체 외 형광 공명 에너지 전달에 밀리초 시간 규모에서 단백질 복합물의 역학을 공부 하는 사용 하 여

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

단백질 단백질 상호 작용은 생물 학적 시스템에 대 한 중요 한 고 단백질 복합물의 기능과 역학에 대 한 통찰력을 제공 하는 바인딩 활동의 연구. 형광 공명 에너지 전달 및 중지 흐름 기법을 사용 하 여 복잡 한 단백질의 운동 매개 변수를 수량화 하는 방법을 설명 합니다.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

단백질은 생물 학적 시스템의 기본 연산자 그리고 그들은 일반적으로 다른 매크로-또는 그들의 생물 학적 기능을 수행 하는 작은 분자 상호 작용. 이러한 상호 작용은 매우 동적, 상호 작용 subunits 지속적으로 연결 하 고 특정 속도에서 해리를 의미 될 수 있습니다. 빠른 방법에 통찰력을 제공 양적 풀 다운 바인딩 속도 론을 공부 하는 상호 작용의 힘을 보여와 같은 기술을 사용 하 여 바인딩 선호도 측정 하는 동안 상호 작용 발생 하 고 얼마나 오랫동안 각 복잡 한 있을 수 있습니다. 또한,는 상호 작용에 대 한 중요 한 지식을 제공 하는 다른 요인에 의해 규제 메커니즘을 공개 도움이 단백질 교환 요인 등 약물, 추가 요소가 존재 상호 작용의 속도 측정 합니다 생물학과 의학 연구의 전진입니다. 여기, 우리는 높은 내장 협회 속도가지고 있으며 다른 단백질에 의해 신속 하 게 해리 될 수 있는 복잡 한 단백질의 바인딩 활동을 측정 하기 위한 프로토콜을 설명 합니다. 메서드는 생체 외에서, 단백질 복합물의 대형을 보고 형광 공명 에너지 전달을 사용 하 고 모니터링 빠른 연결 및 분리의 중단 흐름 fluorimeter에 실시간으로에서 복잡 한 수 있습니다. 이 분석 결과 사용 하 여 복잡 한 단백질의 협회 및 분리 속도 상수 정량 된다.

Introduction

생물 학적 활동은 궁극적으로 대부분의 사람들과 상호 작용 적절 한 생물 학적 기능에 대 한 단백질에 의해 수행. 계산 방식을 사용 하 여, 인간의 단백질 단백질 상호 작용의 총 금액 650000 ~1, 추정 되 고 종종 이러한 상호 작용의 혼란 리드 질병2. 세포질 organismal 과정 통제에 그들의 필수적인 역할 때문 수많은 방법은 효 모 2 잡종, 분자 형광 보완성, 분할 luciferase 단백질 단백질 상호 작용 연구 개발 되었습니다. 보완성, 그리고 공동-immunoprecipitation 분석 결과3. 이러한 방법을 발견 하 고 확인 하는 단백질 단백질 상호 작용에 좋은 동안, 그들은 일반적으로 비 양적 하 고 따라서 상호 작용 단백질 파트너 간의 선호도 대 한 제한 된 정보를 제공. 양적 풀-다운 바인딩 선호도 (예: 분리 상수 Kd)를 측정 하기 위해 사용할 수 있습니다 하지만 그것은 바인딩의 활동을 측정 하지 않습니다도 적용할 수 있는 그것은 Kd 는 부적당 한 것으로 인해 매우 낮은 때 신호 대 잡음 비율4. 표면 플라스몬 공명 (SPR) 분광학 단정 바인딩 활동 있지만 특정 표면 및 잠재적으로 반응5의 바인딩 속성을 바꿀 수 있는 표면에 1 개의 반응의 동원 정지 합니다. 또한, 빠른 연결 및 분리 속도5, 측정 하는 SPR 어렵습니다 그리고 그것은 SPR 교환 단백질 복잡 한 소 단위 단백질의 이벤트 특성을 사용 하 여 적절 한. 여기, 우리는 단백질 복잡 한 조립과 해체 밀리초 시간 규모에서의 속도 측정을 허용 하는 방법을 설명 합니다. 이 방법은 F 상자 단백질 교환 요소6,7 C율 린-ssociated-Nedd8-dissociated 단백질 1 (Cand1)의 역할을 결정 하기 위한 필수적 이었다.

Cand1은 Cullin 링 유비퀴틴 ligases의 큰 가족에 속하는 Skp1•Cul1•F 상자 단백질 (SCF) E3 ligases의 역학을 조절. SCFs 바인딩 링 도메인 단백질 Rbx1, Cul1 및 기판 신병 및 Cul1 접합 기 단백질 Skp18통해 바인딩하는 상호 교환 F 상자 단백질 cullin로 구성 됩니다. E3 리가 SCF catalyzes 유비퀴틴의 기판에의 활용 그리고 기판 F 상자 단백질에 의해 모집 및 Cul1 유비퀴틴-같은 단백질 Nedd89에 의해 수정 될 때 활성화 됩니다. Cand1 수정 되지 않은 Cul1 한다 Cul1와 Skp1•F-상자 단백질의 협회와 Cul110,11,,1213Nedd8 활용을 모두 바인딩 시 방해. 결과적으로, Cand1 SCF 활동 생체 외에서의 억제제 등장 하지만 생물에서 Cand1 결핍 발생 vivo14,,1516 에 SCF 활동 조절에 Cand1의 긍정적인 역할을 제안 하는 결점 , 17.이 역설은 마지막으로 Cul1, Cand1, 및 Skp1•F 상자 단백질 간의 동적 상호 작용을 밝혀 양적 연구에 의해 설명 했다. 형광 공명 에너지 전달 (무서 워) 분석 실험 SCF 및 Cul1•Cand1 단지의 형성을 검출 하는 사용 하 여, 협회 및 분리 속도 상수 (k / k에서각각) 했다 개별적으로 측정. Cand1와 Skp1•F-상자 단백질 형태로 매우 엄격한 복잡 한 Cul1, 그러나에서 떨어져 k SCF의 Cand1에 의해 극적으로 증가 하 고 있는 k에서 Cul1•Cand1는 극적으로 증가 했다 측정 공개 Skp1•F-상자 단백질6,7여. 이 결과 Cul1 이전 SCF 단지에서 재활용을 통해 새로운 SCF 단지의 형성 catalyzes 단백질 교환 요인으로 Cand1의 역할을 정의 하기 위한 초기 및 중요 한 지원을 제공 합니다.

여기, 우리가 개발 하 고 무서 워 분석 결과 사용 하 여 Cul1•Cand1 복잡 한7의 역학 연구의 절차를 제시 하 고 다양 한 생체 역학 연구에 동일한 원리를 적용할 수 있습니다. 무서 워 기증자는 적절 한 파장에 흥분 하 고 기증자 방출 스펙트럼 중복 여기 스펙트럼과 수락자 10-100의 거리 내에 존재 하는 경우에 발생 합니다 Å. 흥분된 상태 함으로써 기증자 강도 감소 하 고 증가 하는 수락자 강도18수락자로 전송 됩니다. 무서 워 (E)의 효율성 포스터 반경 (R0) 및 (r), 기증자 및 수락자 fluorophores 사이의 거리에 따라 달라 집니다 그리고에 의해 정의 됩니다: E = R06/ (R0 6 + r6). 포스터 반경 (R0) 쌍 극 자 각도 방향 등 몇 가지 요인에 따라 달라 집니다, 그리고 기증자 수락자 쌍 및 솔루션의 스펙트럼 중복 사용19. 실시간으로 기증자 방출의 변화를 모니터링 하 고 빠른 k에k에서측정, 중지 흐름 fluorimeter에 무서 워 분석 결과 적용 하려면 그것은 효율적인 무서 워를 설정 하는 데 필요한 하 기증자 방출의 뜻깊은 감소에 있는 결과. 따라서, 염료를 연결할 대상 단백질에 형광 염료와의 적절 한 쌍을 선택 하 여 효율적인 무서 워 설계 중요 하 고이 프로토콜에서 설명 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1입니다. 디자인 무서 워 분석 결과입니다.

  1. 복잡 한 Cul1•Cand1의 구조 파일 단백질 데이터 은행 (1U6G 파일)에서 다운로드 합니다.
  2. PyMOL에 복잡 한 Cul1•Cand1의 구조를 볼 수 있습니다.
  3. PyMOL의 마법사 메뉴에서 측정 함수를 사용 하 여 첫 번째 아미노산의 Cand1와 Cul1의 마지막 아미노산 사이 거리를 견적 하기 위하여 (그림 1).
  4. 로드 온라인 스펙트럼 뷰어 ( 재료의 표참조) 여기 및 7-아미노-4-methylcoumarin (AMC)와 플래시의 방출 스펙트럼을 동시에 볼 (그림 2). 고전은 무서 워 기증자와 플래시 무서 워 수락자 이다.

Figure 1
그림 1: Cul1•Cand1 및 잠재력 라벨 사이트 사이의 거리의 측정의 결정 구조. 크리스탈 구조 파일 단백질 데이터 은행 (파일 1U6G)에서 다운로드 되었고 PyMOL에서 볼. 선택 된 원자 사이 측정 PyMOL에 의해 수행 되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 여기 및 무서 워 대 한 형광 염료의 방출 스펙트럼. AMC (7-아미노-4-methylcoumarin)와 플래시의 스펙트럼 표시 됩니다. 파선 여기 스펙트럼을 나타냅니다 그리고 고체 선 방출 스펙트럼을 나타냅니다. 이미지 형광 SpectraViewer에 의해 원래 생성 하 고 더 나은 선명도 대 한 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

2. Cul1의 준비AMC•Rbx1, 무서 워 기증자 단백질

  1. 대장균 세포에 인간 Cul1sortase•Rbx1 표현에 대 한 플라스 미드를 생성 합니다. Note 공동 대장균 세포에 인간 Cul1•Rbx1을 표현 하는 두 개의 플라스 미드는 이전 보고서20에 자세하게 설명 되어 있습니다.
    1. 표준 PCR, 클로닝 방법21,22통해 Cul1 코딩 순서의 3' 끝에 "LPETGGHHHHHH" (sortase-그의6 태그) 코딩 DNA 순서를 추가 합니다.
    2. 정확한 유전자 삽입을 확인 하기 위해 새로운 플라스 미드를 시퀀스.
  2. 공동 Cul1sortase•Rbx1 대장균 세포에 표현 한다. 메서드는 이전 보고서20에서 파생 됩니다.
    1. 믹스 100 ng 각 BL21와 두 개의 플라스 미드의 (DE3)는 열을 사용 하 여 공동 변환에 대 한 화학적 유능한 세포 충격 방법23. 파운드 한 천 배지 100 µ g/mL 암 피 실린, 37 ° C에서 34 µ g/mL 페니 하룻밤 포함 된 셀을 성장.
    2. 파운드 문화 갓 변환 된 식민지의 50 mL를 접종 하 고 250 rpm 동요와 37 ° C에서 하룻밤 성장. 이 시 동기 문화를 제공합니다.
    3. 6 플라스 크, LB 매체 1 리터와 함께 각각 5 mL 스타터 문화 각 접종 250 rpm OD600 ~ 1.0까지 떨고 37 ° C에서 성장 하 고. 문화 16 ° C에 냉각 하 고 추가 이소프로필-β-D-thiogalactoside (IPTG) 0.4 m m. 16 ° C 하룻밤 250 rpm 동요에서 문화를 유지.
    4. 15 분 동안 5000 x g 에서 원심 분리를 통해 대장균 세포를 수확 하 고 50 mL 원뿔 튜브에 펠 릿 셀을 수집 합니다.
      참고: 셀 펠 릿 단백질 정화 처리 될 수 있습니다 또는 단백질 정화 단계를 진행 하기 전에-80 ° C에 얼.
  3. 복잡 한 Cul1sortase•Rbx1의 정화. 이 메서드는 이전 보고서20에서 파생 됩니다.
    1. 대장균 세포 표현 Cul1sortase•Rbx1의 펠 릿에 세포의 용 해 버퍼 (30 mM Tris HCl, 200 mM NaCl, 5mm DTT, 10% 글리세롤 1 태블릿의 프로 테아 제 억제 물 칵테일, pH 7.6) 50 mL를 추가 합니다.
    2. 50% 진폭에서 쥡니다와 얼음에 셀 lyse 1 초 및 1 초 OFF를 번갈아 하 고 3 분 동안 실행 합니다.
    3. 2-3 배 단계 2.3.2 반복 합니다.
    4. 50 mL 원심 분리 관에 세포 lysate를 전송할 고 45 분 대 한 25000 x g 에서 원심 분리에 의해 세포 파편을 제거 합니다.
    5. 명확한 세포 lysate 티 비즈 2 h 4 ° C에서의 5 mL와 함께 품 어.
    6. 1500 x g 4 ° c.에 2 분 동안에 구슬 lysate 혼합물을 원심 제거는 상쾌한.
    7. (아니 protease 억제제)와 세포의 용 해 버퍼의 5 mL와 구슬 워시와 4 ° c.에 2 분 동안 1500 x g 에서 원심 분리 후에 상쾌한 제거
    8. 반복 단계 2.3.7 2 배.
    9. 씻어 구슬에 세포의 용 해 버퍼의 3 mL를 추가 하 고 빈 열에 구슬 슬러리를 전송.
    10. 열에 차입 버퍼 (50 m m Tris HCl, 200 m m NaCl, 10 m m 감소 티, pH 8.0)의 5 mL를 추가 합니다. 10 분 동안 incubate 고는 eluate 수집 합니다.
    11. 3-4 x 2.3.10 단계를 반복 합니다.
    12. 5 mg/mL 트 롬 빈의 200 µ L을 추가 ( 재료의 표참조)에서 티 비즈 eluate에 4 ° c.에서 밤새 품 어와
      참고: 프로토콜 수 수 일시 중지 여기.
    13. 삼 배 (25mm HEPES, 1mm DTT, 5% 글리세롤, pH 6.5)에 버퍼 A와 단백질의 샘플을 희석.
    14. Equilibrate 이온 교환 크로마토그래피 칼럼 ( 재료의 표참조) 버퍼 A. FPLC 시스템에
    15. 0.5 mL/min 흐름 속도로 equilibrated 양이온 교환 크로마토그래피 열 단백질 샘플을 로드 합니다.
    16. 버퍼 A와 0 ~ 50% 버퍼 B (25mm HEPES, 1 M NaCl, 1 mM DTT, 5% 글리세롤, pH 6.5) 1 mL/min 유량을 혼합 하 여 40 mL에 NaCl의 그라데이션으로 단백질을 elute.
    17. SDS 페이지24을 사용 하 여 다른 분수에 eluted 단백질을 확인 하십시오.
      참고: 프로토콜 수 수 일시 중지 여기.
    18. Cul1sortase•Rbx1을 포함 하는 eluate 분수 풀.
    19. 외 막 (30 kDa 컷오프)을 통해 버퍼를 전달 하 여 2.5 mL을 풀링된 Cul1sortase•Rbx1 샘플을 집중.
  4. Sortase이 중재 transpeptidation21,22를 통해 Cul1의 C-말단에 AMC를 추가 합니다.
    1. Sortase 버퍼 (50 mM Tris HCl, 150 mM NaCl, 10 m m CaCl2, pH 7.5) Cul1sortase•Rbx1 샘플에 버퍼가 변경 염 열을 사용 하 여 ( 재료의 표참조).
      1. Sortase 버퍼의 25 mL 염 열 equilibrate
      2. 열에 Cul1sortase•Rbx1 샘플의 2.5 mL를 로드 합니다. 흐름을 통해 삭제 합니다.
      3. Sortase 버퍼의 3.5 mL과 샘플 elute 흐름 통해 수집 합니다.
    2. Sortase 버퍼에서 Cul1sortase•Rbx1 솔루션의 900 µ L, 100 µ L 600 µ M 정화 sortase A 솔루션 및 25 mM GGGGAMC 펩 티 드의 10 µ L을 추가 합니다. 어두운 하룻밤에 30 ° C에서 반응 혼합물을 품 어. 참고가이 단계 Cul1 생성 됩니다고전•Rbx1.
      주의: 형광 염료는 빛, 그래서 가능한 만큼 단백질 및 샘플 준비 하는 동안 주위 빛에 노출 하지 마십시오에 민감합니다.
      참고: 프로토콜 수 수 일시 중지 여기.
    3. Ni NTA agarose 구슬의 50 µ L 반응 혼합물에 추가 하 고 30 분 동안 실 온에서 품 어.
    4. 2 분 동안 5000 x g 에서 원심 분리 하 여 Ni NTA agarose 구슬 작은 고는 상쾌한을 수집 합니다.
    5. 크기 배제 크로마토그래피 열 equilibrate ( 재료의 표참조) FPLC 시스템에 버퍼 (30 mM Tris HCl, 100 mM NaCl, 1 mM DTT, 10% 글리세롤).
    6. 모든 Cul1를 로드 크기 배타 착 색 인쇄기 열에AMC•Rbx1 샘플. 버퍼의 1.5 x 열 볼륨 elute.
    7. SDS 페이지24여 eluate 분수를 확인 하십시오.
    8. Cul1 포함 된 eluate 분수 풀AMC•Rbx1.
    9. 280에서의 흡 광도 사용 하 여 단백질 농도 측정 한 분 광 광도 계 nm.
    10. 약 수 단백질 해결책 및-80 ° c.에 게
      참고: 프로토콜 수 수 일시 중지 여기.

3. 플래시Cand1, 무서 워 수락자 단백질 의 준비

참고:이 부분에 단계 대부분의 2 단계와 동일. 다른 조건 아래에 자세히 설명 되어 있습니다.

  1. 대장균 세포에 인간 TetraCysCand1를 표현 하기 위한 플라스 미드를 생성 합니다.
    1. 15번째 아미노산의 Cand1 일반 PCR25 통해 전에 추가 하는 "CCPGCCGSG" (tetracysteine/TetraCys 태그) 코딩 DNA 순서 (뇌관 순서: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG)입니다.
    2. PGEX-4T-2 벡터에 PCR 제품을 삽입 합니다. 유전자 삽입은 정확 하 고 프레임을 확인 하는 플라스 미드를 시퀀스.
  2. 플라스 미드는 로제타 유능한 세포로 변환 한다는 점을 제외 하면 TetraCysCand1in 대장균 세포 단계 2.2, 같은 방식으로 표현 한다.
  3. 대장균 세포에서 TetraCysCand1의 정화.
    1. 대장균 세포 알갱이 lyse 고 TetraCysCand1using 티 비즈를 추출 합니다. 이 단계는 단계 2.3.1–2.3.12와 동일 합니다.
    2. 3 겹에 의해 버퍼 c (50 mM Tris HCl, 1mm DTT, 5% 글리세롤, pH 7.5) 티 비즈에서 단백질 eluate 희석. 음이온 교환 크로마토그래피 열 equilibrate ( 재료의 표참조) 버퍼 C와 부하 0.5 mL/min 흐름 속도로 희석된 단백질 샘플 FPLC 시스템에.
    3. 버퍼 C 0 ~ 50% 버퍼 D (50 mM Tris HCl, 1 M NaCl, 1 mM DTT, 5% 글리세롤, pH 7.5) 1 mL/min 유량을 혼합 하 여 40 mL에 NaCl의 그라데이션으로 단백질을 elute. SDS 페이지24를 사용 하 여 다른 분수에 eluted 단백질을 확인 하 고 포함 하는 TetraCysCand1 분수 수영장. TetraCysCand1 무료 GST 보다 더 큰 유지 볼륨은 note.
    4. 외 막 (30 kDa 컷오프)을 통해 버퍼를 전달 하 여 풀링된 TetraCysCand1 샘플을 집중.
    5. FPLC 시스템에 크기 배제 크로마토그래피 열 레이블 버퍼 (20 mM Tris HCl 100 m m NaCl, 2mm TCEP, 1 mM EDTA, 5% 글리세롤) equilibrate. TetraCysCand1 샘플 (500 µ L 각 시간) 로드 및 SDS 페이지24여 eluate 분수를 확인 하십시오.
    6. TetraCysCand1를 포함 하는 모든 분수를 풀 고 외 막 (30 kDa 컷오프)을 통해 버퍼를 전달 하 여 ~ 40 µ m 단백질을 집중. 280에서의 흡 광도 사용 하 여 단백질 농도 추정 nm. 단백질-80 ° c.에 50 µ L aliquots로 저장
      참고: 프로토콜 수 수 일시 중지 여기.
  4. 플래시Cand1의 준비입니다.
    1. 플래시 솔루션의 1 µ L 추가 ( 재료의 표참조) 50 µ L TetraCysCand1 솔루션.
    2. 잘 혼합 하 고 1-2 h 플래시Cand1을 위한 어둠 속에서 실내 온도에 혼합물을 품 어.
      참고: 프로토콜 수 수 일시 중지 여기.

4. Cand1, 무서 워 체이스 단백질의 준비

참고: 단백질 준비 프로토콜은 다음과 같은 수정 3 단계 비슷합니다.

  1. PGEX-4T-2 벡터에 전체 길이 Cand1의 코딩 시퀀스를 삽입 합니다.
  2. 단계 3.3.5 30 mM Tris HCl, 100 mM NaCl, 1 mM DTT, 10% 글리세롤을 포함 하는 버퍼에서에서 사용 되는 버퍼를 변경 합니다.
  3. 3.3.7-3.3.8 단계를 제거 합니다.

5. 테스트 하 고 무서 워 분석 결과 확인

  1. 30 m m 100 mM NaCl, 0.5 m m DTT, 1 mg/mL ovalbumin pH 7.6, Tris HCl를 포함 하는 무서 워 버퍼를 준비 하 고 실내 온도에 사용.
  2. Cul1 사이 무서 워 테스트AMC•Rbx1 및 플래시Cand1는 fluorimeter에.
    1. 무서 워 버퍼의 300 µ L에서 Cul1 추가AMC•Rbx1 (무서 워 기증자) 70의 최종 농도에 nM. 베트에 솔루션을 전송 합니다.
    2. 장소에는 fluorimeter의 샘플 홀더 베트. 350 nm 여기 빛으로 샘플을 자극 하 고 400에서 방출 신호를 스캔 600 nm nm에서 1 nm 씩 증가.
    3. 5.2.1 단계를 반복 하지만 플래시Cand1 변경 Cul1AMC•Rbx1 (무서 워 수락자). 플래시Cand1 샘플 단계 5.2.2에서 동일한 방법을 사용 하 여 스캔.
    4. (선택 사항) 510 nm 여기 빛, 플래시Cand1를 자극 하 고 500에서 방출 신호를 스캔 650 nm nm.
    5. 300 µ L 무서 워 버퍼에 추가 두 Cul1AMC•Rbx1 및 70의 최종 농도에 플래시Cand1 nM. 5.2.2 단계에서와 같은 방법에 샘플을 분석 합니다.
  3. Cul1 사이 무서 워 확인AMC•Rbx1와 체이스 (레이블이 없는 Cand1) 단백질 (그림 3C)을 추가 하 여 플래시Cand1.
    1. 무서 워 버퍼의 300 µ L, 추가 70 nM Cul1AMC•Rbx1와 700 nM Cand1. 5.2.2 단계에서 샘플 방출 스캔.
    2. 무서 워 버퍼의 300 µ L, 추가 70 nM 플래시Cand1와 700 nM Cand1. 5.2.2 단계에서 샘플 방출 스캔.
    3. 무서 워 버퍼의 300 µ L, 추가 70 nM Cul1AMC•Rbx1 및 70 nM 플래시Cand1, 그리고 5 분 동안 실 온에서 샘플을 품 어. 다음 추가 700 nM Cand1, 또한, 후 즉시 스캔 단계 5.2.2에서 샘플 방출). Note이 단계 단계 5.2.5와 비슷합니다.
    4. 300 µ L 무서 워 버퍼에 순차적으로 추가 70 nM Cul1AMC•Rbx1, 700 nM Cand1, 및 70 nM 플래시Cand1. 5 분 동안 실 온에서 샘플을 품 어 및 단계 5.2.2에서 샘플 방출 스캔. Note이 체이스 샘플 ( 그림 3C에서 녹색 라인)입니다.

6. Cul1•Cand1의 협회 속도 상수 (k에에서) 측정

참고: 세부 운영 중지 흐름 fluorimeter의 이전 보고서26에서 설명 하고있다.

  1. 측정에 대 한 중지 흐름 fluorimeter를 준비 합니다.
    1. 제조업체의 지시에 따라 중지 흐름 fluorimeter 설정.
    2. 350 nm, 450 nm 방출 허용 대역 통과 필터를 통과 하는 빛 및 500-650 nm 방출 빛을 차단 사용에서 흥분 빛을 설정 합니다.
    3. 샘플 밸브 작성 위치에 유지 하 고 물으로 채워진 3 mL 주사기를 연결. 여러 번 왔다 갔다 샘플 주사기 드라이브를 이동 하 여 두 샘플 주사기 (A와 B) 물으로 씻어. 이 단계에서 사용 하는 모든 물을 삭제 합니다.
    4. 샘플 밸브 작성 위치에 유지 하 고 무서 워 버퍼 가득 3 mL 주사기를 연결. 몇 시간 아래로 샘플 주사기 드라이브를 이동 하 여 무서 워 버퍼와 함께 두 개의 샘플 주사기를 씻어. 이 단계에서 사용 하는 모든 무서 워 버퍼를 삭제 합니다.
  2. 받아 제어 측정 (그림 4C).
    1. 3 mL 주사기를 연결 하 고 주사기를 무서 워 버퍼에서 100 nM Cul1AMC•Rbx1 로드. 샘플 밸브 드라이브 위치 설정.
    2. 3 mL 주사기를 연결 하 고 주사기 B 무서 워 버퍼 로드. 샘플 밸브 드라이브 위치 설정.
    3. 소프트웨어의 취득 에서 제어판 을 사용 하 여 촬영 5 (주사기 A와 주사기 B에서 동일한 양의 샘플 혼합) 중지 흐름 fluorimeter에 결과 기록 하지 않고.
    4. 소프트웨어에서 취득 에서 제어판 을 열고 프로그램 Cul1의 방출 기록 하AMC 60 s. 다음 싱글 샷 걸릴.
    5. 반복 단계 6.2.4 2 배.
    6. 샘플 밸브 채우기 위치 설정. 빈 주사기 B 하 고 무서 워 버퍼 씻어.
  3. Cul1•Cand1의 협회 속도 상수 (kobs)를 관찰 하는 측정 (그림 4B).
    1. 주사기 A에에서는 샘플을 계속 단계 6.2.1 같은.
    2. 3 mL 주사기를 연결 하 고 주사기 B 100 로드 무서 워 버퍼에서 플래시Cand1 nM. 샘플 밸브 드라이브 위치 설정.
    3. 소프트웨어의 취득 에서 제어판 을 사용 하 여 결과 기록 하지 않고 5 촬영을.
    4. 소프트웨어에서 취득 에서 제어판 을 열고 프로그램 Cul1의 방출 기록 하AMC 60 s. 다음 싱글 샷 걸릴.
    5. 반복 단계 6.3.4 2 배.
    6. 빈 주사기 B 하 고 무서 워 버퍼 씻어.
    7. 여러 번 무서 워 버퍼에서 Cand1 플래시의 농도 증가 함께 단계 6.3.1–6.3.6를 반복 합니다.
    8. 형광 신호는 단일 지 수 곡선을 각 장면에서 시간이 지남에 따라 측정에 맞게 변경 (감소). 이 각 측정에서 kobs를 줄 것 이다 그리고 단위는 s-1. 참고가이 계산의 기초는 이전 보고서27에 잘 설명 되어 있습니다.
  4. 평균 및 kobs사용 각 플래시Cand1 농도의 표준 편차를 계산 합니다. Cand1 농도 (그림 4D)에 대 한 평균 kobs를 플롯 하 고 선의 기울기는 k에 Cul1•Cand1, M-1의 -1의 단위와 함께 나타냅니다.

7. 분리 속도 상수 (k에서) Cul1•Cand1의 Skp1•F 상자 단백질의 존재를 측정 합니다.

참고:이 단계는 6 단계, 다음 수정 비슷합니다.

  1. 주사기, 채우기 위치에서 로드 100 nM Cul1AMC•Rbx1의 솔루션 및 100 nM 플래시Cand1 무서 워 버퍼에. "드라이브" 위치에 샘플 밸브를 켜십시오.
  2. 주사기 B 채우기 위치에서 Skp1•Skp2 (이전 보고서20다음 준비)의 솔루션을 로드 합니다. "드라이브" 위치에 샘플 밸브를 켜십시오.
  3. 소프트웨어에서 취득 에서 제어판 을 열고 프로그램 Cul1의 방출 기록 하AMC 30 s. 다음 싱글 샷 걸릴. 형광 신호 주사기 A와 주사기 B (그림 5)에서 솔루션을 혼합 후 시간이 지남에 따라 증가.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cul1 사이 무서 워 테스트를AMC플래시Cand1, 우리가 먼저 70의 방출 강도 결정 nM Cul1AMC (기증자)와 70 nM 플래시Cand1 (수락자), 각각 (그림 3A-C, 블루 라인). 각 분석에만 한 방출 피크는 현재, 그리고 플래시Cand1의 방출 (수락자) 낮은 했다. 때 70 nM 각 Cul1의AMC플래시Cand1 무서 워 생성을 혼합 했다, 두 방출 봉우리 방출 스펙트럼에 피크의 Cul1AMC 되었다 더 낮은 그리고 플래시Cand1의 피크 되었다 더 높은 (그림 3A -C, 빨간 라인). 전체 길이 Cand1 사용 되었다 무서 워, 기증자 피크 강도 (그림 3A, 빨간 선), 10% 감소를 보여주었다 고 잘린 그것의 처음 나선와 Cand1 사용 하는 경우 기증자 피크 강도의 감소 30% (그림 3B 증가 했다 -D, 레드 라인), 높은 무서 워 효율성을 제안합니다. 신호 변경 무서 워 Cul1 사이에서 발생 했다 확인 하AMC플래시Cand1, 70 nM Cul1AMC (기증자) 700와 함께 혼합 했다 Cand1 레이블 없음 nM (체이스) 70 nM 플래시Cand1 (수락자). 그 결과, 기증자 피크는 완벽 하 게 복원 하 고 수락자 피크 감소 했다 (그림 3C, 녹색 선), 관찰된 무서 워는 Cul1의 형성에 따라 확인AMC플래시Cand1 복잡 한. 추가 700 nM Skp1•Skp2 70 nM Cul1AMC플래시Cand1 또한 완벽 하 게 복원 기증자 피크 (3D 그림, 녹색 선), 제안 Cul1•Cand1 복잡 한 평형에서 Skp1•Skp2에 의해 완전히 중단 되었다.

Figure 3
그림 3: Cul1•Cand1 복잡 한 형성에 대 한 분석 결과 대표적인 마세요. 무서 워 버퍼 (30 mM Tris HCl 100 m NaCl, 0.5 m m DTT, 1 mg/mL ovalbumin pH 7.6 m)에서 샘플 350에 흥분 했다, 및 방출 400에서 검색 된 650 nm nm. (A) 방출 스펙트럼 70의 nM Cul1AMC, 70 nM 플래시Cand1 (전체), 그리고 2의 혼합물 (무서 워). Cand1 (전체) 전체 길이 Cand1 의미합니다. (B) 방출 스펙트럼 70의 nM Cul1AMC, 70 nM 플래시Cand1, 그리고 2의 혼합물 (무서 워). Cand1의 첫 번째 나선 삭제와 함께이 실험 하 고 그 후 사용 되었다. (C) 방출 스펙트럼 70의 nM Cul1AMC, 70 nM 플래시Cand1, 2의 혼합물 (무서 워), 무서 워 (체이스)에 대 한 제어를 쫓아. 체이스 샘플 포함 70 nM Cul1AMC, 700 nM Cand1 및 70 nM 플래시Cand1. (D) 방출 스펙트럼 70의 nM Cul1AMC, 70의 혼합물 nM Cul1AMC 및 70 nM 플래시Cand1 (무서 워), 그리고 700 nM Skp1•Skp2 70 nM Cul1AMC플래시Cand1 복합물에 추가. 각 플롯에서 방출 신호는 70의 방출에 표준화 했다 nM Cul1AMC 450 nm. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

k에 Cul1•Cand1의 중단 흐름 fluorimeter에 시간이 지남에 기증자 신호 감소를 모니터링 하 여 설립된 무서 워 분석 결과 사용 하 여 측정 하기 위해 우리는 먼저 테스트 하 고 사용 될 단백질의 농도 결정. 때 5 nM 각 Cul1의AMC플래시Cand1 사용, 반면, 50 각 단백질의 농도 증가 하는 때 아주 작은 신호 변화 (그림 4A), 관찰 되었다 nM, 시간이 지남에 따라 신호 감소 ( 관찰 되었다 그림 4B) 및 플래시Cand1 없이 버퍼 (그림 4C) 추가 된 경우이 변경 폐지 되었다. 따라서, 50 nM Cul1AMC 는 추가 분석을 위해 사용 되었다 하 고 관찰된 협회 속도 상수 (kobs)의 시리즈 50 혼합 하 여 측정 되었다 nM Cul1AMC 플래시Cand1의 농도 증가 함께. 각 실험에 대 한 kobs 는 단일 지 수 곡선을 포인트 피팅 계산 되며 같은 플래시Cand1 농도에서 얻은 kobs 평균 했다. k에 Cand1 농도와 평균 kobs 를 플롯 하 고 선형 회귀 (그림 4D) 수행, 결정된7,27했다.

Figure 4
그림 4: 협회 속도 상수 대표 측정. (A) 5의 형광 nM Cul1AMC 는 5의 추가 시 시간이 지남에 중지 흐름 fluorimeter에 의해 모니터링 nM 플래시Cand1. (B) 형광 50 nM Cul1AMC 50의 추가 시 시간이 지남에 중지 흐름 fluorimeter에 의해 감시 되었다 nM 플래시Cand1. (C) 50의 형광 nM Cul1AMC 무서 워 버퍼의 추가 따라 시간이 지남에 중지 흐름 fluorimeter에 의해 감시 되었다. (D) k Cul1 Cand1 바인딩을 위해 합니다. Cand1의 다른 농도에서 Cul1•Cand1의 kobs 그려집니다. 선형 기울기에 k에 1.8 x 107 M-1의 -1의 제공합니다. 오차 막대를 나타내는 ±SEM; n = 4. 모든 샘플 무서 워 버퍼에 준비 되었고 350에 흥분 nm. 밴드 패스 필터는 AMC에서 신호를 수집 하 여 플래시에서 신호를 제외 사용 되었다. 데이터 정규화 되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

k의측정 마찬가지로 우리 기증자 신호의 중단 흐름 fluorimeter에 시간이 지남에 따라 증가 (복원)를 모니터링 하 여 Cul1•Cand1의 관찰된 분리 속도 상수를 측정. Cul1AMC플래시Cand1 먼저, 혼합 하 고 Skp1•Skp2 어셈블리 Cul1에 추가 되었다AMC플래시Cand1 중지 흐름 fluorimeter에. 기증자 신호를 신속 하 게 증가 하 고 0.4 s-1 (그림 5)의 kobs 공개. 반면, 버퍼에 추가할 때 어셈블리 Cul1AMC플래시Cand1, 신호 증가 관찰 되었다, Skp1•Skp2에 의해 촉발 되었다 Cul1•Cand1의 빠른 분리를 제안.

Figure 5
그림 5: 분리 속도 상수 대표 측정. 시간 대 기증자 형광 변화 150의 추가 따라 측정 되었다 Skp1•Skp2 또는 50 nM Cul1AMC플래시Cand1 단지 무서 워 버퍼. 신호 변경 단일 지 수 곡선에 맞게 됐다 고 관찰된 분리 속도 상수가 0.4 s-1의. 실험 조건 그림 4에 설명 된 그 유사 했다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

무서 워 공부 하 고 이해 하는 생물 학적 시스템19에 대 한 큰 관심은 물리적 현상입니다. 여기, 우리는 테스트 및 무서 워 두 상호 작용 단백질의 바인딩 활동 연구를 사용 하 여 프로토콜 제시. 디자인할 때 무서 워, 우리 세 가지 주요 요소를 고려: 기증자 방출 및 수락자 여기, 두 fluorophores fluorophores28의 쌍 극 자 방향 사이의 거리 사이의 스펙트럼 중복. 무서 워는 fluorophores 선택, 우리는 흥분 및 fluorophores의 방출 스펙트럼 중첩 하 고 fluorophores 기증자의 방출 스펙트럼은 여기 크게 겹치는 동안 누구의 방출 봉우리 잘 분리에 대 한 검색 수락자 (그림 2)의 스펙트럼. Interfluorophore 거리와 방향을 최적화, 우리는 지원에 대 한 결정 구조를 사용 하 고 우리는 주로 단백질 구조 및 활동의 더 낮은 위험이 있으므로 주로 단백질 테르미니에 fluorophores 연결 고려. 때문에 Cand1의 N terminus 사이 거리 (Cand1NTD)와 Cul1의 C-말단 (Cul1CTD) Cand1의 C-말단 및 Cul1의 N-말단 사이의 거리 보다 짧은 (그림 1), 우리는 Cand1 라벨 하기로NTD 및 Cul1CTD. 우리는25의 tetracysteine 태그 사용 하 여 단백질의 N-말단의 80%-90% 라벨 효율을 달성할 수 있었다, 때문에 우리는 Cand1 라벨 하기로NTD tetracysteine 태그를 통해 플래시와 함께. 우리는 처음에 Cul1 라는CTD 시안색 형광 단백질 (CFP), AMC에 비해 몇 가지 장점을. 첫째, 그것은 유전으로 인코딩된 형광 태그 추가 라벨 프로세스도는 레이블이 전조에서 레이블이 형광 단백질 정화 단계 필요 하지 않습니다 그래서. 둘째, CFP AMC, 보다 밝은 이며 따라서, 고감도 분석 결과 제공 합니다 (아래 내용 참조). 셋째, CFP 플래시, 플래시와 함께 보다 효율적인 무서 워 잠재적으로 저조한 겹쳐 더 큰 스펙트럼을가지고 있습니다. 그러나, 이러한 장점에도 불구 하 고 c f P 단백질은 단백질 구조와 분자 간의 상호 작용을 방해할 수 있는 AMC 태그 보다 훨씬 더 큰 이다. 실제로, 우리는 Cul1 사이 무서 워 관찰 하지 않았다CFP 및 부적당 한 쌍 극 자 방향, 또는 CFP 태그 Cul1 Cand1 상호 작용의 붕괴 가능성이 우리의 테스트에서 Cand1 플래시. 우리 다음에 Cul1 라는CTD AMC와 Cul1 사이 무서 워 관찰 그리고AMC플래시Cand1. 초기 전체 길이 Cand1를 사용 하 여 무서 워 기증자 방출 (그림 3A)의 10% 감소에 지도. 우리는 더는 Cand1의 첫 번째 나선 삭제 하 여 Cul1와 Cand1 사이의 거리는에서 단축 26.8 Å Å 15.5에 (그림 1), 그리고 Cand1 발견 기증자 방출의 30% 감소를 보여주는 Cul1와 훨씬 더 강한 마세요 a 나왔고 처음 나선 부족 피크 (그림 3B)입니다. 또한, 하나의 높은 양자 수익률 fluorophore와 더 큰 소멸 계수 수락자 fluorophore 기증자를 선택 하 여 무서 워 효율성을 높일 수 있습니다.

무서 워의 특징은 그 때 무서 워 발생, 기증자 감소의 방출 및 수락자 증가 (그림 3B)의 방출. 그러나, fluorophores 그들의 환경에 감도 표시 될 수 있습니다 및 따라서, 방출 강도 경우 다른 단백질, 무서 워29의 부재에도 변경 될 수 있습니다. 하 우리가 관찰 변경 된 방출 때문에 Cul1 사이 무서 워AMC플래시Cand1, 우리는 체이스로 레이블이 수락자 단백질 (Cand1)의 초과 금액 x 10을 추가. 체이스 변환 기증자의 방출 및 수락자 다시 정상 수준 (그림 3C)을 지 원하는 Cul1의 변경 된 배출량AMC플래시Cand1 단백질-단백질 상호 작용, 그리고 따라서,이 결과에 따라 달라 집니다 우리 협회와 Cul1•Cand1의 분리를 보고 무서 워 분석 결과 설립을 확인 합니다. 또한, 우리는 소 Cul1에 Skp1•Skp2 추가AMC플래시Cand1 복잡 한, 그리고 Skp1•Skp2 Cul1-Cand1 상호 작용6방해 수 알려져 있다. 우리는 Cul1 사이 무서 워 발견AMC플래시Cand1 사라졌다 (그림 3D, 녹색 선) 그리고 방출 스펙트럼 되었다 체이스 샘플 (그림 3C, 녹색 선)의 방출 스펙트럼과 유사한 제안 Cul1AMC플래시Cand1 Skp1•Skp2와 Cul1에 의해 해리 Skp1•Skp2는 때AMC 비정상적인 방출을 표시 하지 않습니다.

기증자 방출에 변화를 모니터링 함으로써 우리가 직접 관찰할 수 협회와 Cul1의 분리AMC플래시Cand1 중지 흐름 fluorimeter에. 중지 흐름 시스템 반응 빠르게 반응 물, 혼합을 혼합 챔버에 주입 하 고 일단 관찰 실5로 혼합된 반응 이동 흐름을 중지 하 여 작동 합니다. 신호 탐지는 일반적으로 혼합, 밀리초 날짜 표시줄에서 발생 하는 상호 작용을 공부 하 고 있는 사용 후 1-2 밀리초 (ms)를 시작 합니다. 그러나, 관찰된 반응의 반감기는 특정 장치에 반응 물 혼합 하는 데 필요한 시간 보다 짧은,이 접근은 충분히 과민 하 고은 더 이상 적절 한30. 중지 흐름 분석 10-6– 106의 -1 1 차 반응, 그리고 1-109 M-1의 -1 52 차 반응 속도 상수를 결정 하기 위해 사용 되었습니다. 운동 매개 변수 중지 흐름 fluorimeter를 사용 하 여 신뢰할 수 있는 측정을 얻기 위해 시작 및 평형 점 사이의 형광 신호의 중요 한 변화는 필요 하다. 우리가 사용 하는 플래시Cand1 Cul1와 함께 더 나은 무서 워 생성 되므로, 수락자로 처음 나선 부족AMC, 그리고 우리가 테스트 측정을 위해 사용 될 단백질의 농도. 때 5 nM 각 Cul1의AMC플래시Cand1 혼합 했다, Cul1에 변화가AMC 신호 (그림 4A), 관찰이 농도 제안 하는 것은 측정을 위해 충분 한. 때 단백질 농도 50 증가 했다 nM, Cul1에서 감소 시간이 지남에AMC 신호 되었다 명백한 (그림 4B), 그리고 수락자 단백질 (그림 4C) 결 석 때이 변경이 발생 하지 않습니다. Cul1 사용이 결과에 따라,AMCk에 Cul1•Cand1에 대 한 측정을 50 nM concertation에서. 측정에 사용 되는 기증자 단백질의 농도 다른 fluorophores 사용 하는 경우 달라질 수 있습니다. 예를 들어 때 Cul1는 표시 c f P, 5 CFPCul1 nM에 k6의 측정을 위해 충분 하다. 따라서, 각 무서 워 쌍에 대 한 단백질의 최적 농도 시험 한다 그리고 원칙적으로, 밝은 fluorophores 낮은 단백질 농도의 사용을 허용 하 고 제공 하는 더 나은 신호 대 잡음 비율31.

공부 하 고 무서 워 하 여 단백질 단백질 상호 작용, 단백질 구조와 잠재적으로 무서 워의 사용을 제한 하는 활동을 방해 하지 않고 적절 한 위치에 단백질 fluorophores 연결 필요 합니다. 이 프로토콜에서 우리는 N-말단 Cand1의 특히 플래시 염료를 바인딩하는 tetracysteine 태그를 사용 하 여 표시 하 고 대상 단백질32바인딩 후에 플래시 염료 된다 형광. 우리는 Cul1 표시 Cul121,22의 C-말단에 sortase 태그에 fluorophore를 들고 짧은 펩 티 드를 부착 sortase이 중재 transpeptidation를 사용 하 여. 라벨 효율 Ni NTA 구슬 (단계 2.4.3–2.4.4)를 사용 하 여 unreacted 단백질을 제거한 후 > 80 %tetracysteine 태그와 sortase 그의6 태그와 거의 100%입니다. 두 방법 모두 소개 하는 단백질 구조에 최소한의 변경 대상 단백질에 몇 가지 아미노산을 추가 합니다. Transglutaminase 인식 시퀀스 (Q-태그)3334ybbR 태그 등 비슷한 방법은 사이트별 방식에서 대상 단백질을 사용할 수 있습니다. 또한, 형광 염료의 photostability는 무서 워의 사용을 제한할 수도 있습니다. 여기 빛에 반복 또는 긴 노출 photobleaching 부정확 한 정량화 결과35인 fluorophore의 발생할 수 있습니다. 따라서, 기증자 및 수락자 단백질 준비 및 저장 단계에서 보호 되어야 한다. 더 긴 시간 간격 천천히, 시간이 지남에, 기증자 방출의 짧은 읽기 기증자 방출에 변화를 지속적으로 모니터링 하는 대신 발생 하는 이벤트를 촬영 해야 무서 워를 사용 하 여 측정 하 고 샘플 전체 동안 어둠 속에 보관 한다 실험6.

무서 워는 과민 하 고 양적, 때문에 고분자 사이의 상호 작용을 공부를 위한 중요 한 도구가 되고있다. 이 프로토콜 무서 워를 사용 하 여 솔루션에서 복잡 한 단백질의 역학을 공부 하는 예를 제공 합니다. 무서 워도 사용 되었습니다 라이브 셀 함께 생활에 분자 상호 작용 연구를 이미징 세포36는 공개 생리 적 조건 하에서 단백질 복합물의 역학에 강력한. 또한, 무서 워도 사용할 수 있습니다 단일 분자 수준에서의 복잡 한 구조적 변화에 대 한 통찰력을 제공 고분자 단지37,38, 실시간 역학 공부 하. 효율성과 무서 워의 개선, fluorophores 및 바이오 센서와 향상 된 밝기 그리고 photostability은 적극적으로 설계 하 고 공부 하는28,39큰 관심.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

무서 워 분석 결과의 개발에 대 한 통찰력이 토론에 감사 슈 Ou Shan (캘리포니아 공과대학) 하 고. 밀리, Y.Z., 및 X.L. Y.Z. 퍼듀 대학교에서 시작 기금에 의해 투자 되었다 그리고 X.L.This 일 식물 생물학에 대 한 퍼듀 대학 센터에서 종자 교부 금에 의해 부분에서 지원 했다.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics