Arbeit wurde unterstützt durch Zuschüsse aus dem strategischen Priorität Forschungsprogramm der chinesischen Akademie der Wissenschaften, L.P. (XDA13010500) und H.T (XDB29030300), der National Natural Science Foundation of China L.P. (31870887 und 31570897) und J.Y (31670909). L.P. ist Mitglied des CAS Youth Innovation Promotion Association (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics