Mise en place d’une Infection virale et analyse de l’Interaction hôte-Virus chez Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Ce protocole décrit comment établir une infection virale in vivo chez Drosophila melanogaster en utilisant la méthode de nano-injection et les techniques de base pour analyser l’interaction virus-hôte.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Propagation du virus est une cause majeure de maladies épidémiques. Ainsi, la compréhension de l’interaction entre le virus et l’hôte est très important d’élargir nos connaissances de la prévention et le traitement de l’infection virale. La drosophile Drosophila melanogaster s’est avéré pour être un des organismes de modèle plus efficace et productif pour dépister les facteurs antiviraux et d’étudier l’interaction virus-hôte, grâce à puissants outils génétiques et immunitaire innée hautement conservée voies de signalisation. La procédure décrite ici illustre une méthode de nano-injection afin d’établir une infection virale et induisent des réponses antivirales systémiques chez les mouches adultes. Le contrôle précis de la dose d’injection virale dans cette méthode permet de haute reproductibilité expérimentale. Protocoles décrits dans la présente étude comprennent la préparation des mouches et le virus, la méthode d’injection, analyse du taux de survie, la mesure de la charge virus et une évaluation de la voie antivirale. Les effets de l’influence d’une infection virale par le fond des mouches ont été mentionnés ici. Cette méthode d’infection est facile à réaliser et quantitativement reproductible ; Il peut être appliqué à l’écran pour hôte/virale facteurs impliqués dans l’interaction virus-hôte et à disséquer la diaphonie entre immunitaire innée de signalisation et autres voies biologiques en réaction à l’infection virale.

Introduction

Emerging infections virales, surtout par les arbovirus, telles que le Chikungunya virus1, virus de la Dengue, la fièvre jaune virus2 et levirusde Zika3, ont été une énorme menace pour la santé publique en causant des pandémies 4. ainsi, une meilleure compréhension de l’interaction virus-hôte a pris une importance croissante pour la lutte contre les épidémies et le traitement des maladies virales chez l’homme. Pour atteindre cet objectif, des modèles plus adéquate et efficaces s’impose pour étudier les mécanismes sous-jacents d’infection par le virus.

La mouche à fruit, Drosophilamelanogaster (d. melanogaster), fournit un système puissant pour étudier les interactions de virus-hôte5,6 et s’est avéré pour être un des modèles plus efficaces pour étudier des maladies virales humaines7 , 8 , 9. antiviral hautement conservée de signalisation des voies et incomparables outils génétiques font vole un excellent modèle pour produire des résultats significatifs ayant des implications réelles pour études antivirale chez l’homme. En outre, les mouches sont faciles et peu coûteux de maintenir en laboratoire et sont confortables pour un dépistage à grande échelle de nouveaux facteurs de régulation6,10 dans le virus et l’hôte au cours de l’infection.

Quatre grandes voies antivirales hautement conservées (e.g., le RNA interférence (Arni) voie11, la voie de JAK-STAT12, la voie NF-κB et l’autophagie voie13) sont bien étudiés chez la drosophile au cours des dernières années6. La voie de l’ARNi est un mécanisme d’antiviraux large qui peut supprimer la plupart des types de virus infection6,14. Perturbation de cette voie de mutation des gènes comme Dicer-2 (Dcr-2) ou 2 Argonaute (AGO2) peut conduire à une augmentation des virus titre et hôte mortalité15,16,17. La voie de JAK-STAT a été impliquée dans la lutte contre l’infection par un virus de la famille des Dicistroviridae et de la famille des Flaviviridae chez les insectes, par exemple., Drosophila C virus (DCV) mouches16 et le virus du Nil occidental (VNO) et le Virus de la Dengue moustique18,19. Les frais de drosophile (homologue à la voie NF-κB humaine) et les voies de déficit immunitaire (IMD) (semblables à la voie NF-κB et TNF humaine) sont tous deux impliqués dans la défense de virus invasion20,21, 22. autophagie est un autre mécanisme conservé impliquée dans la régulation de l’infection virale, qui est bien caractérisée dans drosophile23,24. Ainsi, l’identification de nouveaux facteurs de régulation de ces voies et dissection diaphonie entre ces antiviraux de signalisation et d’autres voies biologiques, tels que le métabolisme, vieillissement, réaction neurale et ainsi de suite, peuvent être facilement configurés chez la drosophile système.

Bien que les modèles infectieuses virales plus bien établis chez la drosophile sont induites par les virus à ARN, infection par les invertébrés 6I irisé de Virus (IV-6) et virus de Kallithea ont montré le potentiel pour l’étude de virus à ADN le mouches25, 26. En outre, le virus peuvent également être modifié pour permettre l’infection de la drosophile, par exemple, le virus de la grippe9. Cela a considérablement élargi l’application de la plate-forme de criblage de drosophile . Dans cette procédure, nous utilisons DCV à titre d’exemple pour décrire comment développer un système infectieux viral chez la drosophile. DCV est un virus ARN monocaténaire seul polarité positive d’environ 9300 nucléotides, codage 9 protéines27. Comme un pathogène naturel de d. melanogaster, DCV est considéré comme un virus adapté pour étudier l’hôte physiologiques, comportementales et basale système immunitaire lors d’interaction et co-évolution hôte-virus28. En outre, son taux de mortalité rapide suite à une infection chez les mouches de type sauvage rend DCV utile pour dépister les gènes résistants ou sensibles dans l' hôte29.

Cependant, il y a plusieurs aspects préoccupants lorsque l'on étudie des infections virales chez la drosophile. Par exemple, les bactéries symbiotiques Wolbachia ont une capacité d’inhiber un large spectre de la prolifération de virus à ARN dans la drosophile et moustique30,31,32. Données récentes montrent un mécanisme possible quel Wolbachia blocs Sindbis (SINV) d’infection virale par le biais de l’upregulation de methyltransferase Mt2 expression dans l' hôte33. En outre, le bagage génétique des insectes est également critique pour une infection virale. Par exemple, le naturel polymorphisme du gène pastrel (pst), détermine la sensibilité aux infections DCV dans drosophile34,35, tandis que les locus de Ubc-E2H et CG8492 sont impliqués dans les virus de paralysie de Cricket (CrPV) et l’infection par les virus (FHV) maison de troupeau, respectivement36.

La manière d’établir l’interaction hôte-virus dans les mouches, doivent être choisies selon des fins de recherche tel qu’un écran de haut débit pour les composants cellulaires hôte Drosophila cellule lignes37,38, oral infection à étudier la réponse antivirale spécifique gut22,39,40, aiguille piquant41,42 ou nano-injection en passant les barrières épithéliales pour stimuler immunitaire systémique réponses. Nano-injection peut contrôler avec précision la dose virale pour induire une réaction antivirale contrôlée et une lésion physiologiques43, garantissant ainsi la grande reproductibilité expérimental44. Dans cette étude, nous décrivons une méthode de nano-injection pour étudier les interactions virus-hôte chez la drosophile, en soulignant l’importance des effets de fond des mouches.

Protocol

Remarque : Avant de commencer l’expérience, les lignées cellulaires et les stocks de mouche utilisées ne doivent pas être contaminés par d’autres agents pathogènes, en particulier pour les virus tels que DCV, FHV, Drosophila X virus (DXV) et le virus aviaire néphrite (ANV). Idéalement, le séquençage de RNA ou une identification plus simple basées sur la PCR sont utilisés pour détecter la contamination10,45. En cas de contamination, les lignées cellulaires et les stocks de mouche ne devraient pas être utilisés plus jusqu'à ce qu’ils soient décontaminés complètement46.

1. virus et préparation mouche

  1. Collecte et la propagation de virus
    NOTE : Drosophila S2 * cellules sont utilisés pour la titration et propagation de DCV. La lignée de cellules S2 * est dérivée d’une culture primaire des embryons de d. melanogaster stade tardif. Cette lignée cellulaire a été bien décrite précédemment47.
    1. La croissance de cellules S2 * au milieu de drosophile de Schneider à 25 ° C, sans plus de CO2, comme une monocouche semi adhérente, en vrac dans un plat de culture cellulaire de 10 cm, avec une densité de 1 x 107 cellules viables/mL. Milieu complet d’utilisation de cellules de S2 : milieu de drosophile de Schneider contenant 10 % de chaleur inactivé FBS, 100 unités/mL de pénicilline et 100 μg/mL de streptomycine.
      Remarque : Les cellules saines devraient montrer une forme ronde et pièce de taille homogène.
    2. Rapidement décongeler le stock DCV de-80 ° C dans un bain d’eau de 25 ° C. Infecter les cellules S2 * avec DCV à MOI = 0,01 immédiatement en ajoutant directement 1 mL de solution antivirus pour les récipients de culture cellulaire (zone de croissance : 55 cm2) avec 10 mL de milieu complet pour cellules de S2.
    3. Incuber les cellules à 25 ° C pendant 3 à 5 jours. Lorsque le virus est prêt pour la collecte, la morphologie cellulaire est anormale (forme des cellules semble flou) et le milieu de culture est rempli de particules noires indicatives de débris cellulaires.
    4. Percevoir la culture de cellules entières dans un tube de 15 mL par pipetage de haut en bas et congeler à-80 ° C (pour un an).
      Remarque : DCV peut être stocké pendant de longues périodes de temps à-80 ° C avec une perte minimale d’infectiosité, jusqu'à un an.
    5. Décongeler la culture de cellules dans un bain d’eau de 25 ° C sous agitation constante et puis centrifuger à 6 000 x g pendant 15 min à 4 ° C. Récupérer le surnageant dans un tube stérile de 15 mL et vortex. Aliquote jusqu'à 200 μl de solution de virus par tube.
      Remarque : Les aliquotes de Virus peuvent être stockés pendant de courtes périodes jusqu'à 3 jours à 4 ° C et jusqu'à 1 an à-80 ° C. Il faut éviter les cycles de gel-dégel répétés. Il est toujours préférable d’utiliser tous l’aliquote à la fois.
    6. Choisir 5 tubes aléatoires contenant des virus, de déterminer la dose infectieuse de la culture de tissus de virus moyenne (dict50) par un test de l’effet cytopathogène (ECP) (1 unité de TCID50= 0,7 plaque formant unité [PFU]).
      NOTE : CPE fait référence aux changements structurels causés par l’invasion virale des cellules hôtes. Le virus infectant provoque la lyse de la cellule hôte, ou lorsque la cellule meurt sans lyse en raison de l’incapacité de reproduire48.
      1. Le jour 1, prélever des prêts S2 * cellules de pipetage. Compter le nombre de cellules. Centrifuger les cellules pour 300 g x 4 min et éliminer le surnageant. Diluer les cellules à la densité de 1 x 106 cellules/mL avec support complet pour les cellules S2 * comme indiqué au point 1.1.1.
      2. 1 x 105 S2 de graines * (100 μL) des cellules par puits à fond plat 96-puits-plaque (confluence de ~ 30 %).
      3. Effectuer des dilutions 10 fois du stock DCV avec milieu complet pour cellules de S2. Ajouter 50 dilutions µL dans le puits. Ajouter 50 µL de milieu de culture sans virus dans le puits classé comme contrôle négatif bien.
        Remarque : Pour chaque taux de dilution, 8 puits ont été utilisés. Que le rendement DCV typique est environ 108-109 UFP/mL, la dilution doit couvrir au moins 10 ~-5-10-10.
      4. Jour 4, observez le CPE avec un microscope en champ lumineux avec un 20 X ou 40 X objectif. Classer un puits dans lequel les cellules semblent floues et le milieu est plein des fragments comme un « bien positif » et un puits dans lequel la morphologie cellulaire est normale comme « bien négative ».
      5. Puits de Mark CPE positives ou négatives avec + ou –, respectivement. Calculer le virus TCID50 par la méthode de Reed et Muench49.
    7. Éliminer les matières contaminées et les gants dans le bac de décontamination. Si le virus ne peut pas atteindre le désiré TCID50, concentrer 100 mL de solution de virus par centrifugation à 68 000 x g pendant 1 h à 4 ° C.
      Remarque : selon le but de l’expérience, une gamme de doses de 102 à 10 unités de6 dict50 peut être utilisé pour l’infection par le virus. En général, nous utilisons 3 x 106 dict50 unités.
    8. Jeter le surnageant et remettre en suspension dans 1 mL de tampon Tris-HCl (10 mM, pH 7,2). Aliquoter 20 μL de la solution antivirus par tube et conserver à-80 ° C. Choisir 5 tubes aléatoires pour déterminer la moyens virus TCID50 encore une fois.
  2. Préparation pour l’infection de voler
    Remarque : Les bactéries symbiotiques Wolbachia peuvent supprimer beaucoup de genres d’infection de virus à ARN chez les insectes30,31,32,33,41. Ainsi, il est essentiel de purger Wolbachia de mouches, avant d’étudier l’hôte-virus infection in vivo33.
    1. Préparer les aliments mouche contenant la tétracycline en ajoutant 400 μL de 50 tétracycline µg/mL (dans l’éthanol à 70 %) à 4 g de semoule de maïs frais standard mouche nourriture (1 L de nourriture contient 77,7 g de semoule de maïs, 32,19 g de levure, 10,6 g d’agar, 0,726 g de CaCl2 31,62 g de saccharose, 63,3 g de glucose, 2 g de sorbate de potassium et 15 mL de 5 % C8H8O3). Bien mélanger et enfourner à 4 ° C pendant la nuit s’évapore à l’éthanol.
      NOTE : Une forte dose d’éthanol peut affecter la fertilité de mouche, donc n’omettez ne pas cette étape.
    2. Réchauffer les aliments à température ambiante et mettre nouvellement éclos les mouches adultes (20 femmes et 10 hommes) dans le flacon. Se reproduisent les mouches à 25 ° C, 60 % d’humidité sous un cycle lumière/obscurité normal.
      Remarque : En règle générale, il faut 3-4 jours pour les mouches à pondre suffisamment. Trop d’oeufs inhibent le développement des larves et diminuent l’efficacité de la tétracycline.
    3. Recueillir nouvellement éclos les mouches adultes (moins de 3 ~ 5 jours) sous un flux lumineux de CO2et répétez l’étape ~ 1.2.1-1.2.2. En règle générale, au moins trois générations sont nécessaires pour éliminer complètement de Wolbachia.
    4. Après 3 générations avec traitement tétracycline, recueillir 5 vole sous un flux lumineux de CO2 pour l’essai d’infection de Wolbachia . Moudre les mouches pendant 1 min avec 250 μL d’eau bidistillée (ddH2O) et quelques billes en céramique stériles de 0,5 mm dans un tube de 1,5 mL à l’aide d’un homogénéisateur. Ajouter un autre 250 μL de x 2 tampons A (0,2 M Tris-HCl, pH 9,0 ; 0,2 M EDTA ; 2 % SDS) dans l’échantillon et le vortex.
      Remarque : Étant donné que le SDS n’entravera le mouvement de la perle, 1 x tampon A directement inutilisable pour moudre des mouches. Si les mouches ont les yeux rouges, enlever les têtes avant broyage, car il peut influencer la couleur du produit de l’ADN.
    5. Congeler les échantillons à-80 ° C (donjon pour aller jusqu'à un an). Décongeler rapidement le l’échantillon de-80 ° C dans un bain d’eau de 25 ° C jusqu'à dissolution. Incuber les échantillons à 70 ° C pendant 30 min.
    6. Ajouter 190 μl de 5 M KACO, vortex et incuber sur la glace pendant 15 min ou plus.
    7. Centrifuger les échantillons à 13 000 x g pendant 5 min à température ambiante, recueillir le surnageant et de les transférer dans de nouveaux tubes.
    8. Répétez l’étape 1.2.7 pour obtenir l’ADN avec une meilleure qualité.
    9. Ajouter 750 μL d’isopropanol dans chaque échantillon et retourner doucement plusieurs fois à la main. Incuber à température ambiante pendant 5 min.
    10. Centrifuger les échantillons à 13 000 x g pendant 5 min à température ambiante et éliminer le surnageant. Le granule d’ADN génomique blanc restera au fond du tube.
    11. Ajouter 1 mL d’éthanol à 70 % pour les pellets, centrifuger à 13 000 x g pendant 5 min et éliminer le surnageant. Sécher l’ADN jusqu'à ce qu’il devienne transparent.
    12. Dissoudre l’ADN dans 100 μL de ddH2O, titrer la concentration d’ADN par spectrophotométrie d’absorption UV-Vis et diluer l’ADN à 100 ng/μL.
    13. Utilisation 200 ng d’ADN pour la réaction PCR (dans un système de 20 μL, voir la Table des matières). Effectuer la PCR par le programme suivant : 95 ° C pendant 15 min ; cycle 36 de 95 ° C pour 45 s, 50 ° C pour 45 s et 72 ° C pendant 1 minute ; et une étape finale extension (72 ° C pendant 1 min) dans un thermocycleur.
      Remarque : Selon l’ARNr 16 s de Wolbachia, utiliser les amorces suivantes : 5' TGAGGAAGATAATGACGG 3' (avec impatience) et 5' CCTCTATCCTCTTTCAACC 3' (marche arrière). Pour les FSSF, les amorces ont été 5' CATTGGTGTTGGTGTTGGTG 3' (avec impatience) et 5' ACCGAAATAACGAGCTCCAG 3' (marche arrière).
    14. Analyser les produits PCR par électrophorèse sur gel d’agarose à 1 %. La taille du produit PCR de Wolbachia 16 s rRNA et wsp est autour de 200 bp et 600 bp, respectivement.
    15. Arrière de Wolbachia gratuit stock mouche sur la nourriture mouche de semoule de maïs standard. Collecter 3-5 jour nouvellement éclos mâle vole pour l’infection.
      NOTE : Traitement tétracycline peut également affecter la composition microbiote intestinal, qui influence par la suite des réponses antivirales chez l’hôte. Nous recommandons que toutes les mouches devraient recevoir les mêmes traitements de tétracycline. Garder les mouches Wolbachia libres de plus en plus dans des conditions normalisées au moins 3 générations restaurer le microbiote intestinal.
  3. Génotypage de le Pastrel
    Remarque : La présence de l’allèle S ou R du gène pst dans le bagage génétique a signalé d’affecter DCV chez Drosophila34,35. Il est nécessaire de vérifier le génotype pst , surtout pour l’infection de DCV. Il y a quelques SNP en pst qui peuvent affecter les infection par le virus, le SNP major est 512 C/T. Le gradient de température PCR est une méthode rapide pour identifier le génotype pst .
    1. Extrait de voler l’ADN génomique tel que décrit ci-dessus (étape 1.2.4 - 1.2.15).
    2. Utilisez 100 ng d’ADN comme le modèle, l’amorce de 512C, 5' CAGCATGGTGTCCATGAAGTC 3' (avec impatience) et 5' ACGTGATCAATGCTGAAAGT 3' (revers) pour détecter l’allèle R, l’amorce de la 512T, 5' CAGCATGGTGTCCATGAAGTT 3' (avec impatience) et 5' ACGTGATCAATGCTGAAAGT 3' (revers) pour détecter la Allèle S.
    3. Définissez les gradients Tm (température de fusion) comme suit : 54 ° C, 54,7 ° C, 55,5 ° C, 58 ° C, 59,7 ° C, 62,2 ° C, 63,7 ° C et 64 ° C (45 s à chacune des températures).
      Remarque : 30 cycles de PCR PCR sont recommandés (système de 20 μL).
    4. Visualiser le produit PCR de 100 pb par électrophorèse sur gel d’agarose à 2 %.

2. virose chez la drosophile

  1. Infectent les mouches par nano-injection et effectuer des essais de survie.
    1. Tirez les capillaires pour préparer les aiguilles à injection, remblayer l’injection avec de l’huile d’aiguille et monter l’injecteur décrite précédemment50.
    2. Anesthésier les mouches sur le pavé sous un flux lumineux de CO2. Inoculer les mouches par injection intra-thoracique44 de 50,6 nL de solution antivirus (PFU 100, dilué dans un tampon Tris-HCl, pH 7,2). Injecter au moins 3 fioles de mouches (20 mouches par flacon).
      Remarque : L’injection est beaucoup de temps (généralement 100 mouches / heure) et la réplication DCV est très rapide, il est donc très important de noter l’heure exacte sur le tube de finition une fois chaque flacon (20 mouches). Tampon seule injection est définie comme un contrôle de simulacre. Habituellement, les mouches adultes mâles sont préférables, car les résultats sont plus stables et reproductibles que lorsque vous utilisez les femmes puisque les variations hormonales au cours de l’accouplement et la reproduction peuvent influencer la lecture de femelles51.
    3. Cultiver le mouches injectées à 25 ° C, 60 % d’humidité sous un cycle lumière/obscurité normal. Fournir des mouches avec des aliments frais tous les jours et noter le nombre de mouches mortes.
    4. Effectuer au moins 3 réplicats biologiques et tracer la courbe de survie.
    5. Pour l’analyse statistique des données de survie, générer des courbes de survie de Kaplan-Meier de logiciel statistique. Effectuer le test de Mantel-Haenzel pour calculer les valeurs de P. Sur la table de survie, entrer des données pour chaque sujet. Ensuite, le logiciel calcule le pourcentage de survie à chaque fois et parcelles d’un terrain de survie de Kaplan-Meier.
      Remarque : N’ajoutez pas de levure supplémentaire dans le flacon. Par rapport aux fausses témoins, mouches infectées par DCV occasionnellement ont une ascite et sont maladroits, qui les rendent vulnérables à la levure collante. Il est préférable d’enregistrer plusieurs points dans le temps dans l’expérience préliminaire pour découvrir un laps de temps au cours de laquelle la mort massive va arriver pour les mouches infectées. En règle générale, les mouches infectées meurent rarement dans les deux premiers jours, même pour les lignées mutantes Dcr-2 . Pour le Wolbachia gratuit w1118 (Bloomington 5905) mouche infectée avec 100 PFU de DCV, cette fenêtre de temps est environ 3-5 jours après l’infection. Les mouches des fruits qui meurent dans les heures de 0,5 h post injection ne devraient pas être comptées comme une fatalité car ils peuvent être tuées par blessure d’aiguille pas par une infection virale.
  2. DCV charger mesure par dosage CPE
    Remarque : La charge virale est mesurée de la même façon au titrage du stock virus (étape 1.1.6) mais exige la préparation d’échantillons supplémentaires (étape 2.2.1-2.2.4).
    1. Jour 1, infectent les mouches mâles comme décrit dans l’étape 2.1.1-2.1.2. Groupe de mouches injectées par groupes de 20 et gardez-les poussant sur des aliments frais de mouche pour la durée souhaitée (en général pour 24h ou 3 jours). Fournir des mouches avec des aliments frais tous les jours.
    2. Jour 2, semences Drosophila S2 * cellules dans une boîte de Petri de cellulaire de 10 cm à la densité d’environ 5 x106 à 1 x 107 cellules/mL comme indiqué au point 1.1.1.
    3. Le jour 3, recueillir 5 mouches (sous un léger flux de CO2) et moudre dans un tube à centrifuger 1,5 mL pour 30 s avec 200 μl de tampon Tris et perles en céramique à l’aide de homogénisateur. Stocker les échantillons à-80 ° C ou procéder immédiatement à l’étape suivante.
    4. Vortex soigneusement l’échantillon. Utiliser une seringue de 1 mL et 0,22 μm à filtre le surnageant dans un nouveau tube de 1,5 mL. Poursuivre le titrage, tel que décrit dans les étapes 1.1.6.1-1.1.6.5.
  3. Charge DCV mesurée par qRT-PCR
    1. Jour 1, infectent les mouches comme décrit ci-dessus. Groupe injecté mâle vole (20 mouches/groupe) et poussent sur des aliments frais de mouche pour la durée souhaitée, généralement pour 24h ou 3 jours. Fournir des mouches avec des aliments frais tous les jours.
    2. Le jour 3, recueillir 5 mouches sous un flux lumineux de CO2 dans un tube de 1,5 mL avec 200 μl de tampon de lyse et 20 perles en céramique (diamètre = 0,5 mm), moudre les échantillons de homogénisateur à haute vitesse pendant 30 s. ajouter 800 μL de tampon de lyse supplémentaire dans chaque tube et conservez le s amples à-80 ° C, soit immédiatement procéder à extraire l’ARN et qRT-PCR.
    3. Préparer les bouts libres de RNase, tubes et diéthylpyrocarbonate (DEPC) traités et 0,22 µm membrane filtré l’eau désionisée. Ajouter 200 μl de chloroforme (≥99. 5 %) dans l’échantillon et vigoureusement agiter pendant 15 s à la main. Incuber pendant 5 min ou plus à température ambiante jusqu'à ce que la phase aqueuse et la phase organique sont clairement séparées.
      Remarque : Chloroforme est extrêmement dangereux et doit être manipulé avec soin. Ne pas vortexer l’échantillon, ce qui augmentera le risque de contamination de l’ADN.
    4. Centrifuger les échantillons à 13 000 x g pendant 15 min à 4 ° C.
    5. 400 ml du surnageant de collecter et transférer le liquide surnageant dans de nouveaux tubes. Mélanger avec le même volume isopropanol (≥ 99,5 %), retourner doucement les échantillons pour 20 fois à la main et ensuite précipité pendant 10 min ou plus à température ambiante.
      Remarque : Les précipitations à-20 ° C augmenteront rendement RNA.
    6. Centrifuger les échantillons à 13 000 x g pendant 10 min à 4 ° C. RNA White pellets sont visibles au fond du tube.
    7. Jeter le surnageant et ajouter 1 mL d’éthanol à 70 % (éthanol dans l’eau DEPC) et inverser à quelques reprises pour laver l’ARN.
    8. Centrifuger les échantillons à 13 000 x g pendant 5 min à 4 ° C. Jeter le surnageant et sec ARN pendant 5-10 min ; RNA doit devenir transparent.
    9. Ajouter 50 μL d’eau DEPC à l’échantillon, la pipette pour quelques fois et vortex.
    10. Prenez 3 μL d’ARN pour la titration de la concentration en ARN. Quantifier l’ARN à 260 nm. Normalement, la concentration en ARN extraite par le présent protocole est environ de 100 à 500 μg/μL, qui convient pour la synthèse de cDNA.
    11. Utilisation 2 μg d’ARN pour la synthèse de cDNA. Diluer l’échantillon de 100 μL avec FD2O et conserver à-20 ° C.
    12. Procédez qRT-PCR selon les instructions du fabricant et exécutez qRT-PCR.
      Remarque : Pour la synthèse de cDNA de DCV, amorces aléatoires a travaillé beaucoup mieux que l’apprêt Poly A dans nos mains. Expression de l’ARNm DCV est normalisée à la protéine ribosomal endogène 49 (rp49) mRNA. Les amorces utilisées dans cette partie : rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (avec impatience) et 5' CACCAGGAACTTCTTGAATCCGG 3' (revers) ; DCV, 5' TCATCGGTATGCACATTGCT 3' (avec impatience) et 5' CGCATAACCATGCTCTTCTG 3' (revers) ; Vago, 5' TGCAACTCTGGGAGGATAGC 3' (avec impatience) et 5' AATTGCCCTGCGTCAGTTT 3' (revers) ; Viro-induite RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (avec impatience) et 5' GATTACAGCTGGGTGCACAA 3' (marche arrière).

Representative Results

Résultats de la présente section sont obtenus après l’infection DCV de d. melanogaster. La figure 1 montre l’organigramme de l’infection virale chez la drosophile. Les mouches sont injectées intra-thoracically, et ensuite les échantillons sont prélevés pour la mesure de la virale TCID50 et le niveau de RNA de génome (Figure 1). Infection par le virus peut provoquer la lyse cellulaire et ECP n’est observé à 3 jours après l’infection (Figure 2 a). La charge virale mesurée par le dosage de la CPE est conforme à celle mesurée par qPCR (Figure 2 b). Comme illustré à la Figure 3, Wolbachia inhibe l’infection DCV chez la drosophile. amorces WOL-l’ARNr 16 s et les FSSF sont utilisés pour détecter la présence de Wolbachia (Figure 3 a) et de Wolbachia-mouches gratuits montrent une baisse significative de la survie après l’infection DCV (Figure 3 b). Figure 4 illustre comment vérifier pst polymorphisme par gradient PCR utilisant des amorces spécifiques. Figure 5 illustre dose effets dépendants de l’infection de DCV chez la mouche de type sauvage. Le taux de survie dans la Figure 5 a et le virus de charge à 3 jours après l’infection est illustrée à la Figure 5 b. La figure 6 montre que l’infection DCV peut activer l’antiviral Dcr2/Arni et JAK/STAT signalisation dans l' hôte52. Le niveau d’expression de l’expression de vago de Dcr2/RNAi voie du gène rapporteur est élevée 3 jours après l’infection (Figure 6 a). La voie de JAK-STAT est également activée sur infection DCV, ce qui est indiquée par le niveau d’expression de gène de journaliste vir-1 (Figure 6 b). La figure 7 montre que la voie Dcr2/Arni est critique pour infection antivirale chez Drosophila52. DCR-2 mouches mutantes ont un taux de diminution de la survie (Figure 7 a) et une charge accrue de virus (Figure 7 b) après l’infection de DCV.

Figure 1
Figure 1 : organigramme de l’infection de la drosophile et analyse des charges virus.
Établissement de Drosophila infection par nano-injection. Le diagramme de schéma montre que les mouches sont infectés intra-thoracically et que la charge virale sont mesurés par le dosage de la CPE et qRT-PCR. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Analyse des charges DCV.
La charge virale mesurée par le dosage de la CPE est conforme à celle mesurée par qPCR. (A) cellules de S2 sont cultivées à 25 ° C pendant 3 jours avec une dilution de virus différents (50 μL). 1 unité TCID50 du virus utilisé est 4,29 x 109 (équivalent à 3 x 109 UFP/mL). Première table ronde, 10-3 dilution ; deuxième panel, 10-7 dilution ; troisième table ronde, 10-10 dilution ; panneau arrière, sans infection. Cellules en groupe 1 et 2 montrent le phénotype typique de positif CPE (flèches blanches indiquent les débris cellulaires), et cellules de groupe 3 et 4 montrent le phénotype typique de négatif. La barre d’échelle est indiquée dans les chiffres. (B) mesure de DCV charger de qPCR. Effectuer des dilutions successives 10 fois du DCV et infecter la lignée de cellules S2 *. L’ARN total des cellules infectées est extrait et qPCR est effectué afin de mesurer le niveau de l’ARN DCV. Gradient infectieuses la charge virale (déterminée par dosage CPE) dans les cellules est mis en correspondance et positivement associée à la mesure de qPCR (r2= 0,999). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Infection virale des mouches avec ou sans Wolbachia.
Infection de Wolbachia contribue à la résistance de DCV chez la drosophile. (A) le Wolbachia présence est détectée par les amorces wol-l’ARNr 16 s et des FSSF . G1, G2 et G3 représenté Orermouches (Oregon-R) (Bloomington 5) traitement par tétracycline pour un, deux ou trois générations respectivement. La taille de produit PCR est autour de 200 bp (wol-16 s rRNA) et 600 bp (wsp). (B) Wolbachia gratuits mouches sont plus sensibles à l’infection de DCV. 3-5 jours vieux les mouches adultes mâles sont injectées avec 100 PFU de DCV. Wolbachia gratuit vole (lignes pleines) voir réduite de façon significative de la survie que de Wolbachia protégé vole (lignes de tableau de bord) sur l’infection DCV. Deux lignes différentes de type sauvage, minerai,r et w1118, sont utilisés pour l’analyse de la survie et montrent résultat similaire. Toutes les barres d’erreur représentent l’erreur standard (s.e.) d’au moins trois essais indépendants ; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, non significatif. Kaplan-Meier (B). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Pastrel génotypage par PCR dégradé.
polymorphisme de PST est vérifiée par PCR dégradé. PCR dégradé est réalisé pour distinguer pst R (512 C) et l’allèle S (512T) chez la drosophile adulte. Gradients de TM sont a: 54 ° C, b : 54,7 ° C, c: 55,5 ° C, d: 58 ° C, e: 59,7 ° C, f: 62,2 ° C, g : 63,7 ° C, h : 64 ° C.  S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : Taux de survie et DCV titre de minerair mouches infectées avec une dose différente de DCV.
Orermouches sont injectées avec trois différentes doses du DCV, 10 PFU/mouche, PFU/fly 50 et 100 PFU/mouche. (A) les taux de survie des mouches sont significativement plus faible quand infecté avec des doses plus élevées infectieuses. (B) le niveau DCV RNA dans l’ensemble des corps de mouches indiquées sont mesurée par qRT-PCR à l’heure indiquée et normalisée à celle du groupe d’inoculation PFU/fly 10. Toutes les barres d’erreur représentent l’erreur standard (s.e.) d’au moins trois essais indépendants ; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, non significatif. Kaplan-Meier (A) ou anova à (B). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : Dcr2/Arni et antiviral JAK/STAT signalisation activée après l’infection de DCV.
Orermouches étaient infectés par 100 PFU de DCV. Vago (A) et l’ARNm de vir-1 (B) exprimée dans le corps entier sont mesurés par qRT-PCR au temps indiqué points après l’infection. Le changement d’expression est normalisé à celle du niveau de base avant l’infection. Toutes les barres d’erreur représentent l’erreur standard (s.e.) d’au moins trois essais indépendants ; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, non significatif. ANOVA à (A, B). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 7
Figure 7 : Dcr-2 mutante mouche sensible à l’infection de DCV.
DCR-2 mutant vole et son contrôle génétique w1118 mouches étaient infectés par 100 PFU de DCV. (A) les taux de survie des Dcr-2 mouches déficientes et des mouches de type sauvage (w1118) après l’infection de DCV. (B) DCV RNA niveau dans l’ensemble du corps de mouches indiquées est mesurée par qRT-PCR 2 jours après l’infection et normalisée à celle de w1118. Toutes les barres d’erreur représentent l’erreur standard (s.e.) d’au moins trois essais indépendants ; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0,0001, ns, non significatif. Kaplan-Meier (A) ou test T (B) de student. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Discussion

Dans cet article, nous présentons une procédure détaillée sur la façon d’établir un système infectieux viral chez l' adulte Drosophila melanogaster à l’aide de nano-injection. Les protocoles comprennent la préparation de lignes mouches appropriées et stock de virus, techniques d’infection, l’évaluation des indicateurs infectieux et la mesure de la réponse antivirale. Bien que DCV est utilisé comme un exemple d’un virus pathogène, des dizaines de différents types de virus ont été avec succès appliquées pour étude dans le système de la drosophile. En outre, des centaines de facteurs de régulation, de virus ou de l’hôte, ont été identifiés grâce à un dépistage à grande échelle chez les mouches. Ainsi, cette méthode est très adaptable et ne se limite pas au DCV / interaction dedrosophile .

Pour propager et récolter le titre élevé DCV avec succès, quelques précautions doivent être prises. Les cellules doivent être sains, cultivées à une densité convenable et récoltée à l’heure. Réduire le volume de la culture cellulaire n’affecte pas significativement titre de virus. En règle générale, 107 cellules infectées par DCV à MOI = 0,01 sera finalement le rendement de près de8-10 109 TCID50 de DCV, qui peut répondre aux exigences de la plupart des expériences in vivo et in vitro . Le dosage de la CPE et qRT-PCR assay sont décrites dans le présent protocole pour la mesure de la charge virale. Le dosage de la CPE est quelque peu délicat. La densité appropriée d’inoculation de cellules et une norme expérimentée de discrimination positive/négative à CPE permettent un dosage rapide et réussi de CPE. Ainsi, nous fournissons une simple qRT-PCR assay ici pour aider à déterminer le seuil de dilution dosage CPE avant de maîtriser le dosage de la CPE.

Cependant, DCV est un virus très puissant pour la mouche adulte et la lignée de cellules de drosophile . Seulement 100 PFU/mouche inoculation peut tuer 50 % de mouches sauvages dans les 5 jours. Une dose excessive de l’infection peut occulter l’importance entre les lignes sensibles de type sauvage, mouche et potentiels. Il est important d’appliquer au moins deux doses d’infection lors de l’initialisation d’un nouvel écran. Puisque la mort massive de drosophile peut arriver dans une fenêtre de temps très court en raison de la létalité élevée de DCV, enregistrant le nombre de décès plus fréquemment dans des expériences préliminaires est fortement recommandé. Après infection DCV, quelques mouches ont parfois le syndrome de l’ascite. Notamment, les mouches qui meurent après l’infection 0,5 h doivent être exclues, qui pourrait résulter de blessures injection aiguille inappropriée.

La force infectieuse du DCV est aussi influencée par plusieurs facteurs de l’hôte, qui doivent être considérés avant de commencer une expérience. Wolbachia est une verticale transmettre endosymbiote qui a un grand impact sur l’infection par le virus le mouches32. Traitement de tétracycline dans les aliments mouche est une méthode courante utilisée pour éliminer l’infection de Wolbachia . Toutefois, cette méthode modifie également le microbiote intestinal composition, qui peut-être à leur tour affecter la réponse antivirale53. Quelques études ont souligné l’importance de la variance génétique sur l' infection à virus36, tels que l’ubc-e2h, cg8492 et pst. Par exemple, la plupart volée de type sauvage lignes ont pst S allèle et sont sensibles aux virus picorna semblable, tandis que la plupart des lignes mutantes nous avons testé du centre stock Bloomington ont pst R allèle, ainsi ayant des phénotypes résistants. Il est très important d’exclure l’impact du pst, surtout quand la présélection d’un gène de résistance comparant avec contrôle de type sauvage29.

En plus de nano-injection d’induire infection virale systémique, les autres méthodes sont disponibles afin d’étudier l’infection par le virus chez les mouches. Lignées cellulaires Drosophila se sont avérés être une méthode de haut-débit pour écarter les infection par le virus associés hôte composant cellulaire37,38. Toutefois, un système in vitro est toujours accompagné d’un taux élevé de faux positifs, lors de la confirmation in vivo. DCV peut également être appliquée pour infecter les Drosophila oralement, alors qu’il peut seulement déclencher une infection restreinte et plus douce. Seulement 20 % des larves ont été infectés dans les 12 h et de 14 % de mortalité a été observée, avec seulement 25 % de mortalité dans les 20 jours chez les adultes vole22. Piquer les mouches avec des épingles de 0,15 mm de diamètre est un autre moyen de définir une infection virale, mais il ne peut assurer la dose exacte de l’infection et la répétabilité quantitative. Surexprimant des protéines virales par manipulation génétique chez les mouches est un bon moyen d’étudier l’interactomes moléculaire in vivo7. Toutefois, il ne peut pas représenter la réalité de la physiologie et la pathologie chez l’hôte à l’infection. Pendant ce temps, la méthode de nano-injection a aussi des inconvénients, car il n’est pas la voie naturelle de l’infection et peut stimuler directement une solide système immunitaire réponse juste après l’infection, qui a contourné la cuticule, la première ligne de défense antivirale. En somme, le but spécifique de recherche et les conditions expérimentales disponibles sont les facteurs décisifs dans le choix entre différentes méthodes.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous tenons à remercier le laboratoire Pan entier en IPS. CAS. Nous remercions m. Lanfeng Wang (IPS, CAS) pour assistance expérimentale et Dr Gonalo Cordova Steger (nature Springer), Dr. Jessica VARGAS (IPS, Paris) et m. Seng Zhu (IPS, Paris) pour commentaires. Ce travail a été soutenu par des subventions du programme de recherche stratégique prioritaire de l’Académie chinoise des Sciences à L.P (XDA13010500) et Haddad (XDB29030300), la Fondation nationale des sciences naturelles de Chine L.P (31870887 et 31570897) et Jean-Yves (31670909). L.P est membre de l’Association de Promotion de l’Innovation des jeunes CAS (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics