Istituzione dell'infezione virale e analisi dell'interazione ospite-Virus in Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Questo protocollo viene descritto come stabilire l'infezione virale in vivo in Drosophila melanogaster utilizzando il metodo di nano-iniezione e tecniche di base per analizzare l'interazione virus-ospite.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Diffusione del virus è delle principali cause delle malattie epidemiche. Così, capire l'interazione tra il virus e l'host è molto importante per estendere la nostra conoscenza della prevenzione e trattamento dell'infezione virale. Moscerino della frutta Drosophila melanogaster ha dimostrato di essere uno degli organismi modello più efficiente e produttivo allo schermo per fattori antivirali e indagare l'interazione virus-ospite, a causa di potenti strumenti genetici e altamente conservato immune innata vie di segnalazione. La procedura descritta qui di seguito viene illustrato un metodo di nano-iniezione per stabilire l'infezione virale e inducono risposte antivirali sistemiche in mosche adulte. Il controllo preciso della dose iniezione virale in questo metodo consente un'elevata riproducibilità sperimentale. Protocolli descritti in questo studio includono la preparazione di mosche e il virus, il metodo di iniezione, analisi del tasso di sopravvivenza, la misurazione del carico di virus e una valutazione del percorso antivirale. Gli effetti di influenza dell'infezione virale di sfondo dei mosche sono stati menzionati qui. Questo metodo di infezione è facile da eseguire e quantitativamente ripetibile; può essere applicato allo schermo per host/virali fattori coinvolti nell'interazione virus-ospite e dissezionare il crosstalk tra immuni innate di segnalazione e altre vie biologiche in risposta all'infezione virale.

Introduction

Emergenti di infezioni virali, soprattutto da arbovirus, come la Chikungunya virus1, il virus Dengue, la febbre gialla virus2 e ilvirusdi Zika3, sono state un'enorme minaccia per la salute pubblica di causare pandemie 4. così, una migliore comprensione dell'interazione virus-ospite è diventato sempre più importante per il controllo delle epidemie e trattamento di malattie virali negli esseri umani. Per questo obiettivo, è necessario stabilire modelli più appropriati ed efficaci per studiare i meccanismi alla base di infezione del virus.

Moscerino della frutta, Drosophilamelanogaster (d. melanogaster), fornisce un potente sistema per studiare l'interazione virus-ospite5,6 e ha dimostrato di essere uno dei modelli più efficienti per lo studio di malattie virali umane7 , 8 , 9. antivirale altamente conservato segnalazione percorsi e strumenti genetici incomparabile rendono vola un grande modello per produrre risultati significativi con reali implicazioni per gli studi umani di antivirali. Inoltre, mosche sono facile e poco costoso da mantenere in laboratorio e sono convenienti per lo screening su larga scala di nuovi fattori di regolazione6,10 il virus e l'host durante l'infezione.

Quattro importanti vie antivirale altamente conservate (ad es., il RNA interference (RNAi) via11, la via JAK-STAT12, il pathway di NF-κB e l'autofagia via13) sono ben studiati in Drosophila negli ultimi anni6. La via di RNAi è un ampio meccanismo antivirale che può sopprimere la maggior parte dei generi di virus infezione6,14. Interruzione di questa via di mutazione nei geni come Dicer-2 (Dcr-2) o 2 Argonaute (AGO2) può portare a maggiore virus titolo e host mortalità15,16,17. La via JAK-STAT è stata implicata nel controllo dell'infezione da un virus della famiglia Dicistroviridae e famiglia Flaviviridae negli insetti, ad es., Drosophila C virus (DCV) mosche16 e virus del Nilo occidentale (WNV) e il Virus della Dengue nel zanzara18,19. Il pedaggio di Drosophila (omologo al pathway di NF-κB umano) e i percorsi di immunodeficienza (IMD) (simile alla via n-f-κB e TNF umana) sono entrambi coinvolti nella difesa virus invasione20,21, 22. l'autofagia è un altro meccanismo conservato coinvolti nella regolazione dell'infezione virale, che è ben caratterizzato in Drosophila23,24. Così, identificazione di nuovi fattori regolatori di questi meccanismi e dissezione diafonia tra questi antivirali di segnalazione e altri percorsi biologici, come il metabolismo, invecchiamento, reazione neurale e così via, possono essere facilmente impostati in Drosophila sistema.

Anche se più affermati modelli infettive virali in Drosophila sono indotte da virus a RNA, infezione dall'invertebrato iridescente Virus 6I (IV-6) e virus di Kallithea hanno dimostrato il potenziale per lo studio di virus a DNA in mosche25, 26. Inoltre, il virus può anche essere modificato per consentire infezione di Drosophila, come il virus dell'influenza9. Questo ha notevolmente ampliato l'applicazione della piattaforma di screening di Drosophila . In questa procedura, usiamo DCV come esempio per descrivere come sviluppare un sistema virale infettivo in drosofila. DCV è un virus a RNA incagliato singolo senso positivo di circa 9300 nucleotidi, codifica 9 proteine27. Come agente patogeno naturale di d. melanogaster, DCV è considerato come un virus adatto per studiare fisiologici, comportamentali e basale risposta immunitaria durante host-virus interazione e co-evoluzione28. Inoltre, il tasso di mortalità rapida dopo l'infezione in wild-type mosche rende DCV utile alla schermata per geni resistenti o sensibili nel host29.

Tuttavia, ci sono diversi aspetti di preoccupazione quando si studia le infezioni virali in drosofila. Ad esempio, batteri simbiotici Wolbachia hanno una capacità di inibire un ampio spettro di proliferazione di virus a RNA in Drosophila e zanzara30,31,32. Dati recenti indicano un possibile meccanismo in cui Wolbachia blocchi Sindbis virus (SINV) l'infezione attraverso il upregulation della metiltransferasi Mt2 espressione in host33. Inoltre, il background genetico degli insetti è critico per l'infezione virale. Per esempio, il polimorfismo naturale nel gene, pastrel (pst), determina la suscettibilità all'infezione di DCV in Drosophila34,35, mentre i loci di Ubc-E2H e CG8492 sono coinvolti in Flock house virus (FHV) infezione, rispettivamente36e virus di paralisi di Cricket (CrPV).

I particolari modi per stabilire l'interazione virus-ospite in mosche, devono essere scelti secondo scopi di ricerca come ad esempio uno schermo ad alta produttività per componenti cellulari di host in Drosophila cella linee37,38, orale infezione di studiare la risposta antivirale specifica gut22,39,40, ago che pungono41,42 o nano-iniezione passando le barriere epiteliali per stimolare immunitario sistemico risposte. Nano-iniezione può controllare con precisione la dose virale per indurre una reazione controllata di antivirale e una lesione fisiologico43, garantendo così un'elevata riproducibilità sperimentale44. In questo studio, descriviamo un metodo di nano-iniezione per studiare le interazioni virus-ospite in Drosophila, evidenziando l'importanza di effetti di sfondo dei mosche.

Protocol

Nota: Prima di iniziare l'esperimento, le linee cellulari e volare scorte utilizzate non devono essere contaminate da altri patogeni, soprattutto per i virus come DCV, FHV, Drosophila X virus (DXV) e nefrite aviaria (ANV). Idealmente, il sequenziamento di RNA o una più semplice identificazione basati sulla PCR sono utilizzati per rilevare la contaminazione10,45. Se la contaminazione si è verificato, gli stock di volare e di linee cellulari non deve essere utilizzato di più fino a quando sono completamente decontaminati46.

1. virus e preparazione volare

  1. Raccolta e diffusione di virus
    Nota: Drosofila S2 * cellule sono utilizzate per la titolazione e la propagazione di DCV. La linea cellulare S2 * è derivata da una coltura primaria di embrioni in fase tardi di d. melanogaster . Questa linea cellulare è stato ben descritto in precedenza47.
    1. Crescere cellule S2 * in media della drosofila di Schneider a 25 ° C senza ulteriori CO2, come un monostrato sciolto, semi-aderente in una piastra di coltura delle cellule di 10 cm, ad una densità di 1 x 107 vitali cellule/mL. Utilizzo medio completo per cellule di S2: media della drosofila di Schneider contenente 10% calore inattivato FBS, 100 unità/mL penicillina e 100 μg/mL streptomicina.
      Nota: Le cellule sane dovrebbero mostrare una forma rotonda e dimensione omogenea per mostre.
    2. Scongelare rapidamente lo stock DCV da-80 ° C in bagnomaria a 25 ° C. Infettare cellule S2 * con DCV a MOI = 0,01 immediatamente direttamente aggiungendo 1 mL di soluzione di virus per i piatti di cultura cellulare (area di crescita: 55cm2) con 10 mL di terreno completo per cellule di S2.
    3. Incubare le cellule a 25 ° C per 3-5 giorni. Quando il virus è pronto per la raccolta, la morfologia della cellula sia anormale (forma cellulare sembra sfocatura) e terreno di coltura è pieno di particelle nere indicative di detriti cellulari.
    4. Raccogliere la cultura di tutta la cella in una provetta da 15 mL pipettando su e giù e congelare a-80 ° C (per fino a un anno).
      Nota: DCV possono essere memorizzati per periodi prolungati di tempo a-80 ° C con una minima perdita di infettività, fino ad un anno.
    5. Scongelare la coltura delle cellule in un bagno di acqua di 25 ° C con agitazione costante e poi Centrifugare a 6.000 x g per 15 min a 4 ° C. Raccogliere il surnatante in una provetta sterile da 15 mL e vortex. Aliquota fino a 200 μL di soluzione di virus per tubo.
      Nota: Le aliquote Virus possono essere memorizzate per brevi periodi fino a 3 giorni a 4 ° C e fino a 1 anno a-80 ° C. Evitare cicli ripetuti di congelamento-scongelamento. È sempre meglio usare tutti l'aliquota in una sola volta.
    6. Scegliere 5 provette contenenti virus casuale per determinare la dose infettiva di coltura del tessuto medio virus (TCID50) da un'analisi di effetto citopatico (CPE) (1 unità di TCID50= 0,7 placca che formano unità [PFU]).
      Nota: CPE si riferisce ai cambiamenti strutturali nelle cellule dell'ospite causate tramite l'invasione virale. Il virus infettano provoca la lisi della cellula ospite, o quando la cellula muore senza Lisi dovuto un'incapacità di riprodurre48.
      1. Il giorno 1, raccogliere preparato S2 * cellule pipettando. Contare il numero di cellulare. Centrifugare le cellule per 300 x g per 4 min e scartare il surnatante. Diluire le cellule per la densità di 1 x 106 cellule/mL con terreno completo per S2 * le celle come descritto al punto 1.1.1.
      2. Semi di 1 x 105 S2 * (100 μL) di cellule per pozzetto di fondo piatto 96 pozzetti (confluency di ~ 30%).
      3. Effettuare diluizioni seriali 10 volte dello stock DCV con terreno completo per cellule di S2. Aggiungere 50 diluizioni µ l nel pozzo. Aggiungere 50 µ l di terreno di coltura senza virus classificati bene come controllo negativo.
        Nota: Per ogni tasso di diluizione, 8 pozzetti sono stati usati. Come la resa DCV tipica è circa 108-109 PFU/mL, la diluizione dovrebbe coprire almeno ~ 10-5-10-10.
      4. Il giorno 4, osservare CPE con un microscopio a campo chiaro con un 20x o obiettivo 40x. Classificare un pozzo in cui le cellule appaiono sfocate e il supporto è pieno di frammenti come un pozzo"positivo" e un pozzo in cui la morfologia cellulare è normale come"negativo".
      5. Pozzi di positivo o negativi di Mark CPE con + o –, rispettivamente. Calcolare il virus TCID50 la Reed e Muench metodo49.
    7. Smaltire tutti i materiali contaminati e guanti in padella decontaminazione. Se il virus non può raggiungere il desiderato TCID50, concentrato 100 mL di soluzione di virus mediante centrifugazione a 68.000 x g per 1 h a 4 ° C.
      Nota: a seconda lo scopo dell'esperimento, una gamma di dosi da 102 a 106 TCID50 unità può essere utilizzato per l'infezione del virus. In genere, usiamo 3 x 106 TCID50 unità.
    8. Scartare il surnatante e risospendere in 1 mL di tampone Tris-HCl (10 mM, pH 7,2). Aliquota 20 μL di soluzione di virus per tubo e conservare a-80 ° C. Scegli 5 tubi casuale per determinare il medio virus TCID50 nuovamente.
  2. Preparazione per l'infezione di volare
    Nota: Batteri simbiotici Wolbachia possono sopprimere molti tipi di infezione di virus a RNA in insetti30,31,32,33,41. Quindi, è essenziale per eliminare Wolbachia da mosche prima di studiare l'infezione virale in vivo33.
    1. Preparare il cibo volo contenenti tetraciclina aggiungendo 400 μL di 50 tetraciclina µ g/mL (in etanolo al 70%) a 4 g di alimento fresco standard farina di mais (1 L di cibo contiene 77,7 g di farina di mais, 32,19 g di lievito, 10,6 g di agar, 0,726 g di CaCl2 31,62 g di saccarosio, 63,3 g di glucosio, 2 g di potassio sorbato e 15 mL di 5% C8H8O3). Mescolare accuratamente e mettere gli alimenti a 4 ° C durante la notte per far evaporare di etanolo.
      Nota: Una dose elevata di etanolo può influire sulla fertilità volare, così non omettere questo passaggio.
    2. Caldo il cibo a temperatura ambiente e mettere appena obtecta mosche adulte (20 femmine e 10 maschi) nel flaconcino. Allevare le mosche a 25 ° C, umidità 60% nell'ambito di un normale ciclo luce/buio.
      Nota: In genere, ci vogliono 3-4 giorni per le mosche a deporre abbastanza uova. Troppe uova inibiscono lo sviluppo di larve e diminuiscono l'efficienza della tetraciclina.
    3. Raccogliere appena mosche adulte obtecta (entro 3 ~ 5 giorni) sotto un flusso luminoso di CO2e ripetere il passaggio ~ 1.2.1-1.2.2. In genere, almeno 3 generazioni sono necessari per l'eliminazione completamente di Wolbachia.
    4. Dopo 3 generazioni con trattamento tetraciclina, raccogliere 5 mosche sotto un flusso luminoso di CO2 per la prova di infezione di Wolbachia . Macinare le mosche per 1 min con 250 μL di acqua bidistillata (ddH2O) e alcune perle di ceramica sterile di 0,5 mm in una provetta da 1,5 mL utilizzando un omogeneizzatore. Aggiungere un altro 250 μL di 2 x tampone A (0.2 M Tris-HCl, pH 9.0; 0,2 M EDTA; 2% SDS) per il campione e il vortice.
      Nota: Poiché SDS impedirà il movimento del tallone, 1x tampone A non può essere direttamente utilizzato per macinare le mosche. Se le mosche hanno gli occhi rossi, rimuovere teste prima della rettifica, in quanto questo può influenzare il colore del prodotto del DNA.
    5. Congelare i campioni a-80 ° C (tenere fino ad un anno). Scongelare rapidamente il campione da-80 ° C in bagnomaria a 25 ° C fino a completa dissoluzione. Incubare i campioni a 70 ° C per 30 min.
    6. Aggiungere 190 µ l di 5 M KOAc, vortex e incubare in ghiaccio per 15 minuti o più.
    7. Centrifugare i campioni a 13.000 x g per 5 min a temperatura ambiente, raccogliere il surnatante e trasferirli in nuove provette.
    8. Ripetere il passaggio 1.2.7 ottenere il DNA con una migliore qualità.
    9. Aggiungere 750 μL di isopropanolo per ogni campione e capovolgere delicatamente un paio di volte a mano. Incubare a temperatura ambiente per 5 min.
    10. Centrifugare i campioni a 13.000 x g per 5 min a temperatura ambiente e scartare il surnatante. Il pellet di DNA genomico bianco rimarrà nella parte inferiore del tubo.
    11. Aggiungere 1 mL di etanolo al 70% per il pellet, centrifuga a 13.000 x g per 5 min e scartare il surnatante. Asciugare all'aria il DNA fino a quando non diventa trasparente.
    12. Sciogliere il DNA in 100 μL di ddH2O, titolare di concentrazione di DNA mediante spettrofotometria di assorbimento UV-Vis e diluire il DNA a 100 ng/μL.
    13. Uso 200 ng di DNA per la reazione di PCR (in un sistema di 20 μL, vedere la Tabella materiali). PCR per eseguire il seguente programma: 95 ° C per 15 min; ciclo di 36 di 95 ° C per 45 s, 50 ° C per 45 s e 72 ° C per 1 min; e un passo di estensione finale (72 ° C per 1 min) in un termociclatore.
      Nota: Basato su Wolbachia 16S rRNA, utilizzare i seguenti primer: 5' TGAGGAAGATAATGACGG 3' (avanti) e 5' CCTCTATCCTCTTTCAACC 3' (inverso). Per wsp, erano i primer 5' CATTGGTGTTGGTGTTGGTG 3' (avanti) e 5' ACCGAAATAACGAGCTCCAG 3' (inverso).
    14. Analizzare i prodotti di PCR con elettroforesi su gel di agarosio all'1%. Il formato del prodotto PCR di Wolbachia 16S rRNA e wsp è circa 200 bp e 600 bp, rispettivamente.
    15. Posteriore Wolbachia stock fly free su alimento standard farina di mais. Raccogliere 3-5 giorni appena obtecta uomo vola per infezione.
      Nota: Trattamento tetraciclina può colpire anche la composizione del microbiota intestinale, che successivamente influenza le risposte antivirali nell'ospite. Si consiglia che tutte le mosche dovrebbero ricevere gli stessi trattamenti di tetraciclina. Tenere mosche privo di Wolbachia cresce in condizioni standard per almeno 3 generazioni ripristinare microbiota dell'intestino.
  3. Genotipizzazione Pastrel
    Nota: La presenza dell'allele del gene di pst in background genetico S o R è stata segnalata per interessare l'infezione DCV in Drosophila34,35. È necessario controllare il genotipo di pst , soprattutto per l'infezione DCV. Ci sono pochi SNPs in pst che possono influenzare l'infezione del virus, il SNP major è 512 C/T. Il gradiente di temperatura PCR è un metodo rapido per identificare il genotipo di pst .
    1. Estratto di volare DNA genomico, come descritto in precedenza (punto 1.2.4 - 1.2.15).
    2. Uso 100 ng di DNA come il modello, il primer 512C, 5' CAGCATGGTGTCCATGAAGTC 3' (avanti) e 5' ACGTGATCAATGCTGAAAGT 3' (indietro) per rilevare l'allele R, il primer 512T, 5' CAGCATGGTGTCCATGAAGTT 3' (avanti) e 5' ACGTGATCAATGCTGAAAGT 3' (indietro) per rilevare il Allele S.
    3. Impostare i gradienti di Tm (temperatura di fusione) come segue: 54 ° C, 54,7 ° C, 55,5 ° C, 58 ° C, 59,7 ° C, 62,2 ° C, 63,7 ° C e 64 ° C (45 s ad ogni temperatura).
      Nota: 30 cicli di PCR reazione a catena sono raccomandati (sistema 20 μL).
    4. Visualizzare il prodotto di PCR 100-bp mediante elettroforesi su gel di agarosio al 2%.

2. virale infezione in Drosophila

  1. Infettare mosche di nano-iniezione ed eseguire le analisi di sopravvivenza.
    1. Tirare i capillari per preparare gli aghi per iniezione, retro-riempimento l'iniezione dell'ago con olio e montare l'iniettore come precedentemente descritto50.
    2. Anestetizzare mosche sul tappetino sotto un flusso luminoso di CO2. Inoculare mosche da iniezione intra-toracica44 50,6 nL di soluzione virus (100 PFU, diluito con soluzione tampone Tris-HCl, pH 7,2). Iniettare almeno 3 flaconcini di mosche (20 mosche per flaconcino).
      Nota: L'iniezione è che richiede tempo (generalmente 100 mosche ogni ora) e replica DCV è molto rapida, quindi è molto importante annotare l'ora esatta sul tubo una volta finitura ogni flaconcino (20 mosche). Buffer solo iniezione è impostato come un finto controllo. Di solito, mosche adulte maschi sono preferiti, sono risultati più stabili e riproducibili rispetto all'utilizzo di femmine poiché variazioni ormonali durante l'accoppiamento e riproduzione possono influenzare la lettura di femmine51.
    3. Crescere le mosche iniettati a 25 ° C, umidità 60% nell'ambito di un normale ciclo luce/buio. Fornitura di mosche con cibo fresco ogni giorno e registrare il numero di morti flies.
    4. Eseguire almeno 3 repliche biologiche e tracciare la curva di sopravvivenza.
    5. Per l'analisi statistica dei dati di sopravvivenza, generare le curve di sopravvivenza di Kaplan-Meier di software statistico. Eseguire test log-rank aggiustato per calcolare i valori di P. Sul tavolo di sopravvivenza, immettere le informazioni per ogni soggetto. Il software quindi Calcola percentuale sopravvivenza in ogni momento e trame di un complotto di sopravvivenza di Kaplan-Meier.
      Nota: Non aggiungere ulteriore lievito nel flaconcino. Rispetto ai comandi finti, DCV-infettati mosche occasionalmente avere ascite e sono goffi, che li rendono vulnerabili al lievito appiccicoso. È meglio registrare più punti di tempo nell'esperimento preliminare per scoprire un lasso di tempo in cui la morte di massa accadrà per le mosche infette. Generalmente, le mosche infette raramente muoiono entro i primi due giorni, anche per le linee mutanti Dcr-2 . Per il Wolbachia volare gratis w1118 (Bloomington 5905) infettati con 100 PFU di DCV, questa finestra di tempo è circa 3-5 giorni dopo infezione. Mosche della frutta che muoiono entro ore di 0,5 h post iniezione non devono essere contate come una fatalità perché possono essere uccisi da ferita dell'ago non da un'infezione virale.
  2. DCV caricare misura dall'analisi di CPE
    Nota: Carica virale viene misurata analogamente alla titolazione dello stock virus (punto 1.1.6) ma richiede una preparazione campione supplementare (punto 2.2.1-2.2.4).
    1. Il giorno 1, infettare mosche maschii come descritto nel passo 2.1.1-2.1.2. Gruppo iniettati mosche in gruppi di 20 e tenerli in crescita su cibi freschi volare per il tempo desiderato (in genere per 24 h o 3 giorni). Forniscono mosche con cibo fresco ogni giorno.
    2. Il giorno 2, seme della drosofila S2 * cellule in una piastra di coltura delle cellule di 10 cm alla densità di circa 5 x106 a 1 x 107 cellule/mL come descritto al punto 1.1.1.
    3. Il giorno 3, raccogliere 5 mosche (sotto un flusso luminoso di CO2) e li pestava in una provetta da centrifuga da 1,5 mL per 30 s con 200 μL di tampone Tris e perle di ceramica utilizzando omogeneizzatore. Conservare i campioni a-80 ° C o immediatamente procedere al passaggio successivo.
    4. Accuratamente Vortexare il campione. Utilizzare una siringa da 1 mL e 0,22 μm filter per filtrare il surnatante in una nuova provetta da 1,5 mL. Procedere con la titolazione, come descritto nella procedura 1.1.6.1-1.1.6.5.
  3. Carico DCV misurato mediante qRT-PCR
    1. Il giorno 1, infettare mosche come descritto sopra. Gruppo iniezione maschio vola (20 mosche/gruppo) e crescere il cibo fresco di volare per il tempo desiderato, in genere per 24 h o 3 giorni. Forniscono mosche con cibo fresco ogni giorno.
    2. Il giorno 3, raccogliere 5 mosche sotto un flusso luminoso di CO2 in una provetta da 1,5 mL con 200 μL di tampone di lisi e 20 perle in ceramica (diametro = 0,5 mm), macinare i campioni di omogeneizzatore ad alta velocità per 30 s. aggiungere 800 μL di tampone di lisi aggiuntive in ogni provetta e memorizzare il s estrazione del RNA e qRT-PCR condurre ampie a-80 ° C o immediatamente.
    3. Preparare le punte libere di RNasi, tubi e deionizzata, dietilpirocarbonato (DEPC) trattati e 0,22 µm membrana-filtrata acqua. Aggiungere 200 µ l di cloroformio (≥ 99.5%) nel campione e vigorosamente agitare per 15 s a mano. Incubare per 5 minuti o più a lungo a temperatura ambiente fino a quando la fase acquosa e la fase organica sono chiaramente separati.
      Nota: Cloroformio è estremamente pericoloso e deve essere maneggiato con cura. Non centrifugare il campione, che aumenterà il rischio di contaminazione da DNA.
    4. Centrifugare i campioni a 13.000 x g per 15 min a 4 ° C.
    5. Raccogliere 400 μL del surnatante e trasferire il surnatante in nuove provette. Mescolare con la stesso volume di isopropanolo (≥ 99.5%), capovolgere delicatamente a mano i campioni per 20 volte e poi precipitare per 10 minuti o più a lungo a temperatura ambiente.
      Nota: Precipitazioni a-20 ° C aumenterà il rendimento del RNA.
    6. Centrifugare i campioni a 13.000 x g per 10 min a 4 ° C. Pellet di RNA di bianco sono visibili nella parte inferiore del tubo.
    7. Scartare il surnatante e aggiungere 1 mL di etanolo al 70% (etanolo in acqua DEPC) ed invertire alcune volte per lavare il RNA.
    8. Centrifugare i campioni a 13.000 x g per 5 min a 4 ° C. Scartare il surnatante e asciutto RNA per 5-10 min; RNA dovrebbe diventare trasparente.
    9. Aggiungere 50 μL di acqua DEPC a campione, pipetta per poche volte e vortex.
    10. Prendere 3 μL di RNA per titolazione la concentrazione di RNA. Quantificare il RNA a 260 nm. Normalmente, la concentrazione di RNA estratta dal presente protocollo è circa 100-500 μg/μL, che è adatto per la sintesi di cDNA.
    11. Utilizzare 2 μg di RNA per la sintesi di cDNA. Diluire il campione a 100 μL con ddH2O e conservare a-20 ° C.
    12. Eseguire qRT-PCR secondo le istruzioni del produttore e i qRT-PCR.
      Nota: Per la sintesi di cDNA di DCV, primer casuale lavorato molto meglio di primer poli A nelle nostre mani. L'espressione del mRNA DCV è normalizzato a endogena della proteina ribosomiale 49 (rp49) mRNA. Iniettori del oligonucleotide utilizzati in questa parte: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (avanti) e 5' CACCAGGAACTTCTTGAATCCGG 3' (retromarcia); DCV, 5' TCATCGGTATGCACATTGCT 3' (avanti) e 5' CGCATAACCATGCTCTTCTG 3' (retromarcia); vago, 5' TGCAACTCTGGGAGGATAGC 3' (avanti) e 5' AATTGCCCTGCGTCAGTTT 3' (retromarcia); virus-indotta (in avanti) RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' e 5' GATTACAGCTGGGTGCACAA 3' (inverso).

Representative Results

Risultati di questa sezione sono ottenuti dopo l'infezione di DCV di d. melanogaster. La figura 1 Mostra il diagramma di flusso dell'infezione virale in drosofila. Mosche sono iniettati intra-thoracically, e quindi i campioni sono raccolti per la misurazione del virale TCID50 e livello di RNA del genoma (Figura 1). Infezione da virus può indurre la lisi cellulare e CPE è osservato a 3 giorni post infezione (Figura 2A). Il carico del virus misurato dall'analisi di CPE è in linea con quello misurato da qPCR (Figura 2B). Come mostrato nella Figura 3, Wolbachia inibisce l'infezione DCV in drosofila. WOL-16s rRNA e wsp primer vengono utilizzati per rilevare la presenza di Wolbachia (Figura 3A) e Wolbachia-mosche gratis mostrano il tasso di sopravvivenza significativamente in diminuzione dopo infezione DCV (Figura 3B). Nella figura 4 viene illustrato come verificare pst polimorfismo di pendenza PCR utilizzando primers specifici. La figura 5 Mostra dose dipendenti effetti dell'infezione DCV nel moscerino della wildtype. Il tasso di sopravvivenza in Figura 5A e il virus caricare 3 giorni post infezione è mostrato in figura 5B. Figura 6 dimostra che l'infezione DCV può attivare l'antivirale Dcr2/RNAi e JAK/STAT vie nel host52di segnalazione. Il livello di espressione dell'espressione reporter gene vago della via Dcr2/RNAi è elevato 3 giorni post infezione (Figura 6A). La via JAK-STAT è anche attivata al momento dell'infezione DCV, questo è indicato il livello di espressione di reporter gene vir-1 (Figura 6B). La figura 7 Mostra che la via Dcr2/RNAi è critica per l'infezione antivirale in Drosophila52. DCR-2 mosche mutanti hanno un tasso di sopravvivenza in diminuzione (figura 7A) e un carico aumentato virus (figura 7B) dopo l'infezione DCV.

Figure 1
Figura 1: diagramma di flusso dell'infezione di Drosophila e analisi del carico di virus.
L'instaurazione dell'infezione di Drosophila di nano-iniezione. Il grafico dello schema mostra che mosche sono infettati intra-thoracically e quel carico di virus sono misurati mediante il dosaggio CPE e qRT-PCR. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Analisi del carico DCV.
Il carico del virus misurato dall'analisi di CPE è in linea con quello misurato da qPCR. (A) cellule di S2 sono coltivate a 25 ° C per 3 giorni con una diluizione di diversi virus (50 μL). 1 unità TCID50 del virus usato è 4,29 x 109 (equivalente a 3 x 109 PFU/mL). Primo pannello, 10-3 diluizione; secondo pannello, 10-7 diluizione; terzo pannello, 10-10 diluizione; quarto pannello, w/o infezione. Le cellule nel pannello uno e due mostrano il fenotipo tipico di positivo CPE (frecce bianche indicano detriti cellulari), e le cellule nel pannello tre e quattro mostrano il fenotipo tipico di negativo. La barra della scala è indicata nelle figure. (B) misurazione del DCV caricare qPCR. Effettuare diluizioni seriali 10 volte del DCV e infettare la linea cellulare S2 *. Viene estratto il RNA totale delle cellule infettate e qPCR viene eseguita per misurare il livello di RNA DCV. Gradiente carica infettiva virale (determinata mediante analisi di CPE) nelle cellule è abbinata e positivamente relative alla misurazione di qPCR (r2= 0,999). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Infezione virale delle mosche con o senza Wolbachia.
Infezione di Wolbachia contribuisce alla resistenza di DCV in drosofila. (A) la presenza è rilevata dai primer wol-16s rRNA e wsp Wolbachia. G1, G2 e G3 rappresentato mineralermosche (Oregon-R) (Bloomington 5) trattati con tetraciclina per uno, due e tre generazioni rispettivamente. Il formato del prodotto PCR è di circa 200 bp (wol-16s rRNA) e 600 bp (wsp). (B) Wolbachia gratis mosche sono più sensibili all'infezione DCV. 3-5 giorno vecchi maschi mosche adulte sono iniettati con 100 PFU di DCV. Wolbachia gratuito Vola (linee continue) Visualizza significativamente ridotta sopravvivenza che Wolbachia protetto mosche (linee di dash) al momento dell'infezione DCV. Due linee differenti wildtype, mineraler e w1118, sono utilizzati per l'analisi di sopravvivenza e Visualizza risultato simile. Tutte le barre di errore rappresentano standard error (s.e.) di almeno tre prove indipendenti; * P < 0,05, * * P < 0.01, * * * P < 0,001, * * * P < 0,0001, ns, non significativo. Kaplan-Meier (B). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Pastrel genotipizzazione mediante PCR gradiente.
polimorfismo di pst viene verificato mediante PCR gradiente. Gradiente PCR viene eseguita per distinguere pst R (512 C) e l'allele S (512T) nell'adulto della drosofila . Gradienti di TM sono r: 54 ° C, b.: 54,7 ° C, c.: 55,5 ° C, d: 58 ° C, e: 59,7 ° C, f.: 62,2 ° C, g.: 63,7 ° C, h: 64 ° C.  Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: Tasso di sopravvivenza e titolo DCV di mineraler mosche infettati con una dose diversa di DCV.
Mosche di mineralervengono iniettati con tre diverse dosi di DCV, 10 PFU/volare, PFU/fly 50 e 100 PFU/volare. (A) il tasso di sopravvivenza dei mosche è significativamente più basso di quando infettati con dosi più elevate infettive. (B) il livello di RNA DCV in tutto il corpo di mosche indicati è misurato mediante qRT-PCR al tempo indicato e normalizzato a quello del gruppo di inoculazione 10 PFU/volare. Tutte le barre di errore rappresentano standard error (s.e.) di almeno tre prove indipendenti; * P < 0,05, * * P < 0.01, * * * P < 0,001, * * * P < 0,0001, ns, non significativo. Kaplan-Meier (A) o One-Way anova (B). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6: Dcr2/RNAi e antivirale JAK/STAT signaling pathway attivato dopo l'infezione DCV.
Mosche di mineralersono stati infettati con 100 PFU di DCV. Vago (A) e (B) vir-1 mRNA espresso in tutto il corpo sono misurate mediante qRT-PCR al tempo indicato punti post infezione. Il cambiamento di espressione è normalizzato a quella del livello basale prima dell'infezione. Tutte le barre di errore rappresentano standard error (s.e.) di almeno tre prove indipendenti; * P < 0,05, * * P < 0.01, * * * P < 0,001, * * * P < 0,0001, ns, non significativo. One-way ANOVA (A, B). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 7
Figura 7: Dcr-2 mutante fly sensibili all'infezione DCV.
DCR-2 mutante Vola e relativo controllo genetico w1118 mosche sono stati infettati con 100 PFU di DCV. (A) i tassi di sopravvivenza di Dcr-2 carente mosche e mosche di selvaggio-tipo (w1118) post infezione DCV. (B) DCV RNA livello in tutto il corpo di mosche indicati è misurato tramite qRT-PCR 2 giorni post infezione e normalizzato a quello di w1118. Tutte le barre di errore rappresentano standard error (s.e.) di almeno tre prove indipendenti; * P < 0,05, * * P < 0.01, * * * P < 0,001, * * * P < 0,0001, ns, non significativo. Kaplan-Meier (A) o T-test (B) di student. Clicca qui per visualizzare una versione più grande di questa figura.

Discussion

In questo articolo, presentiamo una procedura dettagliata su come stabilire un sistema virale infettivo in adulto Drosophila melanogaster usando nano-iniezione. I protocolli prevedono la preparazione di adeguate linee di volare e stock di virus, tecniche di infezione, la valutazione degli indicatori infettivi e la misura della risposta antivirale. Sebbene DCV è usato come un esempio di un agente patogeno virale, decine di diversi tipi di virus sono state applicate con successo per lo studio del sistema di Drosophila. Inoltre, centinaia di fattori regolatori, del virus o dell'host, è stati identificati attraverso lo screening su larga scala in mosche. Pertanto, questo metodo è altamente adattabile e non limita a DCV / interazionedella drosofila .

Per propagare e raccolto alto titolo DCV, devono essere prese alcune precauzioni. Le cellule dovrebbero essere sane, coltivate a una densità adatta e raccolte in tempo. Riduzione del volume delle cellule di cultura non influisce in modo significativo titolo del virus. In genere, 107 cellule infettate da DCV a MOI = 0,01 verrà finalmente resa approssimativa 108-109 TCID50 di DCV, in grado di soddisfare le esigenze della maggior parte degli esperimenti in vivo e in vitro . Il CPE test e test di qRT-PCR sono descritti nel presente protocollo per la misurazione del carico del virus. Il dosaggio CPE è in qualche modo difficile. La densità appropriata di inoculazione delle cellule e un esperto di discriminazione CPE positivo/negativo standard consentono un'analisi rapida e di successo di CPE. Così, mettiamo a disposizione un test facile qRT-PCR qui per aiutare a decidere il punto di cut-off diluizione nell'analisi di CPE prima di padroneggiare il dosaggio CPE.

Tuttavia, DCV è un virus molto potente per la mosca adulta e la linea cellulare di Drosophila . Solo 100 PFU/fly inoculazione può uccidere il 50% di Envolée entro 5 giorni. Una dose di infezione in eccesso può nascondere il significato tra le righe suscettibili di wild-type, volare e potenziali. È importante applicare almeno due dosi di infezione quando si inizia una nuova schermata. Poiché la morte massiccia di Drosophila può accadere in una finestra di tempo molto breve a causa di alta mortalità di DCV, registrando il numero di morte più frequentemente in esperimenti preliminari è fortemente raccomandato. Dopo l'infezione DCV, alcune mosche occasionalmente avere sindrome di ascite. In particolare, le mosche che muoiono entro l'infezione 0,5 h post dovrebbero essere esclusa, che potrebbe essere causato dalla ferita di iniezione dell'ago inappropriato.

La forza contagiosa di DCV è anche influenzata da molti fattori dell'ospite, che dovrebbero essere considerati prima di iniziare un esperimento. Wolbachia è una verticale trasmettere endosymbiont che ha un grande impatto sull'infezione del virus in mosche32. Trattamento di tetraciclina in alimento è un metodo comune utilizzato per eliminare l'infezione di Wolbachia . Tuttavia, questo metodo inoltre altera la composizione del microbiota intestinale, che a sua volta può influenzare la risposta antivirale53. Alcuni studi hanno sottolineato l'importanza della varianza genetica su infezione virus36, come ubc-e2h, cg8492 e pst. Ad esempio, la maggior parte tipo selvaggio volare linee hanno pst S allele e sono sensibili a picorna-come il virus, mentre la maggior parte delle linee mutanti abbiamo testato dal centro stock Bloomington hanno pst R allele, così avendo fenotipi resistenti. È molto importante escludere l'impatto del pst, soprattutto quando lo screening su un gene di resistenza confrontando con wild-type controllo29.

Oltre a nano-iniezione per indurre infezione sistemica del virus, altri metodi sono disponibili per studiare l'infezione del virus in mosche. Drosophila linee cellulari hanno dimostrato di essere un metodo di alto-rendimento per escludere l'infezione del virus correlati host componente cellulare37,38. Tuttavia, un sistema in vitro è sempre accompagnato con un alto tasso di falsi positivi, quando si conferma in vivo. DCV può essere applicato anche per infettare Drosophila oralmente, considerando che solo può innescare un'infezione limitata e più mite. Solo il 20% delle larve sono stati infettati entro 12 h e 14% di mortalità è stato osservato, con appena il 25% di mortalità in 20 giorni in adulto Vola22. Pizzicore mosche con perni di 0,15 mm di diametro è un altro modo per impostare l'infezione virale, ma non può garantire la dose precisa di infezione e la ripetibilità quantitativa. Che overexpressing proteine virali di manipolazione genetica in mosche è un buon modo per studiare Interattomi molecolare in vivo7. Tuttavia, esso non può rappresentare la realtà della fisiologia e della patologia nell'ospite al momento dell'infezione. Nel frattempo, il metodo di nano-iniezione ha anche svantaggi, come non è la via naturale d'infezione e possa direttamente stimolare una risposta immunitaria forte sistema subito dopo l'infezione, che bypassato la cuticola, la prima linea di difesa antivirale. In sintesi, lo scopo specifico di ricerca e la condizione sperimentale disponibile sono i fattori decisivi nella scelta tra diversi metodi.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Vorremmo ringraziare l'intero laboratorio di Pan in IPS. CAS. Ringraziamo il dottor Lanfeng Wang (IPS, CAS) per assistenza sperimentale e Dr. Gonalo Cordova Steger (natura Springer), Dr. Jessica VARGAS (IPS, Parigi) e Dr. Seng Zhu (IPS, Parigi) per commenti. Questo lavoro è stato sostenuto da sovvenzioni da al programma di ricerca strategico prioritario dell'Accademia cinese delle scienze di l. p (XDA13010500) e h. t (XDB29030300), Fondazione della Cina nazionale di scienze naturali l. p (31870887 e 31570897) e J.Y. (31670909). L. p è membro dell'associazione per la promozione dell'innovazione di CAS della gioventù (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics