Использование в Vitro флуоресценции резонанс передачи энергии для изучения динамики белковых комплексов в масштабе времени миллисекунду

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Белок белковых взаимодействий являются критическими для биологических систем, и исследования кинетики привязки обеспечивают понимание динамики и функции белковых комплексов. Мы описываем метод, который дает количественную оценку кинетических параметров белкового комплекса, с помощью передачи энергии резонансной флюоресценции и остановить поток техники.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Белки являются основным операторам биологических систем, и они обычно взаимодействуют с другими макро - или малых молекул выполнять свои биологические функции. Такое взаимодействие может быть высокодинамичный, означает взаимодействующих подразделений постоянно связаны и отделить некоторые ставкам. В то время как измерения сродство с использованием методов, таких как количественные выпадающем показывает силу взаимодействия, изучение кинетики привязки предоставляет информацию о том, как быстро происходит взаимодействие и как долго каждый комплекс может существовать. Кроме того, измерения кинетика взаимодействия присутствии дополнительным фактором, как фактор обмена белков или наркотиков, помогает раскрыть механизм, по которому взаимодействие регулируется другим фактором, предоставляя важные знания для улучшения биологических и медицинских исследований. Здесь мы описываем протокол для измерения кинетики привязки комплекс белков, который имеет высокое внутренне присущей ей связи скорость и может быть отделен быстро по другим белком. Этот метод использует передачи энергии резонансная флюоресценция сообщить формирования комплекса белков в пробирке, и позволяет мониторинга быстро ассоциации и диссоциация комплекса в режиме реального времени на fluorimeter остановить поток. Используя этот assay, количественно ассоциации и диссоциации константы скорости комплекс белков.

Introduction

В конечном счете биологическая деятельность осуществляется белков, Последнее из которых взаимодействовать с другими для надлежащего биологических функций. Используя вычислительный подход, общее количество белок белковых взаимодействий в человека оценивается в1~ 650 000, и нарушения этих взаимодействий часто приводит к заболеваниям2. Из-за их существенно важную роль в контроле процессов клеточной и научные многочисленные методы были разработаны для изучения взаимодействия протеин протеина, такие как дрожжи 2 гибрида, bimolecular флуоресценции комплементарности, Сплит Люцифераза дополнения и co иммунопреципитация пробирного3. Хотя эти методы являются хорошими на открытие и подтверждение белок белковых взаимодействий, они обычно неколичественного и таким образом предоставляют ограниченную информацию о сходство между взаимодействия партнеров белка. Количественные тянуть Даунс может использоваться для измерения сродство (например, Константа диссоциации Kd), но он не измерить кинетика привязки не могут быть применены, когда Kd очень низка из-за неадекватной Соотношение сигнал шум4. Спектроскопия резонанса (СРП) поверхностного плазмон количественно кинетики привязки, но она требует удельной поверхности и иммобилизация одной реагент на поверхности, которые потенциально могут изменить свойство привязки реагент5. Кроме того это трудно для СРП для измерения быстро ассоциации и диссоциации ставки5, и это не целесообразно использовать СРП для характеризуют событие обмена субблоков протеина в комплекс белков. Здесь мы описываем метод, который позволяет измерения количества белка сложные сборки и разборки в масштабе времени миллисекунду. Этот метод имеет важное значение для определения роли Cullin -ssociated -Nedd8 -дissociated белок 1 (Cand1) как F-box белка обмен фактор6,7.

Cand1 регулирует динамика Skp1•Cul1•F-бокс белка (SCF) E3 ligases, которые принадлежат к большой семье Каллин-кольцо убиквитин ligases. Заявок состоят из Каллин Cul1, который связывает кольцо домен белка Rbx1, и взаимозаменяемыми F-box белка, который вербует субстратов и связывает Cul1 через адаптер белок СКП18. Лигаза E3 SCF катализирует спряжение убиквитин к его основанию, а он активируется, когда субстрат завербован F-box белка, и когда Cul1 изменяется убиквитин подобных белков Nedd89. Cand1 связывает неизмененном Cul1, и после привязки, она разрушает как ассоциации белка Skp1•F-бокс с Cul1 и спряжение Nedd8 Cul110,11,12,13. В результате Cand1, по-видимому, ингибитор SCF активности в пробирке, но Cand1 дефицита в организмах причиной дефектов, которые предполагает позитивную роль Cand1 в регулировании деятельности компаний СКФ в vivo14,,1516 , 17. Этот парадокс объясняется наконец количественного исследования, которые показали динамического взаимодействия между Cul1, Cand1 и Skp1•F-бокс белка. С помощью флуоресценции резонанс энергии передачи (ЛАДА) анализов, которые обнаруживают формирования СКФ и Cul1•Cand1 комплексов, ассоциации и диссоциации оценить константы (kна и kот, соответственно) были измеряется в отдельности. Измерения показали, что Cand1 и Skp1•F-бокс белка форме крайне сжатые комплекс с Cul1, но kот SCF резко увеличивается на Cand1 и kот Cul1•Cand1 резко увеличилось Skp1•F-бокс белок6,7. Эти результаты обеспечивают поддержку первоначальных и критических для определения роли Cand1 как фактор обмена белков, который катализирует образование комплексов новых SCF путем переработки Cul1 от старых СКФ комплексами.

Здесь мы представляем процедура разработки и использования ладу assay для изучения динамики Cul1•Cand1 комплекс7, и тот же принцип может применяться для изучения динамики различных биомолекул. ЛАДУ происходит, когда донор возбужденных с соответствующей длины волны, и акцептора с перекрывающихся доноров спектр излучения спектра возбуждения присутствует на расстоянии 10-100 Å. Возбужденное состояние передается акцептор, тем самым уменьшается интенсивность доноров и увеличения интенсивности акцептора18. Эффективность ладу (E) зависит от радиуса Фёрстер (R0) и расстояние между доноров и акцепторов флуорофоров (r) и определяется: E = R06/ (R0 6 + r6). Радиус Фёрстер (R0) зависит от нескольких факторов, включая угловые ориентацию диполя, спектральные совпадения донорно акцепторной пара и решение используется19. Применять assay ладу на остановился потока fluorimeter, который отслеживает изменения выбросов доноров в режиме реального времени и обеспечивает измерение быстро kна и kот, необходимо создать эффективный ладу, приводит к значительному сокращению выбросов доноров. Таким образом проектирование эффективных ладу, выбрав соответствующие пары флуоресцентных красителей и сайтов на целевых белков прикрепить красители имеет важное значение и будут обсуждаться в настоящем Протоколе.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. дизайн assay ладу.

  1. Скачайте файл структуры Cul1•Cand1 комплекс из банка данных белков (файл 1U6G).
  2. Просмотр структуры комплекса в PyMOL Cul1•Cand1.
  3. Используйте функцию измерения под меню Мастер PyMOL оценить расстояние между первой amino acid Cand1 и последней амино кислоты Cul1 (рис. 1).
  4. Загрузить средство просмотра онлайн спектры (см. Таблицу материалы) и одновременно просматривать возбуждения и выбросов спектры 7-амино-4-methylcoumarin (AMC) и FlAsH (рис. 2). Обратите внимание, что АМС является донором ладу и FlAsH акцептор ладу.

Figure 1
Рисунок 1: Кристаллическая структура измерения расстояния между потенциал маркировки сайтов и Cul1•Cand1. Файл структуры Кристалл был загружен из банка данных белков (файл 1U6G) и в PyMOL. Измерения между отдельных атомов были сделаны PyMOL. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: возбуждение и выбросов спектры флуоресцентных красителей для ладу. Приведены спектры AMC (7-4-амино methylcoumarin) и FlAsH. Пунктирные линии показывают возбуждения спектров, и сплошной линии указывают выбросов спектров. Изображение первоначально порожденных флуоресценции SpectraViewer и был изменен для большей ясности. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

2. Подготовка Cul1 •Rbx1КУА, белок доноров ладу

  1. Постройте плазмиды для выражения человека Cul1sortase•Rbx1 в клетках E. coli . Обратите внимание, что два плазмид, совместно выражая человека Cul1•Rbx1 в клетках E. coli подробно описаны в предыдущем докладе20.
    1. Добавьте последовательность ДНК кодирования «LPETGGHHHHHH» (sortase его6 тег) 3' конца Cul1 кодирования последовательности через стандартное PCR и клонирования методы21,22.
    2. Последовательности новых плазмиду для подтверждения вставка гена является точной.
  2. Совместное Экспресс Cul1sortase•Rbx1 в клетках E. coli . Этот метод является производным от предыдущего доклада20.
    1. Смесь 100 нг двух плазмид с BL21 (DE3) химически сведущие клетки для совместного преобразования с использованием тепла шок метод23. Рост клеток на табличке агар LB, содержащие 100 мкг/мл Ампициллин и хлорамфеникол 34 мкг/мл при 37 ° C на ночь.
    2. Прививок 50 мл LB культуры с свежезаваренным преобразованные колоний и расти на ночь при 37 ° C встряхивании 250 об/мин. Это дает закваски.
    3. Прививок 6 колб, каждый с 1 Л LB средних, с 5 мл закваски и растут при 37 ° C с 250 об/мин, пожимая до од600 ~ 1.0. Cool культуры до 16 ° C и добавить изопропил β-D-thiogalactoside (IPTG) до 0,4 мм. Держите культуры на 16 ° C ночь встряхивании 250 об/мин.
    4. Урожай клеток E. coli путем центрифугирования в 5000 x g 15 мин и собирать клеток окатышей в 50 мл конические трубы.
      Примечание: Гранулы клетки могут быть обработаны для очистки белков или заморожены на-80 ° C, прежде чем продолжить шаги очистки белков.
  3. Очистка Cul1sortase•Rbx1 комплекс. Этот метод является производным от предыдущего доклада20.
    1. Добавьте 50 мл буфера lysis (30 мм трис-HCl, 200 NaCl, 5 мм DTT, 10% глицерина, 1 таблетка ингибитора протеазы коктейль, рН 7,6) Пелле клеток кишечной палочки , выражая Cul1sortase•Rbx1.
    2. Лизируйте клетки на льду с sonication на 50% амплитуды. Чередовать 1-второй и 1-секундный выключения и запустить на 3 мин.
    3. Повторите шаг 2.3.2 x 2-3.
    4. Передача lysate клетки в 50-мл центрифугирования трубку и удалить мусор клетки центрифугированием в 25000 х g 45 мин.
    5. Инкубируйте Светлоклеточная lysate с 5 мл глутатион бусы на 4 ° C на 2 ч.
    6. Центрифуга бусы lysate смеси на 1500 x g на 2 мин при 4 ° C. Удалите супернатант.
    7. Бусины с 5 мл буфера lysis (не ингибиторами протеазы) вымыть и удалить супернатант после центрифугирования в 1500 x g на 2 мин при 4 ° C.
    8. Повторите шаг 2.3.7 2 x.
    9. Добавить 3 мл буфера lysis промывают бусины и передача шлам бусины в пустой столбец.
    10. Добавьте 5 мл буфера (50 Tris-HCl, 200 мм мм NaCl, 10 мм уменьшена глутатиона, pH 8.0) в столбце. Проинкубируйте втечение 10 мин и собирать элюата.
    11. Повторите шаг 2.3.10 3-4 x.
    12. 200 мкл тромбина 5 мг/мл (см. Таблицу материалы) до элюата из бисера глутатиона и инкубировать на ночь при 4 ° C.
      Примечание: Протокол может быть приостановлена здесь.
    13. Разбавьте образец протеина с буфером A (25 мм HEPES, 1 мм DTT, 5% глицерина, рН 6,5) три раза.
    14. Сбалансировать столбец хроматографии катионного обмена (см. Таблицу материалы) на ПСОК систему с буфером а.
    15. Загрузите образец протеина в уравновешенной катионообмен хроматографии столбец со скоростью потока 0,5 мл/мин.
    16. Элюировать белка с градиентом NaCl в 40 мл, смешивая буфер A и 0 до 50% буфера B (25 мм HEPES, 1 M NaCl, 1 мм DTT, 5% глицерина, рН 6,5) при скорости потока 1 мл/мин.
    17. Проверьте eluted белка в различных фракций с использованием SDS-PAGE24.
      Примечание: Протокол может быть приостановлена здесь.
    18. Бильярд элюата фракций, содержащих Cul1sortase•Rbx1.
    19. Концентрат пула Cul1sortase•Rbx1 для образца 2,5 мл, передав в буфер через ультрафильтрационные мембраны (отсечки 30 кДа).
  4. Добавьте AMC C-конечная Cul1 через sortase опосредованной transpeptidation21,22.
    1. Изменить содержимое буфера в образце •Rbx1sortaseCul1 sortase буфер (50 мм трис-HCl, 150 мм NaCl, 10 мм2CaCl, рН 7,5) с помощью столбца опреснительные (см. Таблицу материалы).
      1. Сбалансировать опреснительной столбец с 25 мл буфера sortase.
      2. В столбце Загрузите 2,5 мл Cul1sortase•Rbx1 образца. Отказаться от потока через.
      3. Элюировать образца с 3,5 мл буфера sortase. Соберите потока через.
    2. В 900 мкл раствора •Rbx1sortaseCul1 в sortase буфера добавьте 100 мкл 600 мкм очищенный sortase A решения и 10 мкл пептид GGGGAMC 25 мм. Инкубируйте реакционной смеси при 30 ° C в темной ночи. Обратите внимание, что этот шаг будет генерировать Cul1КУА•Rbx1.
      Предупреждение: Флуоресцентными красителями чувствительны к свет, так что избежать, подвергая их воздействию окружающего света во время белковых и образец подготовки как можно больше.
      Примечание: Протокол может быть приостановлена здесь.
    3. Добавьте 50 мкл Ni-НТА агарозы бусины реакционной смеси и инкубации при комнатной температуре за 30 мин.
    4. Пелле бусины агарозы Ni-НТА центрифугированием в 5000 x g на 2 мин и собирать супернатант.
    5. Сбалансировать размер столбца исключение хроматографии (см. Таблицу материалы) с буфером (30 мм трис-HCl, 100 мм NaCl, 1 мм DTT, 10% глицерина) на ПСОК систему.
    6. Загрузить все Cul1КУА•Rbx1 образца на столбце хроматографии исключения размер. Элюировать объемом 1.5 x столбца буфера.
    7. Проверьте элюата фракций, SDS-PAGE24.
    8. Бассейн элюата фракций, содержащих Cul1КУА•Rbx1.
    9. Измерить концентрацию белка, используя его поглощения в 280 Нм с спектрофотометром.
    10. Алиготе раствор белка и хранить при температуре-80 ° C.
      Примечание: Протокол может быть приостановлена здесь.

3. Подготовка FlAsHCand1, белок акцептора ладу

Примечание: Большинство из шагов в этой части являются так же, как шаг 2. Ниже подробно описаны условия, которые отличаются.

  1. Постройте плазмиду для выражения человека TetraCysCand1 в клетках E. coli .
    1. Добавление последовательности ДНК кодирования «CCPGCCGSG» (tetracysteine/TetraCys тег) до 15й аминокислоты из Cand1 через регулярные ПЦР25 (грунтовка последовательности: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. Вставьте продукт PCR в pGEX 4Т-2 вектора. Последовательность плазмиду для подтверждения вставка гена является точной и в кадре.
  2. Экспресс TetraCysCand1in E. coli клетки в так же, как шаг 2.2, за исключением того, что плазмида преобразуется в Rosetta сведущие клетки.
  3. Очистка TetraCysCand1 из клеток кишечной палочки .
    1. Лизировать гранулы клеток кишечной палочки и экстракт TetraCysCand1using глутатиона бусины. Эти шаги являются так же, как 2.3.1–2.3.12 шаги.
    2. Разбавьте элюата белка из бисера глутатиона с буфера C (50 мм трис-HCl, 1 мм DTT, 5% глицерина, pH 7.5), три складки. Сбалансировать столбец хроматографии обмену анионов (см. Таблицу материалы) на ПСОК систему с буфера C и нагрузки образец разбавленный протеина при скорости потока 0,5 мл/мин.
    3. Элюировать белка с градиентом NaCl в 40 мл, смешивая буфера C и 0 до 50% D буфера (50 мм трис-HCl, 1 M NaCl, 1 мм DTT, 5% глицерина, рН 7,5) при скорости потока 1 мл/мин. Проверьте eluted белка в различных фракций с использованием SDS-PAGE24и бассейн фракций, содержащих TetraCysCand1. Обратите внимание, что TetraCysCand1 имеет больший объем хранения чем бесплатно GST.
    4. Концентрат пула TetraCysCand1 образца, передав в буфер через ультрафильтрационные мембраны (30 кДа отсечки).
    5. Сбалансировать размер исключения хроматографии столбец с маркировки буфера (20 мм трис-HCl, 100 мм NaCl, 2 TCEP, 1 мм ЭДТА, 5% глицерина) на ПСОК систему. Загрузить образец TetraCysCand1 (500 мкл каждый раз) и проверьте элюата фракций SDS-PAGE24.
    6. Объединить всех фракций, содержащих TetraCysCand1 и концентрата белка до ~ 40 мкм, передав в буфер через ультрафильтрационные мембраны (30 кДа отсечки). Оценить концентрацию белка, используя его поглощения в 280 Нм. Хранить белка как 50 мкл аликвоты-80 ° c.
      Примечание: Протокол может быть приостановлена здесь.
  4. Подготовка флэш-Cand1.
    1. 1 мкл флэш-решения (см. Таблицу материалы) до 50 мкл TetraCysCand1 решения.
    2. Хорошо перемешайте и инкубировать смесь при комнатной температуре в темноте для 1-2 h получить FlAsHCand1.
      Примечание: Протокол может быть приостановлена здесь.

4. Подготовка Cand1, Чейз белка ладу

Примечание: Белка подготовка протокол похож на шаг 3, со следующими изменениями.

  1. Вставьте кодирующая последовательность полнометражные Cand1 в pGEX 4Т-2 вектора.
  2. Измените буфер, используемый на шаге 3.3.5 буфер, содержащий 30 мм трис-HCl, 100 мм NaCl, 1 мм DTT, 10% глицерина.
  3. Ликвидировать шаги 3.3.7 и 3.3.8.

5. проверить и подтвердить пробирного ладу

  1. Подготовить ладу буфер, содержащий 30 мм трис-HCl, 100 мм NaCl, 0.5 мм DTT, овальбумина 1 мг/мл, pH 7,6 и использовать при комнатной температуре.
  2. Испытания Лада между Cul1 •Rbx1КУАи флэш-Cand1 на fluorimeter.
    1. Добавьте Cul1 в 300 мкл буфера ладу,AMC•Rbx1 (ладу доноров) до конечной концентрации 70 нм. Передача решения в кювет.
    2. Поместите кювету в держателе образца fluorimeter. Возбуждают образца с 350 Нм возбуждения светом и проверки выбросов сигналы от 400 Нм до 600 Нм при 1 нм с шагом.
    3. Повторите шаг 5.2.1, но изменения Cul1КУА•Rbx1 для FlAsHCand1 (ладу акцептор). Сканировать в образце Cand1 FlAsH, используя тот же метод, что и в шаге 5.2.2.
    4. (Необязательно) Возбуждают FlAsHCand1 возбуждения светом 510 нм и проверки выбросов сигнал от 500 Нм до 650 Нм.
    5. Добавьте в 300 мкл буфера ладу, оба Cul1КУА•Rbx1 и FlAsHCand1 до конечной концентрации 70 нм. Анализ образца таким же образом, как в шаге 5.2.2.
  3. Подтвердить Лада между Cul1 •Rbx1КУАи FlAsHCand1 путем добавления белка Чейз (немеченого Cand1) (рис. 3 c).
    1. Добавьте в 300 мкл буфера ладу, 70 нм Cul1КУА•Rbx1 и 700 Нм Cand1. Проверка образца выбросов как шаг 5.2.2.
    2. Добавьте в 300 мкл буфера ладу, 70 нм FlAsHCand1 и 700 Нм Cand1. Проверка образца выбросов как шаг 5.2.2.
    3. Добавьте в 300 мкл буфера ладу, 70 нм Cul1КУА•Rbx1 и 70 нм FlAsHCand1 и Проинкубируйте образцы при комнатной температуре в течение 5 мин. Затем добавить 700 Нм Cand1 и сразу же после того, сканирования образца выбросов как шаг 5.2.2). Обратите внимание, что этот шаг похож на шаг 5.2.5.
    4. В 300 мкл буфера ладу, последовательно добавить 70 нм Cul1КУА•Rbx1, 700 Нм Cand1 и 70 нм FlAsHCand1. Инкубировать образца при комнатной температуре в течение 5 мин и проверки образцов выбросов как шаг 5.2.2. Обратите внимание, что это пример Чейз (зеленая линия на рис. 3 c).

6. Измерьте константа скорости ассоциации (kна) по Cul1•Cand1

Примечание: Детали работы остановлены потока fluorimeter были описаны в предыдущем докладе26.

  1. Подготовьте остановить поток fluorimeter для измерения.
    1. Включите fluorimeter остановить поток согласно инструкции производителя.
    2. Установите возбуждения света на 350 Нм и использование полосовой фильтр, который позволяет 450 Нм выбросов свет пройти и блокирует 500-650 Нм выбросов света.
    3. Держите образца клапанов на заполнить позиции и подключить 3 мл шприц с водой. Путем перемещения образца шприц диск вверх и вниз несколько раз промойте водой два образца шприцы (A и B). Отменить все воды, используемой в этом шаге.
    4. Держите образца клапанов на заполнить позиции и подключить 3 мл шприц, заполнены с буфером ладу. Мыть два образца шприцы с буфером ладу, перемещая образца шприц диск вверх и вниз несколько раз. Отменить все буфера ладу, используемые на этом шаге.
  2. Возьмите измерения управления (рис. 4 c).
    1. Подключите 3 мл шприц и загрузить шприц А с 100 Нм Cul1КУА•Rbx1 в буфере ладу. Поверните клапан образца в положение диска .
    2. Подключите 3 мл шприц и загрузить B шприц с буфером ладу. Поверните клапан образца в положение диска .
    3. Используйте Панель управления при приобретении программного обеспечения принять пять выстрелов (смешать равные количества образцов из шприца A и B шприц) на fluorimeter остановить поток без записи результатов.
    4. Откройте Панель управления при приобретении программного обеспечения и программа для записи выбросов Cul1КУА более 60 s. Затем принять ни одного выстрела.
    5. Повторите шаг 6.2.4 2 x.
    6. Поверните клапан образца для заполнения позиции. Пустой шприц B и мыть с буфером ладу.
  3. Мера, наблюдается ассоциации константы скорости (kobs) Cul1•Cand1 (рис. 4В).
    1. Держите образец в шприц А так же, как и шаг 6.2.1.
    2. Подключите 3 мл шприц и загрузить B шприц с 100 Нм FlAsHCand1 в буфере ладу. Поверните клапан образца в положение диска .
    3. Используйте Панель управления при приобретении программного обеспечения принять пять выстрелов без записи результатов.
    4. Откройте Панель управления при приобретении программного обеспечения и программа для записи выбросов Cul1КУА более 60 s. Затем принять ни одного выстрела.
    5. Повторите шаг 6.3.4 2 x.
    6. Пустой шприц B и мыть с буфером ладу.
    7. Повторите шаги 6.3.1–6.3.6 несколько раз с увеличением концентрации FlAsHCand1 в буфере ладу.
    8. Изменение (уменьшение) помещается в флуоресцентные сигналов измеряется временем от каждого выстрела для экспоненциальной кривой. Это даст kobsв каждом измерении, и подразделение-s-1. Обратите внимание, что основой такого расчета хорошо обсуждался в предыдущем докладе27.
  4. Вычислить среднее и стандартное отклонение kobsдля каждой концентрации Cand1 FlAsH. Участок средняя kobsпротив концентрации Cand1 (рис. 4 d), и наклон линии представляет kна Cul1•Cand1, с блоком M-1 s-1.

7. Измерьте скорость Константа диссоциации (kвыкл) из Cul1•Cand1 в присутствии белка Skp1•F-бокс.

Примечание: Этот шаг похож на шаге 6, со следующими изменениями.

  1. В шприц А, под заполнить позиции, загрузите решение 100 Нм Cul1КУА•Rbx1 и 100 Нм FlAsHCand1 в буфере ладу. Поверните клапан образца в положение «Драйв».
  2. В шприц B под заполнить позиции, загрузите решение Skp1•Skp2 (подготовлен после предыдущего доклада20). Поверните клапан образца в положение «Драйв».
  3. Откройте Панель управления при приобретении программного обеспечения и программа для записи выбросов Cul1КУА более 30 s. Затем принять ни одного выстрела. Флуоресцентный сигналы увеличить со временем после смешивания решения из шприца A и B шприца (рис. 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Для тестирования в ладу между Cul1КУА и FlAsHCand1, мы сначала определили интенсивности выбросов 70 нм Cul1AMC (донора) и 70 нм FlAsHCand1 (акцептор), соответственно (Рисунок 3А-C, синие линии). В каждом анализе только один пик выбросов был подарок, а также выбросов FlAsHCand1 (акцептор) был низким. Когда 70 нм каждый Cul1КУА и FlAsHCand1 были смешанные для создания ладу, два пиковых выбросов были представлены в спектрах выбросов и пик Cul1КУА стал ниже, и пик FlAsHCand1 стал выше (Рисунок 3A -C, красные линии). Когда полнометражные Cand1 был использован для ладу, пик доноров показал 10% снижение интенсивности (рис. 3A, красная линия), и Cand1 с его первого helix усечены был использован, снижение интенсивности пик доноров было увеличено до 30% (рис. 3B -D, красные линии), предлагая высокую эффективность ладу. Чтобы убедиться, что сигнал изменения были результатом Лада между Cul1КУА и FlAsHCand1, 70 нм Cul1AMC (донора) была смешана с 700 Нм без маркировки Cand1 (Чейз) и 70 нм FlAsHCand1 (акцептор). В результате, пик доноров был полностью восстановлен и акцептор пик снижалась (рис. 3 c, зеленая линия), который подтвердил, что наблюдаемые ладу зависит от формирования Cul1AMCфлэш-Cand1 комплекс. Добавление 700 Нм Skp1•Skp2 в 70 нм Cul1КУАFlAsHCand1 также полностью восстановлен доноров пик (Рисунок 3D, зеленая линия), предполагая, что комплекс Cul1•Cand1 была полностью нарушена Skp1•Skp2 в равновесие.

Figure 3
Рисунок 3: представитель ладу assay для формирования сложных Cul1•Cand1. Образцы в буфере ладу (30 мм трис-HCl, 100 NaCl, 0.5 мм DTT, овальбумина 1 мг/мл, pH 7,6) были рады на 350 Нм, а выбросы были отсканированы от 400 Нм до 650 Нм. (A) спектры выбросов 70 нм Cul1КУА, 70 нм флэш-Cand1 (полная) и смесь двух (ЛАДА). Cand1 (полная) выступает за полную длину Cand1. (B) спектры выбросов 70 нм Cul1КУА, 70 нм FlAsHCand1 и смесь двух (ЛАДА). Cand1 с его первого helix удален был использован в этом эксперименте и в последующий период. (C) спектры выбросов 70 нм Cul1КУА, 70 нм FlAsHCand1, смесь двух (лад) и погони управления для Лада (Чейз). В образце Чейз содержится 70 нм Cul1КУА, 700 Нм Cand1 и 70 нм FlAsHCand1. (D) спектры выбросов 70 нм Cul1КУА, смесь 70 нм Cul1КУА и 70 нм FlAsHCand1 (лад) и 700 Нм Skp1•Skp2 добавлены 70 нм Cul1КУАфлэш-Cand1 комплекс. В каждом участке, были нормализованы сигналы выбросов для выбросов 70 нм Cul1AMC на 450 Нм. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Для измерения kна Cul1•Cand1 с помощью установленных assay ладу, мониторинг сокращения доноров сигнала со временем на fluorimeter остановить поток, мы сначала протестированы и определена концентрация белка для использования. Когда 5 Нм каждый Cul1КУА и FlAsHCand1 были использованы, очень мало изменений сигнала было отмечено (рис. 4A), тогда как, когда концентрация каждого белка была увеличена до 50 Нм, наблюдалось снижение сигнала со временем ( Рисунок 4B) и это изменение было отменено, если буфер без FlAsHCand1 был добавлен (рис. 4 c). Таким образом, 50 Нм Cul1AMC был использован для дальнейшего анализа, и ряд наблюдаемых ассоциации константы скорости (kobs) были измерены путем смешивания 50 Нм Cul1КУА с увеличением концентрации FlAsHCand1. kobs для каждого эксперимента была рассчитана путем установки точки для экспоненциальной кривой, и были среднем kobs , полученные от такой же концентрации FlAsHCand1. Заговоре средняя kobs с концентрацией Cand1 и выполняет линейную регрессию (рис. 4 d), kна был решительным7,27.

Figure 4
Рисунок 4: представитель измерение константа скорости ассоциации. (A) флуоресценции 5 Нм Cul1КУА контролируется fluorimeter остановить поток со временем после добавления 5 Нм FlAsHCand1. (B) флуоресценции 50 Нм Cul1КУА контролируется fluorimeter остановить поток со временем после добавления 50 Нм FlAsHCand1. (C) флуоресценции 50 Нм Cul1КУА контролируется fluorimeter остановить поток со временем при добавлении ладу буфера. (D) kна Cand1 привязки к Cul1. kobs Cul1•Cand1 в различных концентрациях Cand1 строятся. Линейные склона дает kна 1.8 x 107 M-1 s-1. Планки погрешностей представляют ±SEM; n = 4. Все образцы были подготовлены в буфере ладу и возбужденных в 350 Нм. Полосовой фильтр был использован для сбора сигналов от КУА и исключить сигналы из FlAsH. Данные не были нормализованы. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Подобно к измерению kна, мы измерили наблюдаемых диссоциации константа скорости по Cul1•Cand1 путем наблюдения за увеличение (восстановление) сигнала доноров со временем на fluorimeter остановить поток. Cul1КУА и FlAsHCand1 были сначала, а затем Skp1•Skp2 был добавлен к креплению Cul1КУАфлэш-Cand1 на fluorimeter остановить поток. Сигнал доноров увеличилось быстро и он показал kobs 0.4 s-1 (рис. 5). В отличие от этого, когда буфер был добавлен к креплению Cul1AMCFlAsHCand1, наблюдался рост не сигнал, предлагая быстрый диссоциации Cul1•Cand1 было вызвано Skp1•Skp2.

Figure 5
Рисунок 5: представитель измерение константы диссоциации. Изменения в флуоресцировании доноров против времени была измерена после добавления 150 Нм Skp1•Skp2 или ладу буфера до 50 Нм Cul1КУАFlAsHCand1 комплекса. Сигнал изменения были пригодны для экспоненциальной кривой, и это дает константа скорости наблюдается диссоциации 0.4 s-1. Экспериментальные условия были аналогичны описанным на рисунке 4. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Лада-это физическое явление, которое представляет большой интерес для изучения и понимания биологических систем19. Здесь мы представляем собой протокол для тестирования и использования лад для изучения кинетики привязки двух взаимодействующих белков. При проектировании ладу, мы рассмотрели три основных фактора: спектральный перекрытие между донорами выбросов и акцептор возбуждения, расстояние между двумя флуорофоров и ориентацию диполя флуорофоров28. Чтобы выбрать флуорофоров для ладу, мы обложил возбуждения и выбросов спектры флуорофоров и искали флуорофоров, вершины которых выбросов хорошо отделены в то время как спектр излучения доноров значительно перекрывает с возбуждением спектр акцептор (рис. 2). Чтобы оптимизировать расстояние interfluorophore и ориентации, мы использовали кристаллической структуры для оказания помощи, и мы главным образом рассмотрены, придавая флуорофоров белка Термини, главным образом благодаря более низкий риск нарушения структуры белков и деятельности. Потому что расстояние между N-го Cand1 (Cand1ДНТ) и C-конечная Cul1 (Cul1КТР) меньше, чем расстояние между C-конечная Cand1 и N-го Cul1 (рис. 1), мы решили обозначить Cand1НТД и Cul1КТР. Потому что мы смогли добиться маркировки эффективности 80%-90% N-го белка с помощью тега tetracysteine25, мы решили обозначить Cand1НТД с помощью тега tetracysteine флэш. Мы изначально помечены Cul1КТР с голубой флуоресцентный белок (СЛП), который имеет несколько преимуществ над AMC. Во-первых это генетически закодированный флуоресцентные метки, поэтому оно не требует дополнительной маркировки процесс, ни шагов, которые очищают помечены флуоресцентный белок от неподписанных прекурсоров. Во-вторых, СЛП ярче, чем AMC, и таким образом, он предлагает более высокая чувствительность анализа (см. обсуждение ниже). В-третьих СЛП имеет большего спектра совпадают с FlAsH, потенциально приносит более эффективные ладу с FlAsH. Однако, несмотря на эти преимущества, СЛП белок гораздо больше, чем AMC тег, который может помешать конформации белка и между молекулярного взаимодействия. Действительно, мы не наблюдали Лада между Cul1CFP и FlAsHCand1 в нашем тесте, которая, вероятно, из-за неадекватной диполя ориентации, или нарушение Cul1-Cand1 взаимодействия по тегу СЛП. Мы затем помечены Cul1КТР с КУА, и мы наблюдали Лада между Cul1КУА и FlAsHCand1. Первоначальный ладу, используя полнометражные Cand1 привело к 10% сокращения выбросов доноров (рис. 3A). Мы также обнаружили, что, исключив первый спирали Cand1, расстояние между Cul1 и Cand1 сокращается от 26,8 Å до 15,5 Å (рис. 1) и Cand1 не хватает первого helix принесли a гораздо сильнее ладу с Cul1, показаны 30% сокращения выбросов доноров пик (рис. 3B). Кроме того одно может повысить эффективность ладу, выбрав донора, Флюорофор с высокой доходности квантовой и акцепторной Флюорофор с коэффициентом большие вымирания.

Характерной особенностью ладу является то, что когда происходит ладу, выброс снижается доноров и выбросов акцептора увеличивается (рис. 3B). Однако флуорофоров может отображать чувствительность к их окружающей среде, и таким образом, интенсивность выбросов может измениться, когда другой белок присутствует, даже в отсутствие ладу29. Чтобы убедиться, что изменения выбросов, мы наблюдали за ладу между Cul1КУА и FlAsHCand1, мы добавили 10 x избыточное количество белка немеченого акцептора (Cand1) как погони. Чейз преобразует излучение донора и акцептор обратно к нормальному уровню (рис. 3 c), который поддерживает что изменения выбросов Cul1КУА и флэш-Cand1 зависит от взаимодействия протеин протеина и, следовательно, этот результат подтверждает, что мы создали assay ладу, который сообщает Ассоциация и диссоциации Cul1•Cand1. Кроме того, мы добавили Skp1•Skp2 креплению Cul1 комплексAMCFlAsHCand1 и Skp1•Skp2 известно чтобы иметь возможность нарушить взаимодействие Cul1-Cand16. Мы обнаружили, что ладу между Cul1КУА и FlAsHCand1 исчез (рис. 3D, зеленая линия) и спектр излучения стал похож на спектр излучения Чейз образца (рис. 3 c, зеленая линия), предлагая •КУАCul1FlAsHCand1 отделить Skp1•Skp2 и Cul1КУА не отображать аномальные выбросов при наличии Skp1•Skp2.

Отслеживая изменения в выбросах доноров, мы можем непосредственно наблюдать ассоциации и диссоциации Cul1КУАфлэш-Cand1 на fluorimeter остановить поток. Система остановлена потока работает путем инъекций реактивы в смесительную камеру быстро смешать реактивы и остановки потока, когда смешанные реактивы перемещаются в камеры наблюдения5. Сигнал обнаружения обычно начинается 1-2 миллисекунды (МС) после перемешивания, что позволяет изучать взаимодействия, которые происходят на шкале времени миллисекунду. Однако когда период полураспада наблюдаемых реакции короче времени, необходимого для смешать реактивы на определенном устройстве, этот подход не является достаточно чувствительным и больше не является соответствующей30. Были использованы остановлен поток анализ для определения константы скорости в диапазоне s – 106 10-6-1 для реакции первого порядка и 1 – 109 M-1 s-1 для реакции второго порядка5. Чтобы получить надежное измерение кинетических параметров с использованием fluorimeter остановить поток, необходимо значительное изменение флуоресцентного сигнала между точки начала и равновесия. Мы использовали FlAsHCand1 хватает первую спираль как акцептор, потому что он дает лучше МУЧИТЬСЯ с Cul1КУАи мы тестирование концентрация белков, которые будут использоваться для измерения. Когда 5 Нм каждый Cul1КУА и FlAsHCand1 были смешаны, никаких изменений в Cul1 сигналAMC было отмечено (рис. 4A), предлагая это концентрация является недостаточным для измерения. Когда концентрация белка были увеличены до 50 Нм, уменьшение Cul1 сигналAMC со временем стал очевидным (рис. 4B), и это изменение не происходит, когда белок акцептора отсутствовал (рис. 4 c). На основании этого результата, мы использовали Cul1AMC на 50 Нм коалиции для измерения kна Cul1•Cand1. Концентрация белка доноров, используемых для измерения может меняться, когда используются различные флуорофоров. Например, когда Cul1 помечены СЛП, 5 Нм CFPCul1 достаточно для измерения kна6. Таким образом оптимальная концентрация белка должно испытываться для каждой пары лад, и в принципе, ярче флуорофоров позволяют использовать более низкие концентрации белка и обеспечить лучшее соотношение сигнал шум31.

Для изучения взаимодействия протеин proteina лад, он требует, придавая флуорофоров белков на соответствующие должности без нарушения структуры белков и деятельности, которая потенциально ограничивает использование ладу. В этом протоколе мы помечены N-го Cand1 с помощью тега tetracysteine, который специально связывает FlAsH краска и FlAsH краска становится люминесцентные, только после того, как он связывает целевой белок32. Мы помечены Cul1 с помощью sortase опосредованной transpeptidation, который придает короткие пептиды, проведения Флюорофор в sortase тег на C-конечная Cul121,22. Маркировка энергоэффективности является > 80% с помощью тега tetracysteine и почти 100% с помощью тега sortase его6 после удаления непрореагировавшего белка, с помощью Ni-НТА бусины (шаги 2.4.3–2.4.4). Оба метода добавьте несколько аминокислоты целевого белка, представляя минимальные изменения в структуре белка. Аналогичные подходы, такие как Трансглютаминаза признание последовательности (Q-тег)33 и тег ybbR34, может также использоваться для обозначения целевого белка на основе конкретных участков. Кроме того светостойкость флуоресцентных красителей могут также ограничить использование ладу. Повторяющиеся или длительного воздействия возбуждения света может привести к Фотообесцвечивание Флюорофор, что приводит к неточной квантификации результаты35. Таким образом доноров и акцепторов белки должны быть защищены от света во время приготовления и хранения шаги. При использовании лад для измерения события, которые происходят медленно, а не постоянно отслеживает изменения в доноров выбросов с течением времени, короткие чтений эмиссии доноров должно быть принято на более длительные интервалы времени и образец должны храниться в темноте в течение всего 6эксперимент.

Потому что ладу чувствительных и количественных, он стал важным инструментом для изучения взаимодействия между макромолекул. Этот протокол представляет собой пример использования лад для изучения динамики белкового комплекса в растворе. Лада также были использованы вместе с живой клетки imaging для изучения молекулярных взаимодействий в живых клетках36, который является мощным в выявление динамики белковых комплексов в физиологических условиях. Кроме того лад может также использоваться на уровне одной молекулы для изучения в реальном времени динамику макромолекулярных комплексов37,38, обеспечивая понимание конформационные изменения комплекса. Для повышения эффективности и выявления ладу, флуорофоров и биодатчиков с повышение яркости и светостойкость представляют большой интерес, которые активно разработаны и изучал28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы благодарим Шу-Ou Шань (Калифорнийский технологический институт) за глубокий дискуссии о развитии assay ладу. М.г., ВМФ и X.L. финансировались запуска средств из Университета Пердью в ВМФ и X.L.This работы была частично поддержана семян грант от центра Университета Purdue для биологии растений.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics