שימוש בהעברת אנרגיה פלורסצנטיות תהודה חוץ גופית ללמוד את הדינמיקה של חלבון מתחמי בקנה מידה הזמן אלפיות השנייה

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

אינטראקציות חלבון-חלבון קריטי עבור מערכות ביולוגיות, מחקרים של קינטיקה איגוד לספק תובנות הדינמיקה והתפקוד של מתחמי חלבון. אנו מתארים שיטה מכמת את הפרמטרים קינטי של חלבון מורכב באמצעות קרינה פלואורסצנטית והעברת אנרגיה תהודה הטכניקה זרימה עצר.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

חלבונים הן חברות הסלולר העיקרי של מערכות ביולוגיות, הם בדרך כלל לקיים אינטראקציה עם אחרים מאקרו או מולקולות קטנות כדי לבצע תפקודים ביולוגיים שלהם. אינטראקציות כזה יכול להיות מאוד דינמיים, כלומר subunits שמעצבת כל הזמן משויך, חלופה מועדפת בשיעורים מסוימים. בעוד מדידה של זיקה מחייבת שימוש בטכניקות כגון הנפתח כמותיים חושף את עוצמת האינטראקציה, לומד את קינטיקה איגוד מספק תובנות על איך מהר האינטראקציה מתרחשת, כמה זמן כל מתחם יכולה להתקיים. יתר על כן, מדידה של קינטיקה של אינטראקציה בנוכחות גורם נוסף, כגון פקטור המרת חלבון או סם, מסייע לחשוף את המנגנון שבאמצעותו האינטראקציה מוסדר על ידי הגורם השני, מתן ידע חשוב עבור קידום מחקר ביולוגי ורפואי. כאן, אנו מתארים את פרוטוקול למדידת קינטיקה של איגוד של קומפלקס החלבונים יש שיעור גבוה האגודה מהותי, יכול להיות חלופה מועדפת במהירות על ידי חלבון אחר. השיטה משתמשת העברת אנרגיה של קרינה פלואורסצנטית תהודה לדווח היווצרות של המתחם חלבון במבחנה, והוא מאפשר ניטור של דיסוציאציה של המתחם בזמן אמת על fluorimeter זרימה הפסיק וארגון מהר. שימוש assay הזה, הם לכמת את קבועי קצב דיסוציאציה וארגון של החלבונים.

Introduction

פעילויות ביולוגיות בסופו של דבר תבוצענה על ידי חלבונים, ביותר אשר אינטראקציה עם אחרים עבור תפקודים ביולוגיים נאותה. שימוש בגישה חישובית, הסכום הכולל של אינטראקציות חלבון-אנוש מוערך ~ 650,0001, שיבוש אינטראקציות אלה לעיתים קרובות מוביל מחלות2. עקב תפקידיהם חיוני בשליטה הסלולר תהליכים organismal, פותחו שיטות רבות ללמוד אינטראקציות חלבון-חלבון, כגון שמרים-שני-היברידית, קומפלמנטציה פלורסצנטיות ריאקציה דו-מולקולרית, פיצול-לוציפראז קומפלמנטציה ו- co-immunoprecipitation assay3. בעוד ששיטות אלה טובים גילוי ולאשר אינטראקציות חלבון-חלבון, הם בדרך כלל שאינם כמותיים, ובכך לספק מידע מוגבל לגבי הזיקה בין בני הזוג חלבון אינטראקציה. השפעה כמותית-דאונס יכול לשמש כדי למדוד את זיקה מחייבת (למשל, קבוע דיסוציאציה Kd), אבל זה לא למדוד את קינטיקה של האיגוד, ולא ניתן להחיל אותה כאשר Kd נמוכה מאוד עקב לקוי יחס אות לרעש4. פלזמון משטח תהודה (SPR) ספקטרוסקופיה מכמת את קינטיקה מחייב, אך זה דורש על משטח ספציפי בטקטיקות של מגיבים אחד על פני השטח, אשר פוטנציאל תוכל לשנות את המאפיין איגוד של מגיב5. יתר על כן, קשה למדוד דיסוציאציה המחירים5וארגון מהר SPR, וזה לא ראוי לעשות שימוש SPR לאפיין את האירוע של החלפת החלבוניות בתוך קומפלקס החלבונים. כאן, אנו מתארים שיטה המאפשרת מדידת שיעור של חלבונים מורכבים הרכבה ופירוק בקנה מידה הזמן אלפיות השנייה. שיטה זו היתה חיונית לצורך קביעת התפקיד של Cullin - ssociated -Nedd8 -dissociated חלבון 1 (Cand1)כמו F-box חלבון exchange גורם6,7.

Cand1 מסדיר את הדינמיקה של Skp1•Cul1•F-תיבת חלבון (SCF) E3 ligases, אשר שייכת למשפחה גדולה של Cullin-טבעת אוביקוויטין ligases. SCFs מורכב cullin Cul1, אשר נקשר החלבון תחום טבעת Rbx1, ולא של חלבון F-box להחלפה, אשר מגייס סובסטרטים ומאגד Cul1 דרך החלבון מתאם Skp18. E3 ליגאז, SCF מזרז את ההטיה של אוביקוויטין את המצע שלה, וגם זה מופעל כאשר המצע הוא גויס על ידי החלבון F-box, וכאשר Cul1 משתנה על ידי החלבון אוביקוויטין דמוי Nedd89. Cand1 נקשר Cul1 שלא שונתה, על הכריכה, זה משבש גם איגוד חלבון Skp1•F-box עם Cul1 וגם את ההטיה של Nedd8 Cul110,11,12,13. כתוצאה מכך, Cand1 שנראה מעכב פעילות SCF במבחנה, אבל חוסר Cand1 אורגניזמים גרם פגמים שמרמז תפקיד חיובי של Cand1 בוויסות פעילות SCF vivo14,15,16 , 17. פרדוקס זה הוסבר בסופו של דבר על ידי מחקר כמותי שגילה את האינטראקציות דינמי בין חלבון Cul1, Cand1 ו Skp1•F-box. באמצעות קרינה פלואורסצנטית תהודה אנרגיה העברה (סריג) מבחני המאתרות את היווצרות מתחמי SCF ו- Cul1•Cand1, שיוך של דיסוציאציה לדרג קבועים (k- ו kחופש, בהתאמה) היו נמדד בנפרד. המדידות חשפו כי הן Cand1 והן Skp1•F-תיבת חלבון טופס הדוק ביותר מתחם עם Cul1, אבל את kהנחה של SCF מתגברת באופן דרמטי על ידי Cand1, kהנחה של Cul1•Cand1 הוא גדלו דרמטית. על ידי Skp1•F-תיבת חלבון6,7. תוצאות אלה מספקים את התמיכה הראשונית וקריטיים להגדרת תפקידו של Cand1 כגורם exchange חלבון, אשר מזרז היווצרות של מתחמי SCF חדש באמצעות מיחזור Cul1 מ מתחמי SCF הישן.

כאן, אנו מציגים את ההליך של פיתוח ושימוש וזמינותו סריג ללמוד את הדינמיקה של מורכבות Cul1•Cand17, ניתן להחיל את אותו עיקרון ללמוד את הדינמיקה של מולקולות שונות. סריג מתרחשת כאשר תורם הוא מתרגש עם הגל המתאים, מקבל עם ספקטרום עירור חפיפה ספקטרום הפליטה תורם קיים למרחק של 10-100 Å. המדינה נרגשת מועבר מקבל, ובכך להקטין את עוצמת התורם, הגדלת עוצמת מקבל18. היעילות של קשת/קשתית (E) תלוי רדיוס פורסטר (R0) והן את המרחק בין התורם ואת מקבל fluorophores (r), מוגדר על-ידי: E = R06/ (R0 6 + r6). רדיוס פורסטר (R0) תלויה במספר גורמים, כולל כיוון זוויתי דיפול, החפיפה ספקטרלי של הזוג מקבל התורם, והפתרון היה19. למרוח וזמינותו סריג fluorimeter עצר-flow, אשר מפקח על השינוי של הפליטה תורם בזמן אמת ומאפשר מדידות של מהיר k- ו kאת, זה הכרחי ליצור סריג יעיל זה תוצאות לירידה משמעותית של פליטת התורם. לכן, עיצוב סריג יעיל על-ידי בחירת הזוג המתאים של צבעי פלורסנט, ואתרים על החלבונים היעד כדי לצרף את צבע חשוב, יידונו ב פרוטוקול זה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. עיצוב וזמינותו סריג.

  1. הורד את הקובץ מבנה של Cul1•Cand1 מורכבות מ בנק מידע החלבונים (קובץ 1U6G).
  2. הציגו את המבנה של Cul1•Cand1 מתחם PyMOL.
  3. השתמש בפונקציה מדידה תחת התפריט אשף של PyMOL כדי להעריך את המרחק בין החומצה אמינית הראשון של Cand1 חומצת אמינו האחרונה ביותר של Cul1 (איור 1).
  4. לטעון את הצופה ספקטרה באינטרנט (ראה טבלה של חומרים) ולהציג את עירור ועל ספקטרום הפליטה של 7-אמינו-4-methylcoumarin (AMC) ו- FlAsH בו זמנית (איור 2). שימו לב כי AMC התורם סריג, פלאש הוא מקבל סריג.

Figure 1
איור 1: מבנה הגביש Cul1•Cand1 מדידה של המרחק בין הפוטנציאל תיוג אתרים- הקובץ מבנה קריסטל הייתה שהורדו מ בנק מידע החלבונים (קובץ 1U6G), צפו ב PyMOL. מידות בין אטומים שנבחר נעשו על-ידי PyMOL. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: עירור של ספקטרום הפליטה של צבעי פלורסנט עבור קשת/קשתית. ספקטרום של AMC (7-אמינו-4-methylcoumarin) ו- FlAsH מוצגים. קווים מקווקווים מציינים את עירור ספקטרה, קווים אחידים מציינים ספקטרום הפליטה. התמונה נוצר במקור על ידי SpectraViewer-ידי קרינה פלואורסצנטית ולשנות עבור בהירות יותר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

2. הכנת Cul1AMC•Rbx1, החלבון התורם סריג

  1. לבנות פלסמידים לביטוי האנושי •Rbx1sortaseCul1 בתאים e. coli . שימו לב כי פלסמידים 2 שיתוף לבטא Cul1•Rbx1 האנושי בתאים e. coli מתוארים בפירוט הדוח הקודם20.
    1. להוסיף רצף ה-DNA קידוד "LPETGGHHHHHH" (sortase-שלו6 תג) 3' סוף Cul1 רצף קידוד באמצעות תקן ה-PCR ושיטות השיבוט21,22.
    2. רצף של פלסמיד חדש כדי לאשר תותב ג'ין הוא מדויק.
  2. שיתוף אקספרס Cul1 •Rbx1sortaseבתאים e. coli . השיטה נגזרת של הדוח הקודם20.
    1. Ng לערבב 100 כל של פלסמידים 2 עם BL21 (DE3) תאים כשיר מבחינה כימית לשינוי שיתוף באמצעות החום לחשמל שיטת23. לגדל תאים בצלחת אגר LB המכיל אמפיצילין µg/mL 100 ו µg 34/mL כלורמפניקול ב 37 מעלות צלזיוס למשך הלילה.
    2. לחסן 50 מ של תרבות ליברות עם מושבות טרי טרנספורמציה ולגדול בן לילה ב 37 ° C עם סל"ד 250 רועדת. זה נותן תרבות starter.
    3. לחסן 6 מבחנות, כל אחד עם 1 ליטר של מדיום ליברות, עם 5 מ"ל starter תרבות כל ולגדול ב 37 ° C עם סל"ד 250 לרעוד עד ה OD600 ~ 1.0. מגניב התרבות עד 16 ° C ולהוסיף איזופרופיל-β-D-thiogalactoside (IPTG) 0.4 מ מ. שמור את התרבות ב 16 ° C בלילה עם סל"ד 250 רועדת.
    4. הקציר התאים e. coli באמצעות צנטריפוגה ב x 5,000 g למשך 15 דקות ולאסוף תא כדורי צינורות חרוט 50 מ.
      הערה: כדורי תא יעובד לטיהור חלבון או להיות קפוא ב-80 מעלות צלזיוס לפני שממשיכים לשלבים טיהור חלבון.
  3. טיהור של •Rbx1sortaseCul1 מורכבים. שיטה זו נגזרת של הדוח הקודם20.
    1. להוסיף 50 מ של פירוק מאגר (30 מ מ טריס-HCl, 200 מ"מ NaCl, 5 מ מ DTT, 10% גליצרול, 1 טבליה של מעכב פרוטאז קוקטייל, pH 7.6) בגדר של e. coli תאים לבטא Cul1sortase•Rbx1.
    2. Lyse התאים על הקרח עם sonication-משרעת 50%. לסירוגין שניה אחת ON ו- OFF שניה אחת ולרוץ 3 דקות.
    3. חזור על שלב 2.3.2 x 2-3.
    4. להעביר את התא lysate לתוך צינור 50-mL צנטריפוגה ולהסיר את שאריות תאים על ידי צנטריפוגה ב x 25,000 g למשך 45 דקות.
    5. דגירה התא ברורה lysate 5 מ של גלוטתיון חרוזים ב 4 מעלות צלזיוס במשך שעתיים.
    6. Centrifuge את התערובת חרוזים-lysate ב x 1,500 g למשך 2 דקות ב 4 º C. הסר את תגובת שיקוע.
    7. לשטוף את החרוזים עם 5 מ של פירוק מאגר (עם מעכבי פרוטאז לא) ולהסיר את תגובת שיקוע לאחר צנטריפוגה ב 1,500 x g למשך 2 דקות ב 4 º C.
    8. חזור על שלב 2.3.7 2 x.
    9. להוסיף 3 מ"ל של פירוק מאגר החרוזים שטף ולהעביר את slurry חרוז לתוך עמודה ריקה.
    10. הוסף 5 מ של מאגר • תנאי (50 מ"מ טריס-HCl, 200 מ"מ NaCl, 10 מ מ מופחת גלוטתיון, pH 8.0) לתוך העמודה. תקופת דגירה של 10 דקות ולאסוף את eluate.
    11. חזור על שלב 2.3.10 x 3-4.
    12. להוסיף 200 µL של תרומבין 5 מ"ג/מ"ל (ראה טבלה של חומרים) eluate של החרוזים גלוטתיון דגירה בין לילה ב 4 º C.
      הערה: הפרוטוקול אפשר לעצור כאן.
    13. לדלל את הדגימה חלבון עם מאגר A (25 מ מ HEPES, 1 מ"מ DTT, גליצרול 5%, pH 6.5) פי שלושה.
    14. Equilibrate עמודה כרומטוגרפיה קטיון (ראה טבלה של חומרים) על מערכת FPLC עם מאגר א
    15. לטעון את המדגם חלבון לעמודה כרומטוגרפיה equilibrated קטיון בספיקה 0.5 mL/min.
    16. Elute החלבון עם שיפוע של NaCl ב- 40 מ"ל על ידי ערבוב מאגר A ו- 0 עד 50% B מאגר (25 מ מ HEPES, 1 M NaCl, 1 מ"מ DTT, גליצרול 5%, pH 6.5) בספיקה 1 mL/min.
    17. בדוק את החלבון eluted בחלקים שונים באמצעות מרחביות-עמוד24.
      הערה: הפרוטוקול אפשר לעצור כאן.
    18. בריכת שברים eluate המכיל Cul1sortase•Rbx1.
    19. לרכז את Cul1sortase•Rbx1 הדגימה במאגר כדי 2.5 מ ל ע י העברת המאגר דרך קרום אולטראפילטרציה (הקיצוץ 30 kDa).
  4. להוסיף AMC קצה קרבוקסילי של Cul1 דרך transpeptidation בתיווך sortase21,22.
    1. לשנות את המאגר במדגם •Rbx1sortaseCul1 אל המאגר sortase (50 מ מ טריס-HCl, 150 מ מ NaCl, 10 מ מ CaCl2, pH 7.5) משתמש בעמודה desalting (ראה טבלה של חומרים).
      1. Equilibrate עמודה desalting 25 מ ל מאגר sortase.
      2. לטעון 2.5 מ ל Cul1sortase•Rbx1 מדגם לתוך העמודה. למחוק את הזרימה דרך.
      3. Elute הדגימה עם 3.5 מ של מאגר sortase. לאסוף את הזרימה דרך.
    2. ב- µL 900 של הפתרון •Rbx1sortaseCul1 במאגר sortase, להוסיף 100 µL של 600 מיקרומטר מטוהר sortase A פתרון ו 10 µL של 25 מ מ GGGGAMC פפטיד. דגירה תערובת התגובה ב 30 מעלות צלזיוס ב הלילה האפל. הערה שלב זה יפיק Cul1AMC•Rbx1.
      התראה: צבעי פלורסנט רגישים אור, כדי להימנע לחשוף אותם תאורת במהלך הכנת חלבון ולדגום כמה שיותר.
      הערה: הפרוטוקול אפשר לעצור כאן.
    3. להוסיף תערובת התגובה µL 50 של ני-נ agarose חרוזים, דגירה בטמפרטורת החדר למשך 30 דקות.
    4. גלולה Ni-נ agarose חרוזים על ידי צנטריפוגה ב x 5,000 g למשך 2 דקות ולאסוף את תגובת שיקוע.
    5. Equilibrate גודל אי-הכללה של כרומטוגרפיה עמודה (ראה טבלה של חומרים) עם מאגר (30 מ מ טריס-HCl, 100 מ מ NaCl, 1 מ"מ DTT, 10% גליצרול) על מערכת FPLC.
    6. לטעון את כל Cul1 שלAMCמדגם •Rbx1 על העמודה כרומטוגרפיה של אי-הכללה של גודל. Elute עם 1.5 x בעמודה כמות המאגר.
    7. בדוק את השברים eluate על ידי מרחביות-עמוד24.
    8. בריכה שברים eluate המכיל Cul1AMC•Rbx1.
    9. למדוד את ריכוז חלבון באמצעות ספיגת שלה ב 280 ננומטר עם ספקטרופוטומטרים.
    10. Aliquot הפתרון חלבון וחנות ב-80 מעלות צלזיוס.
      הערה: הפרוטוקול אפשר לעצור כאן.

3. הכנת פלאשCand1, החלבון מקבל סריג

הערה: רוב השלבים בחלק זה הם אותו דבר כמו בשלב 2. תנאים שונים מתוארים בפירוט בהמשך.

  1. לבנות את פלסמיד לביטוי האנושי Cand1 TetraCysבתאים e. coli .
    1. הוסף את רצף ה-DNA קידוד "CCPGCCGSG" (tetracysteine/TetraCys תג) לפני 15th חומצת אמינו ביותר של Cand1 באמצעות PCR רגיל25 (פריימר רצפים: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. הכנס את המוצר PCR וקטור pGEX-4T-2. רצף של פלסמיד כדי לאשר תותב ג'ין הוא מדויק, מסגרת.
  2. אקספרס TetraCysCand1in e. coli תאים באותו אופן כשלב 2.2, חוץ מזה פלסמיד הוא הופך תאים המוסמכת רוזטה.
  3. טיהור של TetraCysCand1 את התאים e. coli .
    1. Lyse כדורי תא החיידק ולחלץ TetraCysCand1using גלוטתיון חרוזים. השלבים זהים שלבים 2.3.1–2.3.12.
    2. לדלל את eluate חלבון מ החרוזים גלוטתיון עם מאגר C (50 מ מ טריס-HCl, 1 מ"מ DTT, גליצרול 5%, pH 7.5) על ידי שלושה קיפולים. Equilibrate עמודת כרומטוגרפיה של exchange אניון (ראה טבלה של חומרים) על מערכת FPLC עם מאגר C וטעינה הדגימה חלבון מדולל בספיקה 0.5 mL/min.
    3. Elute החלבון עם שיפוע של NaCl ב- 40 מ"ל על ידי ערבוב מאגר C ו- 0 עד 50% D מאגר (50 מ מ טריס-HCl, 1 M NaCl, 1 מ"מ DTT, גליצרול 5%, pH 7.5) בספיקה 1 mL/min. בדוק את החלבון eluted בחלקים שונים באמצעות מרחביות-דף24ולאחר בריכה שברים המכיל TetraCysCand1. שימו לב כי TetraCysCand1 נפח שמירה גדול יותר מאשר GST חינם.
    4. לרכז את הדגימה Cand1 TetraCysבמאגר על-ידי העברת המאגר דרך קרום אולטראפילטרציה (הקיצוץ 30 kDa).
    5. Equilibrate את העמודה כרומטוגרפיה אי-הכללה של גודל עם מאגר תיוג (20 מ"מ טריס-HCl, 100 מ מ NaCl, 2 מ מ. TCEP, 1 מ"מ EDTA, 5% גליצרול) על מערכת FPLC. לטעון מדגם TetraCysCand1 (500 µL בכל פעם) וסמנו שברים eluate מרחביות-עמוד24.
    6. בריכה כל השברים המכיל TetraCysCand1 ולרכז החלבון מיקרומטר ~ 40 ע י העברת המאגר דרך קרום אולטראפילטרציה (הקיצוץ 30 kDa). מעריכים את ריכוז חלבון באמצעות ספיגת שלה ב 280 ננומטר. לאחסן את החלבון כמו 50 aliquots µL ב-80 מעלות צלזיוס.
      הערה: הפרוטוקול אפשר לעצור כאן.
  4. הכנת Cand1 פלאש.
    1. להוסיף 1 µL של פתרון פלאש (ראה טבלה של חומרים) לפתרון Cand1 TetraCysµL 50.
    2. מערבבים היטב, דגירה התערובת בטמפרטורת החדר בחושך 1-2 h לקבל Cand1 פלאש.
      הערה: הפרוטוקול אפשר לעצור כאן.

4. הכנת Cand1, החלבון צ'ייס סריג

הערה: פרוטוקול הכנה חלבון דומה בשלב 3, עם השינויים הבאים.

  1. הכנס את רצף קידוד של Cand1 באורך מלא וקטור pGEX-4T-2.
  2. לשנות את המאגר המשמש בשלב 3.3.5 למאגר המכיל 30 מ מ טריס-HCl, 100 מ מ NaCl, 1 מ"מ DTT, 10% גליצרול.
  3. לחסל את השלבים 3.3.7 ו 3.3.8.

5. לבדוק ולאשר וזמינותו סריג

  1. הכנת המאגר סריג המכיל 30 מ מ טריס-HCl, 100 מ מ NaCl, 0.5 מ מ DTT, אובלבומין 1 מ"ג/מ"ל, pH 7.6, ולהשתמש בטמפרטורת החדר.
  2. מבחן על סריג בין Cul1AMC•Rbx1, פלאשCand1 על fluorimeter.
    1. ב- µL 300 מאגר סריג, להוסיף Cul1AMC•Rbx1 (סריג התורם) כדי ריכוז סופי של 70 ננומטר. להעביר את הפתרון cuvette.
    2. מקם את cuvette בעל מדגם fluorimeter. לרגש את הדגימה עם 350 nm עירור אור ולסרוק את האותות פליטה מ- 400 nm 600 nm ב במרווחים 1 ננומטר.
    3. חזור על שלב 5.2.1 אבל שינוי Cul1 •Rbx1AMCכדי Cand1 פלאש(סריג מקבל). סרוק את הדגימה Cand1 FlAsHבאמצעות אותה שיטה כמו שלב 5.2.2.
    4. (אופציונלי) לרגש את Cand1 פלאשבאור עירור 510 ננומטר, וסרוק את האות פליטה בין 500 nm 650 ננומטר.
    5. במאגר 300 µL סריג, להוסיף שתי Cul1AMC•Rbx1 ו- Cand1 פלאשכדי ריכוז סופי של 70 ננומטר. לנתח את הדגימה באותו אופן כמו שלב 5.2.2.
  3. לאשר את סריג בין Cul1AMC•Rbx1, פלאשCand1 על-ידי הוספת החלבון צ'ייס (ללא תווית Cand1) (איור 3C).
    1. ב- µL 300 מאגר סריג, להוסיף 70 nM Cul1AMC•Rbx1 ו 700 nM Cand1. סרוק את הפליטה מדגם כמו שלב 5.2.2.
    2. ב- µL 300 מאגר סריג, להוסיף 70 nM Cand1 פלאשו 700 nM Cand1. סרוק את הפליטה מדגם כמו שלב 5.2.2.
    3. ב- µL 300 מאגר סריג, להוסיף 70 nM Cul1AMC•Rbx1 ו-70 ננומטר פלאשCand1, דגירה המדגם בטמפרטורת החדר במשך 5 דקות. לאחר מכן להוסיף 700 nM Cand1, מיד לאחר התוספת, סריקה הפליטה מדגם כמו שלב 5.2.2). שימו לב כי שלב זה דומה לשלב 5.2.5.
    4. במאגר 300 µL סריג, ברצף להוסיף 70 nM Cul1AMC•Rbx1, 700 nM Cand1, ו- 70 nM Cand1 פלאש. דגירה המדגם בטמפרטורת החדר במשך 5 דקות, ולאחר סרוק הפליטה מדגם כמו שלב 5.2.2. שים לב כי זוהי הדוגמה צ'ייס (הקו הירוק באיור 3C).

6. למדוד קבוע קצב האגודה (k-) Cul1•Cand1

הערה: פרטים של ההפעלה fluorimeter זרימה הפסיק תואר בשנת הדוח הקודם26.

  1. היכונו fluorimeter זרימה עצר את המדידה.
    1. הפעל את fluorimeter זרימה עצר לפי הוראות היצרן.
    2. להגדיר את עירור אור 350 nm, וכן שימוש מסנן הלהקה-pass המאפשר 450 nm פליטת האור לעבור וחוסם 500-650 nm פליטת אור.
    3. לשמור את השסתומים מדגם במיקום למלא וחבר מזרק 3 מ ל מים. לשטוף מדגם שני מזרקים (A ו- B) עם מים על-ידי הזזת את הכונן מזרק מדגם לאורך מספר פעמים. למחוק את כל המים בשימוש בשלב זה.
    4. לשמור את השסתומים מדגם במיקום למלא וחבר מזרק 3 מ"ל מלא מאגר סריג. לשטוף את מזרקים מדגם שני עם המאגר סריג על-ידי הזזת את הכונן מזרק מדגם לאורך כמה זמן. למחוק את כל המאגר סריג המשמש בשלב זה.
  2. קח שליטה מדידה (איור 4C).
    1. התחבר מזרק 3 מ"ל, לטעון את המזרק A עם 100 ננומטר Cul1AMC•Rbx1 במאגר סריג. להפוך את השסתום דוגמה למיקום כונן .
    2. התחבר מזרק 3 מ"ל, לטעון B מזרק עם המאגר סריג. להפוך את השסתום דוגמה למיקום כונן .
    3. השתמש בלוח הבקרה תחת ידרשו בתוכנה לקחת חמש יריות (לערבב נפח שווה של דגימות מן המזרק A ו- B מזרק) על fluorimeter זרימה עצר ללא הקלטה את התוצאות.
    4. פתח את לוח הבקרה תחת ידרשו בתוכנה, תוכנית להקליט את פליטת Cul1AMC יותר מ-60 s. אז לקחת ירייה אחת.
    5. חזור על שלב 6.2.4 2 x.
    6. להפוך את השסתום מדגם למיקום למלא . לרוקן את המזרק B, לשטוף עם המאגר סריג.
  3. מדד נצפתה האגודה קצב קבועים (kobs) של Cul1•Cand1 (איור 4B).
    1. לשמור את הדגימה במזרק A כמו שלב 6.2.1.
    2. להתחבר מזרק 3 מ"ל ולטעון B מזרק עם 100 ננומטר Cand1 פלאשבמאגר סריג. להפוך את השסתום דוגמה למיקום כונן .
    3. השתמש בלוח הבקרה תחת ידרשו בתוכנה כדי לקחת חמש יריות ללא הקלטה את התוצאות.
    4. פתח את לוח הבקרה תחת ידרשו בתוכנה, תוכנית להקליט את פליטת Cul1AMC יותר מ-60 s. אז לקחת ירייה אחת.
    5. חזור על שלב 6.3.4 2 x.
    6. לרוקן את המזרק B, לשטוף עם המאגר סריג.
    7. חזור על צעדים 6.3.1–6.3.6 מספר פעמים עם הגדלת ריכוזים של פלאשCand1 במאגר סריג.
    8. להתאים את השינוי (ירידה) אותות פלואורסצנט נמדד לאורך זמן של כל זריקה לעקומה מעריכית יחיד. זה ייתן kobsבמדידה כל, יחידת s-1. שימו לב כי הבסיס של חישוב זה טוב נדון הדוח הקודם27.
  4. לחשב את הממוצע, סטיית התקן של kobsבכל ריכוז Cand1 פלאשבשימוש. להתוות את הממוצע kobsכנגד ריכוז Cand1 (איור 4D) ומייצג השיפוע של הקו k- של Cul1•Cand1, עם יחידת ז-1 s-1.

7. למדוד את קצב קבוע דיסוציאציה (k.) של Cul1•Cand1 בנוכחות של חלבון Skp1•F-box.

הערה: השלב זה דומה לשלב 6, עם השינויים הבאים.

  1. במזרק A, תחת המיקום למלא , לטעון פתרון של 100 ננומטר Cul1AMC•Rbx1 ו- 100 ננומטר Cand1 פלאשבמאגר סריג. להפוך את השסתום מדגם למיקום "נסיעה".
  2. מזרק ב', תחת המיקום למלא , לטעון פתרון של Skp1•Skp2 (שהוכן בעקבות הדוח הקודם20). להפוך את השסתום מדגם למיקום "נסיעה".
  3. פתח את לוח הבקרה תחת ידרשו בתוכנה, תוכנית להקליט את פליטת Cul1AMC מעל גיל 30 s. אז לקחת ירייה אחת. אותות פלואורסצנט להגדיל לאורך זמן לאחר ערבוב פתרונות של מזרק A ו- B מזרק (איור 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כדי לבדוק את סריג בין Cul1AMC , פלאשCand1, קבענו לראשונה את עוצמת הפליטה של 70 nM Cul1AMC (התורם) ו- 70 nM Cand1 פלאש(מקבל), בהתאמה (איור 3 אקווים-C, כחול). כל ניתוח, רק פסגה אחת פליטה היה נוכח, ולא את פליטת Cand1 פלאש(מקבל) היה נמוך. כאשר 70 nM כל של Cul1AMC , Cand1 פלאש, מעורבים כדי ליצור סריג, שתי הפסגות פליטה היו קיימות ב- ספקטרום הפליטה, ואת שיא של Cul1AMC הפך נמוך הפסגה של פלאשCand1 הפך גבוה יותר (איור 3A קווים -C, אדום). כאשר Cand1 באורך מלא שימש סריג, הפסגה התורם הראו הפחתה 10% בעוצמת (איור 3A, אדום קו), וכאשר Cand1 עם סליל הראשון שלה נחתך שימש, ההפחתה של התורם שיא עוצמת הוגדל ל 30% (איור 3B -D, קווים אדומים), רומז סריג יעילות גבוהה יותר. כדי לאשר השינויים אות היו נבעה סריג בין Cul1AMC , פלאשCand1, 70 nM Cul1AMC (התורם) היה מעורב עם 700 nM ללא תווית Cand1 (צ'ייס) ו 70 nM Cand1 פלאש(מקבל). כתוצאה מכך, הפסגה התורם שוחזר במלואו, הפסגה מקבל היה ירד (איור 3C, הקו הירוק), אשר אישר כי סריג שנצפה תלויה היווצרות של Cul1AMCפלאשCand1 קומפלקס. הוספת 700 nM Skp1•Skp2 •AMCnM Cul1 70 Cand1פלאשושוחזר לגמרי גם הפסגה התורם (קואיור תלת-ממד, ירוק), רומז כי המתחם Cul1•Cand1 מלא הופרעו על ידי Skp1•Skp2 ב שיווי משקל.

Figure 3
איור 3: סריג נציג וזמינותו של היווצרות מורכבות Cul1•Cand1. הדגימות במאגר קשת/קשתית (30 מ"מ טריס-HCl, 100 מ מ NaCl, 0.5 מ מ DTT, אובלבומין 1 מ"ג/מ"ל, pH 7.6) היו נרגשים-350 nm, את פליטת נסרקו מ- 400 nm 650 ננומטר. (א) ספקטרום הפליטה של 70 nM Cul1AMC, 70 nM פלאשCand1 (מלאות), תערובת של השניים (דאגה). Cand1 (מלאות) ופירושה באורך מלא Cand1. (B) ספקטרום הפליטה של 70 nM Cul1AMC, 70 nM Cand1 פלאש, תערובת של השניים (דאגה). Cand1 עם סליל הראשון שלה נמחק נעשה שימוש בניסוי זה ולאחר מכן. (ג) ספקטרום הפליטה של 70 nM Cul1AMC, 70 nM פלאשCand1, תערובת של השניים (דאגה), ולרדוף הבקרה עבור קשת/קשתית (צ'ייס). המדגם צ'ייס הכיל 70 nM Cul1AMC, 700 nM Cand1 ו-70 ננומטר Cand1 פלאש. (ד) ספקטרום הפליטה של 70 nM Cul1AMC, תערובת של 70 nM Cul1AMC ו- 70 nM Cand1 פלאש(סריג) ולאחר 700 nM Skp1•Skp2 הוסיף אל המתחם •פלאשCand1 70 nM Cul1AMC. כל מגרש, האותות פליטה היו מנורמל ל הפליטה של 70 nM Cul1AMC ב 450 ננומטר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

כדי למדוד k- של Cul1•Cand1 באמצעות וזמינותו סריג הוקמה על ידי ניטור ההפחתה של האות תורם לאורך זמן על fluorimeter זרימה עצר, קודם נבדק ואנו נחוש את הריכוז של חלבון כדי לשמש. כאשר 5 nM כל של Cul1AMC פלאשCand1 שימשו, מעט מאוד שינוי אות נצפתה (איור 4A), ואילו, כאשר הריכוז של כל חלבון הוגדל ל- 50 ננומטר, ההפחתה של האות לאורך זמן נצפתה ( איור 4B) ואת השינוי בוטלה אם המאגר ללא פלאשCand1 נוספה (איור 4C). לכן, 50 ננומטר Cul1AMC שימש עוד יותר ניתוחים, סדרה של האגודה שנצפה שיעור קבועים (kobs) נמדדו על ידי ערבוב 50 ננומטר Cul1AMC עם הגדלת ריכוזי Cand1 פלאש. kobs עבור ניסוי חושבה על-ידי הזזת הנקודות לעקומה מעריכית יחיד, kobs המתקבל ריכוז Cand1 פלאשזהה היו בממוצע. על-ידי התוויית הממוצע kobs עם ריכוז Cand1 וביצוע של רגרסיה ליניארית (איור 4D), k- היה נחוש7,27.

Figure 4
איור 4: מדידה נציג האגודה קצב קבוע. (א) ידי קרינה פלואורסצנטית 5 nM Cul1AMC היה בפיקוח של fluorimeter זרימה הפסיק לאורך זמן על תוספת של 5 nM Cand1 פלאש. (B) ידי קרינה פלואורסצנטית של 50 ננומטר Cul1AMC היה בפיקוח של fluorimeter זרימה הפסיק לאורך זמן על תוספת של 50 ננומטר Cand1 פלאש. (ג) ידי קרינה פלואורסצנטית של 50 ננומטר Cul1AMC היה בפיקוח של fluorimeter זרימה הפסיק לאורך זמן על תוספת של המאגר סריג. (ד) k- עבור איגוד Cand1 כדי Cul1. kobs של Cul1•Cand1 בריכוזים שונים של Cand1 מותווים. מדרון ליניארי נותן k של 1.8 x 107 ז-1 s-1. קווי שגיאה מייצגים ±SEM; n = 4. כל הדגימות היו מוכנים במאגר סריג ונרגשת -350 ננומטר. מסנן לעבור הלהקה שימש כדי לאסוף אותות AMC ולהשמיט אותות של פלאש. אין נתונים היו מנורמל. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

בדומה המידה של k-, מדדנו קבוע קצב דיסוציאציה שנצפה Cul1•Cand1 על-ידי ניטור העלייה (שחזור) של האות תורם לאורך זמן על fluorimeter זרימה עצר. Cul1AMC , פלאשCand1 היו מעורבים קודם ולאחר מכן נוספו Skp1•Skp2 Cul1 preassembledAMCפלאשCand1 על fluorimeter זרימה עצר. האות התורם גדל במהירות, הוא חשף את kobs של 0.4 s-1 (איור 5). לעומת זאת, כאשר מאגר נוסף של Cul1 preassembled •AMCCand1פלאש, אין עלייה אות נצפתה, רומז על דיסוציאציה מהיר של Cul1•Cand1 נגרם על-ידי Skp1•Skp2.

Figure 5
איור 5: נציג מדידה של קצב קבוע דיסוציאציה. בשינוי קרינה פלואורסצנטית התורם לעומת הזמן נמדד בעקבות תוספת של 150 nM Skp1•Skp2 או המאגר סריג 50 ננומטר Cul1AMCפלאשCand1 מתחם. שהאות משנה היו מתאימים לעקומה מעריכית יחיד, זה נותן קבוע דיסוציאציה שנצפו בשיעור של 0.4 s-1. תנאי הניסוי היו דומה לזו המתוארת באיור4. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

סריג הוא תופעה פיזיקלית זה עניין רב בלימוד והבנה של מערכות ביולוגיות19. כאן, אנו מציגים עבור בדיקה ושימוש סריג ללמוד את איגוד קינטיקה של שני חלבונים שמעצבת פרוטוקול. בעת עיצוב סריג, שקלנו שלושה גורמים עיקריים: ספקטרלי החפיפה בין התורם פליטה, מקבל עירור, המרחק בין את fluorophores שני, כיוון דיפול fluorophores28. כדי לבחור את fluorophores על סריג, אנחנו בשכבות עירור של ספקטרום הפליטה של fluorophores ולאחר חיפשו fluorophores פיקס פליטה של מי מופרדים היטב בזמן ספקטרום הפליטה של התורם באופן משמעותי חופף עירור ספקטרום של מקבל (איור 2). כדי למטב את interfluorophore המרחק והכיוון, השתמשנו למבנה הגבישי לקבלת סיוע, בעיקר שקלנו הצמדת fluorophores טרמיני חלבון, בעיקר בשל הסיכון הנמוך של לשבש את מבנה החלבון ופעילות. כי המרחק בין N-הסופית של Cand1 (Cand1NTD), על קצה קרבוקסילי של Cul1 (Cul1CTD) קצר יותר המרחק בין C-הסופית של Cand1 את קצה אמיני של Cul1 (איור 1), החלטנו לשים תווית Cand1NTD , Cul1CTD. כי היינו יכולים להשיג 80% – 90% יעילות תיוג של N-הסופית של חלבון באמצעות תג tetracysteine25, בחרנו להביא את תווית Cand1NTD עם פלאש באמצעות התג tetracysteine. בתחילה סיווגנו את Cul1CTD עם חלבון פלואורסצנטי ציאן (CFP), שבו יש כמה יתרונות על פני AMC. קודם כל, זה תגית פלורסנט מקודדים גנטית, אז זה לא דורש תהליך תיוג נוספים ולא השלבים לטהר החלבון הניאון שכותרתו מ מבשר שלה ללא תווית. שנית, CFP הוא בהיר יותר AMC, לפיכך, הוא מציע וזמינותו רגישות גבוהה יותר (ראה דיון להלן). שלישית, CFP יש ספקטרום גדול חפיפה עם פלאש, פוטנציאל מניב סריג יעיל יותר עם פלאש. עם זאת, למרות היתרונות הללו, CFP חלבון הוא הרבה יותר גדול מאשר התג AMC, אשר עלולים להפריע את קונפורמציה חלבון ואת האינטראקציה הבין-מולקולרי. אכן, לא נתבונן אל סריג בין Cul1CFP , פלאשCand1 הבדיקה שלנו, אשר, ככל הנראה עקב התמצאות דיפול לקוי, או שיבוש האינטראקציה Cul1-Cand1 על ידי התג CFP. ואז סיווגנו את Cul1CTD עם AMC, ראינו סריג בין Cul1AMC , Cand1 פלאש. הראשונית סריג שימוש Cand1 באורך מלא הובילה 10% צמצום הפליטה התורם (איור 3 א). עוד מצאנו כי על-ידי מחיקת את הסליל הראשון של Cand1, המרחק בין Cul1 לבין Cand1 מתקצר מ- 26.8 Å ל 15.5 Å (איור 1), Cand1 חסר את הסליל הראשון הניב הרבה סריג חזק עם Cul1, מציג 30% צמצום הפליטה התורם שיא (איור 3B). בנוסף, אחד עשוי לשפר את היעילות סריג על-ידי בחירה תורם fluorophore עם תשואה גבוהה יותר קוונטית fluorophore מקבל עם מקדם הכחדה גדולה יותר.

תכונה אופיינית של סריג זה סריג מתרחש, הפליטה של ירידות התורם, הפליטה של עליות מקבל (איור 3B). עם זאת, fluorophores עשוי להציג רגישות לסביבה שלהם, לכן, עוצמת הפליטה עשויים להשתנות כאשר קיים חלבון אחר, אפילו בהיעדר סריג29. כדי לוודא הפליטה שהשתנו הבחנו עקב סריג בין Cul1AMC , פלאשCand1, הוספנו 10 x סכום עודף של חלבון מקבל תווית (Cand1) כמו מרדף. המרדף ממירה את הפליטה של התורם ובחזרה מקבל רמת נורמלי (איור 3C), אשר תומכת זה את פליטת ששונו של Cul1AMC ואת Cand1 פלאש, תלוי אינטראקציית חלבון-חלבון, ולכן, תוצאה זו . מאשר כי הקמנו וזמינותו של סריג מדווח על האגודה ועל דיסוציאציה של Cul1•Cand1... יתר על כן, הוספנו Skp1•Skp2 Cul1 preassembled מתחם •פלאשCand1AMC, Skp1•Skp2 ידוע היכולת לשבש את האינטראקציה של Cul1-Cand16. . מצאנו את זה על סריג בין Cul1AMC פלאשCand1 נעלם (דמות תלת-ממד, הקו הירוק) והפך ספקטרום הפליטה הדומה ספקטרום הפליטה של המדגם צ'ייס (איור 3C, ירוק קו), רומז •AMCCul1 Cand1פלאשהיא חלופה מועדפת על-ידי Skp1•Skp2 Cul1AMC לא יציג פליטה חריג כאשר Skp1•Skp2 קיים.

על-ידי ניטור בשינוי התורם פליטה, ניתן להבחין ישירות את העמותה ואת דיסוציאציה של Cul1AMCפלאשCand1 על fluorimeter זרימה עצר. מערכת הזרימה הפסיק עובד על ידי הזרקת המגיבים לתא ערבוב במהירות לערבב שני המגיבים, והפסקת הזרם ברגע מעורבים שני המגיבים מועברים לתוך הקאמרית התבוננות5. זיהוי האות מתחיל בדרך כלל 1-2 מילי-שניות (ms) לאחר ערבוב, אשר מאפשר ללמוד האינטראקציות המתרחשות בציר אלפיות השנייה. עם זאת, כאשר מחצית החיים של התגובה שנצפה הוא קצר יותר מאשר הזמן הנדרש כדי לערבב שני המגיבים בהתקן מסוים, גישה זו אינה רגישה מספיק ואינו מתאים30. ניתוח תזרים הפסיק שימשו לקביעת קבועי קצב החל 10-6–106 s-1 עבור תגובות מסדר ראשון, ו- 1 – 109 ז-1 s-1 עבור תגובות מסדר5. כדי לקבל מדידה אמין של הפרמטרים קינטי משתמש fluorimeter זרימה עצר את, נחוץ שינוי משמעותי של האות פלורסנט בין נקודות החל ואיזון. השתמשנו Cand1 פלאששל חסר את הסליל הראשון בתור מקבל, כי זה מניב יותר סריג עם Cul1AMC, ואנחנו נבדק ריכוז החלבונים כדי לשמש למדידה. כאשר 5 nM כל של Cul1AMC , פלאשCand1 היו מעורבים, לא חל שינוי Cul1 אותAMC נצפתה (איור 4A), רומז ריכוז זו אינה מספיקה עבור המידה. כאשר ריכוז חלבון היו גדל ל- 50 ננומטר, הירידה Cul1AMC אות לאורך זמן הפכה לכאורה (איור 4B), שינוי זה אינו מתרחש כאשר החלבון מקבל היה נעדר (איור 4C). בהתבסס על תוצאה זו, השתמשנו Cul1AMC ב 50 ננומטר concertation למדוד k- Cul1•Cand1. ריכוז החלבון התורם המשמש למדידה יכול להשתנות כאשר משמשים fluorophores שונים. לדוגמה, כאשר Cul1 נקראת עם CFP, 5 nM של CFPCul1 מספיקה עבור המידה של k-6. לכן, ריכוז אופטימלי של החלבון צריך להיבדק עבור כל זוג סריג, בעקרון, fluorophores בהיר יותר לאפשר שימוש ריכוז חלבון נמוך יותר ולספק יחס אות לרעש טוב יותר31.

ללמוד אינטראקציות חלבון על ידי סריג, זה דורש צירוף fluorophores חלבונים ומעמדות המתאים מבלי להפריע את מבנה החלבון ופעילות, אשר פוטנציאל מגביל את השימוש סריג. פרוטוקול זה, סיווגנו את קצה אמיני של Cand1 באמצעות תג tetracysteine, הכורך במיוחד לצבוע פלאש, לצבוע פלאש הופך פלורסנט רק אחרי זה מאגד את חלבון המטרה32. . סיווגנו את Cul1 באמצעות בתיווך sortase transpeptidation, אשר מייחסת פפטיד קצר נושא של fluorophore על תג sortase ב C-הסופית של21,Cul122. היעילות תיוג היא > 80% עם התגית tetracysteine, כמעט 100% עם התגית sortase לו6 לאחר הסרת החלבון unreacted באמצעות Ni-נ חרוזים (צעדים 2.4.3–2.4.4). שתי השיטות להוסיף כמה חומצות אמינו חלבון המטרה, היכרות עם שינויים מינימליים במבנה חלבון. גישות דומות, כגון transglutaminase זיהוי רצף (Q-תג)33 ו- תג ' ybbR '34, יכול לשמש גם כדי לתייג את חלבון המטרה באופן ספציפי לאתר. בנוסף, פוטוסטביליטי של צבעי פלורסנט יכול גם להגביל את השימוש סריג. חוזרות או זמן חשיפה לאור עירור יכול להוביל photobleaching של fluorophore, וכתוצאה מכך כימות לא מדויק תוצאות35. לכן, התורם ואת מקבל החלבונים צריכים להיות מוגנים מפני אור במהלך השלבים להכנת ואחסון. כאשר משתמש סריג למדידת אירועים שמתרחשים לאט, במקום וניטור שוטף בשינוי התורם פליטה לאורך זמן, קריאות קצר של הפליטה התורם יילמד במרווחי זמן ארוך יותר, המדגם צריך להישמר בחושך במהלך כולו ניסוי6.

מכיוון סריג הוא רגיש ולא כמותית, הוא הפך כלי חשוב ללמוד את האינטראקציה בין מקרומולקולות. פרוטוקול זה מציג דוגמה לשימוש סריג ללמוד את הדינמיקה של החלבונים בתמיסה. סריג שימש גם יחד עם התא חי הדמיה ללמוד אינטראקציות מולקולרית חי תאים36, אשר חזקה חושפים את הדינמיקה של חלבון מתחמי בתנאים פיזיולוגיים. יתר על כן, סריג יכול לשמש גם ברמת מולקולה בודדת כדי ללמוד את הדינמיקה בזמן אמת של קומפלקסים macromolecular37,38, לספק תובנות לגבי השינוי הסתגלותי של המתחם. כדי לשפר את היעילות ואת גילוי של סריג, fluorophores ביולוגיים עם משופרת בהירות, פוטוסטביליטי עניין רב, אשר מתוכננים באופן פעיל ולמד28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

אנו מודים שן שו-Ou (המכון הטכנולוגי של קליפורניה) לדיון תובנה על התפתחות וזמינותו סריג. מ. ג, Y.Z. ו- X.L. במימון קרנות הפעלה מאוניברסיטת Purdue כדי Y.Z., X.L.This עבודה נתמך בחלקו על ידי מענק זרע מן המרכז של אוניברסיטת Purdue עבור ביולוגית הצמח.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics