Bruger i Vitro fluorescens resonans energioverførsel at studere dynamikken i proteinkomplekser på en millisekund tidsskala

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Protein-protein interaktioner er kritisk for biologiske systemer, og undersøgelser af bindende kinetik give indsigt i den dynamik og funktion af proteinkomplekser. Vi beskriver en metode, der kvantificerer kinetiske parametre for et proteinkompleks ved hjælp af fluorescens resonans energioverførsel og stoppede strømmen teknik.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Proteiner er de primære aktører i biologiske systemer, og de interagerer normalt med andre makro- eller små molekyler til at udføre deres biologiske funktioner. Sådanne interaktioner kan være meget dynamisk, hvilket betyder de interagerende underenheder er konstant forbundet og adskilt til bestemte priser. Mens måling bindende affinitet ved hjælp af teknikker, såsom kvantitative pull-down afslører styrken af interaktion, studerer bindende kinetik giver indsigt i, hvordan hurtigt vekselvirkningen opstår og hvor længe hver kompleks kan eksistere. Derudover måling kinetik af en interaktion ved tilstedeværelse af en yderligere faktor, som et protein udveksling faktor eller et stof, hjælper afslører den mekanisme, hvormed samspillet er reguleret af den anden faktor, give vigtig viden til de fremme af biologisk og medicinsk forskning. Her, beskriver vi en protokol til måling af den bindende kinetik af et protein kompleks, der har en høj iboende association og kan adskilles hurtigt af et andet protein. Metoden bruger fluorescens resonans energioverførsel rapportere dannelsen af protein kompleks in vitro, og det giver mulighed for overvågning af hurtig association og dissociation af kompleks i realtid på en stoppet-flow fluorimeter. Ved hjælp af denne analyse, er association og dissociation sats konstanter protein kompleks kvantificeret.

Introduction

Biologiske aktiviteter udføres i sidste ende af proteiner, mest som interagerer med andre for ordentlig biologiske funktioner. Brug af et beregningsprogram tilgang, den samlede mængde protein-protein interaktioner i menneskelige skønnes for at være ~ 650.0001, og afbrydelse af disse interaktioner ofte fører til sygdomme2. På grund af deres væsentlige roller i at kontrollere cellulært og kropsligt processer, er talrige metoder blevet udviklet for at studere protein-protein interaktioner, såsom gær-to-hybrid, bimolecular fluorescens komplementering, split-luciferase komplementering, og co-immunoprecipitation assay3. Mens disse metoder er gode til at opdage og bekræfter protein-protein interaktioner, de er normalt ikke-kvantitative og dermed giver begrænsede oplysninger om affinitet mellem de interagerende protein partnere. Kvantitative pull-downs kan bruges til at måle bindingsaffinitet (f.eks. dissociationskonstant Kd), men det måle ikke kinetik af bindingen, og heller ikke kan det anvendes når Kd er meget lav på grund af en utilstrækkelig signal-støj-forholdet4. Overflade plasmon resonans (SPR) spektroskopi kvantificerer bindende kinetik, men det kræver en specifik overflade og immobilisering af en reaktant på overfladen, som potentielt kan ændre egenskaben binding af reaktanter5. Desuden er det vanskeligt for SPR at måle hurtig association og dissociation satser5, og det er ikke hensigtsmæssigt at bruge SPR for at karakterisere begivenhed for at udveksle protein underenheder i et proteinkompleks. Her, beskriver vi en metode, der giver mulighed for måling af satserne for protein kompleks samling og demontering på en millisekund tidsskala. Denne metode var afgørende for bestemmelse af Cullin -enssociated -Nedd8 -dissociated protein 1 (Cand1) betydning som F-boks protein udveksling faktor6,7.

Cand1 regulerer dynamikken i Skp1•Cul1•F-box protein (SCF) E3 ligases, som hører til den store familie af Cullin søerne-RING ubiquitin ligases. SCFs består af cullin Cul1, som binder RING domæne protein Rbx1, og et udskifteligt F-boks protein, som rekrutterer substrater og binder Cul1 gennem adapter protein Skp18. Som en E3 ligase, SCF katalyserer konjugation af ubiquitin til sit bæremateriale, og det er aktiveret når substratet er rekrutteret af F-boks protein, og når Cul1 er ændret af ubiquitin-lignende protein Nedd89. Cand1 binder umodificeret Cul1, og efter bindende, det forstyrrer både sammenslutningen af Skp1•F-box protein med Cul1 og konjugering af Nedd8 til Cul110,11,12,13. Som følge heraf Cand1 syntes at være en hæmmer af SCF aktivitet in vitro, men Cand1 mangel i organismer forårsaget defekter, der antyder en positiv rolle i Cand1 i reguleringen af SCF aktiviteter i vivo14,15,16 , 17. dette paradoks blev endelig forklares ved en kvantitativ undersøgelse, der afslørede de dynamiske interaktioner blandt Cul1, Cand1 og Skp1•F-box protein. Ved hjælp af fluorescens resonans energi overførsel (FRET) assays, der registrerer dannelsen af de videnskabelige komité for levnedsmidler og Cul1•Cand1 komplekser, association og dissociation Vurder konstanter (k og kud, henholdsvis) var målt individuelt. Målingerne viste, at både Cand1 og Skp1•F-box protein form yderst stramme kompleks med Cul1, men de kud af SCF øges dramatisk af Cand1 og den kud af Cul1•Cand1 øges dramatisk af Skp1•F-box protein6,7. Disse resultater giver den første og afgørende støtte for definitionen af Cand1 som et protein udveksling faktor, som katalyserer dannelsen af nye SCF komplekser gennem genbrug Cul1 fra de gamle SCF komplekser.

Her præsenterer vi proceduren for udvikling og anvendelse af FRET analysen for at studere dynamikken i Cul1•Cand1 komplekse7, og det samme princip kan anvendes for at studere dynamikken i forskellige biomolekyler. FRET opstår, når en donor er spændt med den passende bølgelængde, og en acceptor med excitation spektrum overlappende donor emission spektrum er til stede inden for en afstand på 10-100 Å. Den eksiterede tilstand er overført til acceptor, dermed faldende donor intensitet og øge acceptor intensitet18. FRET (E) effektivitet afhænger af både Förster radius (R0) og afstanden mellem donor og acceptor fluorophores (r), og er defineret af: E = R06/ (R0 6 + r6). Förster radius (R0) afhænger af et par faktorer, herunder dipol kantede orientering, den spektrale overlapning af donor-acceptor par, og løsningen anvendes19. Hvis du vil anvende FRET analysen på en stoppet-flow fluorimeter, som overvåger ændringen af donor emission i realtid og gør det muligt for målinger af hurtig k og kud, det er nødvendigt at fastlægge effektive FRET der resulterer i en betydelig reduktion af donor emission. Derfor udforme effektive FRET ved at vælge den passende par fluorescerende farvestoffer og websteder på target proteiner til at vedhæfte farvestofferne er vigtig og vil blive drøftet i denne protokol.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. design FRET assay.

  1. Hent filen struktur af komplekse Cul1•Cand1 fra Protein Data Bank (fil 1U6G).
  2. Se strukturen i Cul1•Cand1 kompleks i PyMOL.
  3. Brug funktionen måling under menuen guiden af PyMOL for at anslå afstanden mellem den første aminosyre i Cand1 og den sidste aminosyre i Cul1 (figur 1).
  4. Indlæse online spectra fremviseren (Se Tabel af materialer) og se excitation og emission spektre af 7-amino-4-cumarin (AMC) og FlAsH samtidig (figur 2). Bemærk at AMC FRET donor og FlAsH er FRET acceptor.

Figure 1
Figur 1: krystalstruktur af Cul1•Cand1 og måling af afstanden mellem potentiale mærkning websteder. Krystal struktur fil blev hentet fra Protein Data Bank (fil 1U6G), og set i PyMOL. Målinger mellem valgte atomer blev udført af PyMOL. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: excitation og emission spektre af fluorescerende farvestoffer til FRET. Spektre af AMC (7-amino-4-cumarin) og FlAsH er vist. Stiplede linjer angiver excitation spektre, og solid linjer angiver emission spektre. Billedet var oprindeligt genereret af fluorescens SpectraViewer og blev ændret for bedre klarhed. Venligst klik her for at se en større version af dette tal.

2. forberedelse af Cul1AMC•Rbx1, FRET donor protein

  1. Konstruere plasmider for at udtrykke menneskelige Cul1sortase•Rbx1 i E. coli celler. Bemærk at de to plasmider Co udtrykker menneskelige Cul1•Rbx1 i E. coli celler er beskrevet i detaljer i en tidligere betænkning20.
    1. Tilføje en DNA sekvens kodning "LPETGGHHHHHH" (sortase, hans6 tag) til 3'-enden af Cul1 kodende sekvens gennem standard PCR og kloning metoder21,22.
    2. Sekvens den nye plasmid for at bekræfte gen Indsæt er korrekt.
  2. Co express Cul1sortase•Rbx1 i E. coli celler. Metoden er afledt fra en tidligere rapport20.
    1. Mix 100 ng hver af de to plasmider med BL21 (DE3) kemisk kompetente celler for Co transformation ved hjælp af varmen chok metode23. Vokse celler på LB agar plade med 100 µg/mL ampicillin og 34 µg/mL chloramphenicol ved 37 ° C natten over.
    2. Podes 50 mL af LB kultur med frisk transformerede kolonier og vokse natten over ved 37 ° C med 250 rpm ryster. Dette giver en igangsætter kultur.
    3. Podes 6 flasker, hver med 1 L af LB medium, med 5 mL starter kultur hver og vokse ved 37 ° C med 250 rpm ryster indtil OD600 er ~ 1.0. Cool kultur til 16 ° C og tilføje isopropyl-β-D-thiogalactoside (IPTG) til 0,4 mM. Holde kulturen ved 16 ° C natten over med 250 rpm ryster.
    4. Høste E. coli celler gennem centrifugering ved 5.000 x g i 15 min. og indsamle celle pellets i 50 mL konisk rør.
      Bemærk: Celle pellets kan behandles for protein oprensning eller fryses ved-80 ° C, før du fortsætter til protein oprensning trin.
  3. Rensning af Cul1sortase•Rbx1 kompleks. Denne metode er afledt fra en tidligere rapport20.
    1. Der tilsættes 50 mL af lysisbuffer (30 mM Tris-HCl, 200 mM NaCl, 5 mM DTT, 10% glycerol, 1 tablet af protease hæmmer cocktail, pH 7,6) til E. coli celler udtrykker Cul1sortase•Rbx1 pellet.
    2. Lyse celler på isen med sonikering på 50% amplitude. Veksler mellem 1-other ON og 1-other OFF og køre i 3 min.
    3. Gentag trin 2.3.2 2-3 x.
    4. Overføre cellen lysate ind i en 50 mL centrifugering rør og fjerne celle debris ved centrifugering ved 25.000 x g i 45 min.
    5. Inkuber cellen klare lysate med 5 mL af glutathion perler ved 4 ° C i 2 timer.
    6. Centrifugeres perler-lysate blandingen på 1.500 x g i 2 min. ved 4 ° C. Fjern supernatanten.
    7. Vask perler med 5 mL af lysisbuffer (med ingen proteasehæmmere) og Fjern supernatanten efter centrifugering ved 1.500 x g i 2 min. ved 4 ° C.
    8. Gentag trin 2.3.7 2 x.
    9. Tilsættes 3 mL lysisbuffer til vasket perlerne og overføre perle gylle i en tom kolonne.
    10. Der tilsættes 5 mL af eluering buffer (50 mM Tris-HCl, 200 mM NaCl, 10 mM reduceret glutathion, pH 8,0) i kolonnen. Der inkuberes i 10 min og Eluatet opsamles.
    11. Gentag trin 2.3.10 3-4 x.
    12. Tilføje 200 µL af 5 mg/mL thrombin (Se Tabel af materialer) til eluat fra glutathion perler og der inkuberes natten over ved 4 ° C.
      Bemærk: Protokollen kan pause her.
    13. Fortynd protein prøven med Buffer A (25 mM HEPES, 1 mM DTT, 5% glycerol, pH 6,5) tredoblet.
    14. Blandingen henstår en kationbytter kromatografi kolonne (Se Tabel af materialer) på et FPLC system med Buffer A.
    15. Indlæse protein prøven til kolonnen afbalancerede kationbytter kromatografi på en 0,5 mL/min. strømningshastighed.
    16. Elueres protein med en gradient af NaCl i 40 mL ved at blande Buffer A og 0-50% Buffer B (25 mM HEPES, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 6,5) på en 1 mL/min. strømningshastighed.
    17. Check den eluted protein i forskellige fraktioner ved hjælp af SDS-PAGE24.
      Bemærk: Protokollen kan pause her.
    18. Pool eluatet fraktioner der indeholder Cul1sortase•Rbx1.
    19. Koncentrere poolet Cul1sortase•Rbx1 prøven til 2,5 mL af passerer buffer gennem en ultrafiltrering membran (30 kDa cutoff).
  4. Tilføje AMC til C-terminus af Cul1 gennem sortase-medieret transpeptidation21,22.
    1. Ændre buffer i Cul1sortase•Rbx1 prøve at sortase buffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7,5) ved hjælp af en udvanding kolonne (Se Tabel af materialer).
      1. Blandingen henstår en udvanding kolonne med 25 mL af sortase buffer.
      2. Indlæse 2,5 mL af Cul1sortase•Rbx1 prøve i kolonnen. Kassér gennemstrømnings.
      3. Elueres prøve med 3,5 mL af sortase buffer. Indsamle gennemstrømnings.
    2. I 900 µL af opløsningen Cul1sortase•Rbx1 i sortase buffer, Tilsæt 100 µL af 600 µM renset sortase A solution og 10 µL af 25 mM GGGGAMC peptid. Inkuber reaktionsblanding ved 30 ° C i den mørke natten. Bemærk at dette skridt vil generere Cul1AMC•Rbx1.
      Forsigtig: Fluorescerende farvestoffer er følsomme over for lys, så undgå at udsætte dem for omgivende lys at forberedelsen protein og prøve så meget som muligt.
      Bemærk: Protokollen kan pause her.
    3. Tilsæt 50 µL af Ni-NTA Agarosen perler til reaktionsblandingen og inkuberes ved stuetemperatur i 30 min.
    4. Pellet Ni-NTA Agarosen perler ved centrifugering ved 5.000 x g i 2 min og indsamle supernatanten.
    5. Blandingen henstår en størrelse udstødelse kromatografi kolonne (Se Tabel af materialer) med buffer (30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol) på FPLC systemet.
    6. Indlæse alle Cul1AMC•Rbx1 prøve på kolonnen størrelse udstødelse kromatografi. Elueres med 1,5 x kolonne volumen af buffer.
    7. Kontrollere eluatet fraktioner af SDS-PAGE24.
    8. Pool eluatet fraktioner der indeholder Cul1AMC•Rbx1.
    9. Måle proteinkoncentration ved hjælp af sin absorbans på 280 nm med et spektrofotometer.
    10. Alikvot protein løsning og opbevares ved-80 ° C.
      Bemærk: Protokollen kan pause her.

3. forberedelse af FlAsHCand1, FRET acceptor protein

Bemærk: De fleste trin i denne del er det samme som trin 2. Betingelser, der afviger er beskrevet mere detaljeret nedenfor.

  1. Konstruere plasmid for at udtrykke menneskelige TetraCysCand1 i E. coli celler.
    1. Tilføje DNA sekvens kodning "CCPGCCGSG" (tetracysteine/TetraCys tag) før de 15th amino syre af Cand1 gennem regelmæssig PCR25 (primer sekvenser: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. Indsæt PCR-produktet i en pGEX-4T-2 vektor. Sekvens plasmid for at bekræfte gen Indsæt er nøjagtige og i ramme.
  2. Express TetraCysCand1in E. coli celler på samme måde som trin 2.2, bortset fra at plasmidet omdannes til Rosetta kompetente celler.
  3. Rensning af TetraCysCand1 fra E. coli celler.
    1. Lyse E. coli celle pellets og uddrag TetraCysCand1using glutathion perler. Disse trin er de samme som trin 2.3.1–2.3.12.
    2. Fortynd protein eluatet fra glutathion glasperler med Buffer C (50 mM Tris-HCl, 1 mM DTT, 5% glycerol, pH 7,5) af tre folder. Blandingen henstår en anion exchange kromatografi kolonne (Se Tabel af materialer) på FPLC systemet med Buffer C og belastning fortyndet protein prøven på en 0,5 mL/min. strømningshastighed.
    3. Elueres protein med en gradient af NaCl i 40 mL ved at blande Buffer C og 0 til 50% Buffer D (50 mM Tris-HCl, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 7,5) i en 1 mL/min. strømningshastighed. Check den eluted protein i forskellige fraktioner ved hjælp af SDS-PAGE24, og samle de fraktioner, der indeholder TetraCysCand1. Bemærk, at TetraCysCand1 har en større opbevaring volumen end gratis GST.
    4. Koncentrere poolet TetraCysCand1 prøven ved at passere buffer gennem en ultrafiltrering membran (30 kDa cutoff).
    5. Blandingen henstår kolonnen størrelse udstødelse kromatografi med mærkning buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM TCEP, 1 mM EDTA, 5% glycerol) på FPLC systemet. Indlæse TetraCysCand1 prøve (500 µL hver gang) og kontrollere eluatet fraktioner af SDS-PAGE24.
    6. Samle alle de fraktioner, der indeholder TetraCysCand1 og koncentrere protein til ~ 40 µM af passerer buffer gennem en ultrafiltrering membran (30 kDa cutoff). Anslå proteinkoncentration ved hjælp af sin absorbans på 280 nm. Gemme protein som 50 µL alikvoter ved-80 ° C.
      Bemærk: Protokollen kan pause her.
  4. Forberedelse af FlAsHCand1.
    1. Tilføj 1 µL af FlAsH løsning (Se Tabel af materialer) til 50 µL TetraCysCand1 løsning.
    2. Bland godt og Inkuber blanding ved stuetemperatur i mørke i 1-2 timer at få FlAsHCand1.
      Bemærk: Protokollen kan pause her.

4. forberedelse af Cand1, FRET chase protein

Bemærk: Protein forberedelse protokol er svarende til trin 3, med følgende ændringer.

  1. Indsæt den kodende sekvens af fuld længde Cand1 i pGEX-4T-2 vektor.
  2. Ændre den buffer, der bruges i trin 3.3.5 til en buffer, som indeholder 30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol.
  3. Eliminer skridt 3.3.7 og 3.3.8.

5. test og bekræft FRET assay

  1. Forberede FRET bufferen indeholder 30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL ægalbumin, pH 7,6, og brug ved stuetemperatur.
  2. Teste FRET mellem Cul1AMC•Rbx1 og FlAsHCand1 på en fluorimeter.
    1. Tilføj Cul1 i 300 µL af FRET buffer,AMC•Rbx1 (FRET donor) til en slutkoncentration på 70 nM. Opløsningen overføres til en kuvette.
    2. Sted kuvette i prøveholderen af en fluorimeter. Excite prøve med 350 nm excitations lys og scanne emission signaler fra 400 nm til 600 nm ved 1 nm intervaller.
    3. Gentag trin 5.2.1 men ændre Cul1AMC•Rbx1 til FlAsHCand1 (FRET acceptor). Skan FlAsHCand1 prøven med den samme metode som i trin 5.2.2.
    4. (Valgfrit) Ophidse FlAsHCand1 med 510 nm excitations lys, og scanne emission signalet fra 500 nm til 650 nm.
    5. Tilføj begge Cul1 i 300 µL FRET buffer,AMC•Rbx1 og FlAsHCand1 til en endelig koncentration på 70 nM. Analysere prøven på samme måde som i trin 5.2.2.
  3. Bekræfte FRET mellem Cul1AMC•Rbx1 og FlAsHCand1 ved at tilføje chase (umærkede Cand1) protein (figur 3 c).
    1. I 300 µL af FRET buffer, tilføje 70 nM Cul1AMC•Rbx1 og 700 nM Cand1. Skan prøve emission som i trin 5.2.2.
    2. I 300 µL af FRET buffer, tilføje 70 nM FlAsHCand1 og 700 nM Cand1. Skan prøve emission som i trin 5.2.2.
    3. I 300 µL af FRET buffer, tilføje 70 nM Cul1AMC•Rbx1 og 70 nM FlAsHCand1, og der inkuberes prøve ved stuetemperatur i 5 min. Derefter tilføje 700 nM Cand1, og straks efter tilsætning, scanne prøve emission som i trin 5.2.2). Bemærk, at dette trin svarer til trin 5.2.5.
    4. I 300 µL FRET buffer, sekventielt tilføje 70 nM Cul1AMC•Rbx1, 700 nM Cand1 og 70 nM FlAsHCand1. Inkuber prøve ved stuetemperatur i 5 min, og scanne prøve emission som i trin 5.2.2. Bemærk at dette er eksemplet chase (grøn linje i figur 3 c).

6. mål forening konstanten (k) af Cul1•Cand1

Bemærk: Oplysninger om opererer en stoppet-flow fluorimeter er blevet beskrevet i en tidligere betænkning26.

  1. Forberede måling stoppet-flow fluorimeter.
    1. Tænde stoppede strømmen fluorimeter efter fabrikantens anvisninger.
    2. Indstille excitations lys på 350 nm, og brug en sporgruppe-pass filter, der giver mulighed for 450 nm emission lys for at passere og blokerer 500-650 nm udledning lyse.
    3. Holde prøve ventiler på FYLDE position, og Tilslut en 3 mL sprøjte fyldt med vand. Vask de to prøve sprøjter (A og B) med vand ved at flytte prøve sprøjte drev op og ned flere gange. Kassér alle vandområder i dette trin.
    4. Holde prøve ventiler på FYLDE position, og Tilslut en 3 mL sprøjte fyldt med FRET buffer. Vask de to prøve sprøjter med FRET buffer ved at flytte prøve sprøjte drev op og ned flere tid. Kassér alle de FRET buffer, der bruges i dette trin.
  2. Tage en kontrol måling (figur 4 c).
    1. Tilslut en 3 mL sprøjte og indlæse sprøjte A med 100 nM Cul1AMC•Rbx1 i FRET buffer. Drej prøve ventilen til positionen DRIVE .
    2. Tilslut en 3 mL sprøjte og indlæse sprøjte B med FRET buffer. Drej prøve ventilen til positionen DRIVE .
    3. Bruge Kontrolpanel under anskaffe i softwaren til at tage fem skud (bland lige saa stort volumen af prøver fra sprøjten A og sprøjte B) på stoppede strømmen fluorimeter uden registrering af resultaterne.
    4. Åbn Kontrolpanelet under erhverve i softwaren, og program til at optage emission af Cul1AMC over 60 s. Derefter tage en enkelt skud.
    5. Gentag trin 6.2.4 2 x.
    6. Drej prøve ventilen til positionen FYLDE . Tomme sprøjte B og vask med FRET buffer.
  3. Foranstaltning observeret association sats konstanter (kobs) af Cul1•Cand1 (figur 4B).
    1. Hold prøven i sprøjten A det samme som i trin 6.2.1.
    2. Tilslut en 3 mL sprøjte og indlæse sprøjte B med 100 nM FlAsHCand1 i FRET buffer. Drej prøve ventilen til positionen DRIVE .
    3. Bruge Kontrolpanel under erhverve i softwaren til at tage fem skud uden registrering af resultaterne.
    4. Åbn Kontrolpanelet under erhverve i softwaren, og program til at optage emission af Cul1AMC over 60 s. Derefter tage en enkelt skud.
    5. Gentag trin 6.3.4 2 x.
    6. Tomme sprøjte B og vask med FRET buffer.
    7. Gentag trin 6.3.1–6.3.6 flere gange med stigende koncentrationer af FlAsHCand1 i FRET buffer.
    8. Passe ændringen (fald) i fluorescerende signaler målt over tid fra hvert skud til en enkelt eksponentiel kurve. Dette vil give kobsi hver måling, og enheden er s-1. Bemærk, at grundlaget for denne beregning har talt godt i en tidligere betænkning27.
  4. Beregne gennemsnit og standardafvigelse for kobsfor hver FlAsHCand1 koncentration anvendt. Afbilde den gennemsnitlige kobsmod Cand1 koncentration (figur 4D), og hældningen af linjen repræsenterer den k af Cul1•Cand1, med en enhed af M-1 s-1.

7. måle dissociation sats konstant (koff) af Cul1•Cand1 i Skp1•F-box protein.

Bemærk: Dette trin er svarende til trin 6, med følgende ændringer.

  1. I sprøjten A, under den FYLDE holdning, indlæse en løsning for 100 nM Cul1AMC•Rbx1 og 100 nM FlAsHCand1 i FRET buffer. Drej prøve ventilen til positionen "DRIVE".
  2. Indlæse en opløsning af Skp1•Skp2 (udarbejdet efter en tidligere rapport20) under positionen FYLDE sprøjten b. Drej prøve ventilen til positionen "DRIVE".
  3. Åbn Kontrolpanelet under erhverve i softwaren, og program til at optage emission af Cul1AMC over 30 s. Derefter tage en enkelt skud. De fluorescerende signaler øges over tid efter blanding løsninger fra sprøjten A og sprøjte B (figur 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

At teste FRET mellem Cul1AMC og FlAsHCand1, vi først bestemmes emissionen intensiteten af 70 nM Cul1AMC (donor) og 70 nM FlAsHCand1 (acceptor), henholdsvis (figur 3A-C, blå linjer). I hver ende, kun én emission højdepunkt var nutid, og emissionen af FlAsHCand1 var (acceptor) lav. Når 70 nM Cul1AMC og FlAsHCand1 blev blandet for at generere FRET, to emission toppe var til stede i emission spektre, og toppen af Cul1AMC blev lavere og toppen af FlAsHCand1 blev højere (figur 3A -C, røde linjer). Når den fuld længde Cand1 blev brugt til FRET, donor peak viste en 10% reduktion i intensitet (figur 3A, rød linje), og når Cand1 med sin første helix afkortet blev brugt, blev reduktion af donor peak intensitet øget til 30% (figur 3B -D, røde linjer), foreslår højere FRET effektivitet. At bekræfte, at signalet ændringer blev ført fra FRET mellem Cul1AMC og FlAsHCand1, 70 nM Cul1AMC (donor) var blandet med 700 nM umærket Cand1 (jagten) og 70 nM FlAsHCand1 (acceptor). Som et resultat, donor peak blev gennemrenoveret og acceptor højdepunkt var faldet (figur 3 c, grøn linje), som bekræftede, at den observerede FRET afhænger dannelsen af Cul1AMCFlAsHCand1 kompleks. Tilføje 700 nM Skp1•Skp2 til 70 nM Cul1AMCFlAsHCand1 også fuldt restaureret donor peak (figur 3D, grøn linje), hvilket tyder på at Cul1•Cand1 kompleks fuldt blev afbrudt af Skp1•Skp2 ved ligevægt.

Figure 3
Figur 3: repræsentant FRET assay for Cul1•Cand1 komplekse dannelse. Prøver i FRET buffer (30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL ægalbumin, pH 7,6) var begejstrede på 350 nm, og emissionerne blev scannet fra 400 nm til 650 nm. (A) Emission spektre af 70 nM Cul1AMC, 70 nM FlAsHCand1 (fuld), og en blanding af to (ÆRGRE). Cand1 (fuld) står for fuld længde Cand1. (B) Emission spektre af 70 nM Cul1AMC, 70 nM FlAsHCand1, og en blanding af to (ÆRGRE). Cand1 med sin første helix slettet blev brugt i dette eksperiment, og derefter. (C) Emission spektre af 70 nM Cul1AMC, 70 nM FlAsHCand1, en blanding af to (ÆRGRE), og jage kontrol til FRET (Chase). Chase prøven indeholdt 70 nM Cul1AMC, 700 nM Cand1 og 70 nM FlAsHCand1. (D) Emission spektre af 70 nM Cul1AMC, en blanding af 70 nM Cul1AMC og 70 nM FlAsHCand1 (FRET) og 700 nM Skp1•Skp2 føjet til 70 nM Cul1AMCFlAsHCand1 kompleks. I hvert enkelt observationsområde, emission signaler var normaliseret til emission af 70 nM Cul1AMC ved 450 nm. Venligst klik her for at se en større version af dette tal.

For at måle den k af Cul1•Cand1 ved hjælp af etablerede FRET analysen af overvågning reduktion af donor signalet over tid på stoppede strømmen fluorimeter, vi først testet og bestemmes koncentrationen af protein skal anvendes. Når 5 nM Cul1AMC og FlAsHCand1 blev brugt, meget lille signal ændring blev observeret (figur 4A), hvorimod når koncentrationen af hvert protein blev øget til 50 nM, reduktion af signalet over tid blev observeret ( Figur 4B), og denne ændring blev afskaffet hvis buffer uden FlAsHCand1 blev tilføjet (figur 4 c). Derfor 50 nM Cul1AMC blev brugt til yderligere analyser, og en række observerede association sats konstanter (kobs) blev målt ved at blande 50 nM Cul1AMC med stigende koncentrationer af FlAsHCand1. Kobs til hvert eksperiment blev beregnet ved at montere point til en enkelt eksponentialkurve, og kobs fremstillet af den samme FlAsHCand1 fusion var i gennemsnit. Ved at plotte de gennemsnitlige kobs med Cand1 koncentration og udføre en lineær regression (figur 4D), den k var bestemt7,27.

Figure 4
Figur 4: repræsentativ måling af foreningen konstant. (A) fluorescens af 5 nM Cul1AMC blev overvåget af en stoppet-flow fluorimeter over tid efter tilsætning af 5 nM FlAsHCand1. (B) fluorescens af 50 nM Cul1AMC blev overvåget af en stoppet-flow fluorimeter over tid efter tilsætning af 50 nM FlAsHCand1. (C) fluorescens af 50 nM Cul1AMC blev overvåget af en stoppet-flow fluorimeter over tid efter tilsætning af FRET buffer. (D) k for Cand1 binding til Cul1. kobs af Cul1•Cand1 i forskellige koncentrationer af Cand1 er afbildet. Lineær hældning giver k 1,8 x 107 M-1 s-1. Fejllinjer udgør ±SEM; n = 4. Alle prøver blev forberedt i FRET buffer og ophidset på 350 nm. Et båndpas filter blev brugt til at samle signalerne fra AMC og udelukke signaler fra FlAsH. Ingen data blev normaliseret. Venligst klik her for at se en større version af dette tal.

Svarende til måling af k, vi målte den observerede dissociationskonstant sats af Cul1•Cand1 ved at overvåge stigning (restore) af donor signalet over tid på stoppet-flow fluorimeter. Cul1AMC og FlAsHCand1 var blandede først, og derefter Skp1•Skp2 blev tilføjet til den hovedmeningen Cul1AMCFlAsHCand1 på stoppet-flow fluorimeter. Donor signal steg hurtigt, og det viste en kobs af 0,4 s-1 (figur 5). Derimod når buffer blev føjet til den hovedmeningen Cul1AMCFlAsHCand1, ingen signal stigning blev observeret, at foreslå den hurtige dissociation af Cul1•Cand1 blev udløst af Skp1•Skp2.

Figure 5
Figur 5: repræsentativ måling af sats dissociationskonstant. Ændringen i donor fluorescens versus tid blev målt efter tilsætning af 150 nM Skp1•Skp2 eller FRET buffer til 50 nM Cul1AMCFlAsHCand1 kompleks. Signal ændringer var egnede til en enkelt eksponentialkurve, og det giver observerede dissociationskonstant sats af 0,4 s-1. De eksperimentelle betingelser var det samme som beskrevet i figur 4. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

FRET er et fysisk fænomen, som er af stor interesse for at studere og forstå biologiske systemer19. Vi præsenterer her, en protokol for afprøvning og brug af FRET for at studere bindende kinetik af to interagerende proteiner. Når du udformer FRET, vi anså tre hovedfaktorer: den spektrale overlapning mellem donor emission og acceptor excitation, afstanden mellem de to fluorophores og dipol orientering af fluorophores28. For at vælge fluorophores for FRET, vi overlejret excitation og emission spektre af fluorophores, og søgte efter fluorophores hvis emission toppe er godt adskilt, mens emission spektrum af donor betydeligt overlapper med excitation spektrum af acceptoren (figur 2). For at optimere interfluorophore afstand og retning, vi brugte krystalstruktur for bistand, og vi betragtet primært som knytter fluorophores til protein termini, hovedsagelig på grund af den lavere risiko for at forstyrre protein struktur og aktivitet. Fordi afstanden mellem N-terminus af Cand1 (Cand1NTD) og C-terminus af Cul1 (Cul1CTD) er kortere end afstanden mellem C-terminus af Cand1 og N-terminus af Cul1 (figur 1), besluttede vi at mærke Cand1NTD og Cul1CTD. Fordi vi havde kunnet opnå 80% – 90% mærkning effektivitet af N-terminus et protein ved hjælp af tetracysteine tag25, valgte vi at mærke Cand1NTD med FlAsH gennem tetracysteine tag. Vi oprindeligt hedder Cul1CTD med cyan fluorescerende proteiner (FFP), som har et par fordele i forhold til AMC. For det første er en genetisk kodet fluorescerende tag, så det ikke kræver ekstra mærkning proces eller trin, renser den mærket fluorescerende protein fra sin umærkede forløber. For det andet fælles fiskeripolitik er lysere end AMC, og derfor, det giver højere assay følsomhed (Se forklaring nedenfor). For det tredje har fælles fiskeripolitik et større spektrum overlapper med FlAsH, potentielt giver mere effektiv FRET med FlAsH. Trods disse fordele er dog er fælles fiskeripolitik protein meget større end AMC-tag, som kan interferere med protein kropsbygning og den indbyrdes molekylære interaktion. Ja, vi ikke har overholdt FRET mellem Cul1fælles fiskeripolitik og FlAsHCand1 i vores test, som sandsynligvis skyldes utilstrækkelig dipol orientering eller afbrydelse af Cul1-Cand1-interaktion af fælles fiskeripolitik tag. Vi derefter mærket Cul1CTD med AMC, vi iagttog FRET mellem Cul1AMC og FlAsHCand1. Oprindelige FRET ved hjælp af den fulde længde Cand1 førte til 10% reduktion af donor emission (figur 3A). Vi endvidere konstateret, at ved at slette den første helix af Cand1, afstanden mellem Cul1 og Cand1 er forkortet fra 26,8 Å til 15,5 Å (figur 1), og Cand1 mangler den første helix givet en meget stærkere FRET med Cul1, viser 30% reduktion af donor emission Peak (figur 3B). Derudover kan man forbedre FRET effektivitet ved at vælge en donor, fluorophore med højere kvanteudbytte og en acceptor fluorophore med en større extinction koefficient.

Et karakteristisk træk ved FRET er, at når FRET opstår, emission af donor falder og emission af acceptoren stigninger (figur 3B). Men fluorophores kan vise følsomhed til deres miljø, og dermed, emission intensitet kan ændres, når et andet protein er til stede, selv i mangel af FRET29. Bekræfte, at den ændrede emission vi observeret på grund af FRET mellem Cul1AMC og FlAsHCand1, vi har tilføjet 10 x overskydende beløb af umærket acceptor protein (Cand1) som en chase. Chase konverterer emission af donoren og acceptoren tilbage til det normale niveau (figur 3 c), som understøtter, den ændrede emission af Cul1AMC og FlAsHCand1 afhænger protein-protein interaktion, og derfor dette resultat bekræfter, at vi etablerede en FRET assay, der rapporterer association og dissociation af Cul1•Cand1. Derudover har vi tilføjet Skp1•Skp2 til den hovedmeningen Cul1AMCFlAsHCand1 kompleks, og Skp1•Skp2 er kendt for at være i stand til at forstyrre Cul1-Cand1 interaktion6. Vi fandt, at FRET mellem Cul1AMC og FlAsHCand1 forsvundet (figur 3D, grøn linje) og emission spektrum blev svarende til emission spektrum af chase prøven (figur 3 c, grøn linje), hvilket tyder på, Cul1AMCFlAsHCand1 er adskilt af Skp1•Skp2 og Cul1AMC viser ikke unormal emission, når Skp1•Skp2 er til stede.

Ved at overvåge ændringer i donor emission, kan vi direkte observere association og dissociation af Cul1AMCFlAsHCand1 på en stoppet-flow fluorimeter. Stoppet-flow-systemet fungerer ved at indsprøjte reaktanter til et blandingskammer hurtigt blandes reaktanter, og standse strømmen når de blandede reaktanter er flyttet ind i en bemærkning afdeling5. Signal detection starter som regel 1-2 millisekunder (ms) efter blanding, som gør det muligt at studere samspil, der opstår på millisekund tidsskalaen. Men når halveringstiden for de observerede reaktion er kortere end den tid, det tager at blande reaktanter på en bestemt enhed, denne fremgangsmåde er ikke følsomme nok og er ikke længere passende30. Stoppet-flow analyser har været brugt til at bestemme sats konstanter spænder 10-6– 106 s-1 for første-ordens reaktioner, og 1-109 M-1 s-1 for anden ordens reaktioner5. For at opnå pålidelig måling af de kinetiske parametre ved hjælp af stoppede strømmen fluorimeter, er en betydelig ændring af de fluorescerende signal mellem punkterne starter og ligevægt nødvendige. Vi brugte FlAsHCand1 mangler den første helix som acceptor, fordi det giver bedre FRET med Cul1AMC, og vi testede koncentrationen af proteiner skal bruges til målingen. Når 5 nM Cul1AMC og FlAsHCand1 var blandede, ingen ændring i Cul1AMC signal blev observeret (figur 4A), tyder denne koncentration er utilstrækkelig til måling. Når protein koncentrationer blev øget til 50 nM, faldet i Cul1AMC signal over tid blev tilsyneladende (figur 4B), og denne ændring ikke opstår, når acceptor protein var fraværende (figur 4 c). Baseret på dette resultat, vi brugte Cul1AMC på 50 nM samråd at måle den k for Cul1•Cand1. Koncentration af donor protein bruges til måling kan variere ved forskellige fluorophores. For eksempel, når Cul1 er mærket med den fælles fiskeripolitik, 5 nM af fælles fiskeripolitikCul1 er tilstrækkelig for måling af k6. Derfor, den optimale koncentration af protein bør testes for hvert FRET par, og i princippet, lysere fluorophores tillade brug af lavere protein koncentrationer og give bedre signal til støjforhold31.

For at undersøge protein-protein interaktioner af FRET, kræver det knyttet fluorophores til proteiner på relevante holdninger uden at forstyrre protein struktur og aktivitet, som potentielt begrænser brugen af FRET. I denne protokol, vi mærket de N-terminus af Cand1 ved hjælp af en tetracysteine tag, der specifikt binder den FlAsH farvestof og FlAsH farvestoffet bliver fluorescerende kun efter det binder target protein32. Vi hedder Cul1 ved hjælp af sortase-medieret transpeptidation, som lægger en kort peptid bærer en fluorophore til sortase tag på C-terminus Cul121,22. Den mærkning effektivitet er > 80% med tetracysteine tag, og næsten 100% med koden sortase, hans6 efter fjernelse af ureageret protein ved hjælp af Ni-NTA perler (trin 2.4.3–2.4.4). Begge metoder tilføje et par aminosyrer til target proteinet, indførelse af minimale ændringer til protein struktur. Lignende tiltag, såsom transglutaminase anerkendelse sekvens (Q-tag)33 og ybbR tag34, kan også bruges til at mærke target proteinet i en lokationsspecifik måde. Desuden kan fotostabilitet af de fluorescerende farvestoffer også begrænse brugen af FRET. Gentagne eller lang eksponering for excitation lys kan føre til photobleaching af fluorophore, hvilket resulterede i ukorrekte kvantificering resultater35. Derfor, donor og acceptor proteinerne bør beskyttes mod lys under tilberedning og opbevaring trin. Når du bruger FRET for at måle hændelser, der opstår langsomt, i stedet for konstant overvågning af ændringen i donor emission over tid, korte aflæsninger af donor emission bør tages på længere tidsintervaller og prøven bør holdes i mørke i hele eksperiment6.

Fordi FRET er følsomme og kvantitative, er det blevet et vigtigt redskab til at studere samspillet mellem makromolekyler. Denne protokol udgør et eksempel på brugen af FRET for at studere dynamikken i et protein kompleks i løsning. FRET er også blevet brugt sammen med levende celle imaging for at studere molekylære interaktioner i levende celler36, som er stærke i afslørende dynamikken i proteinkomplekser fysiologiske betingelser. FRET kan desuden også bruges på enkelt-molekyle niveau for at undersøge makromolekylære komplekser37,38, real-time dynamik giver indblik i en konformationel ændring af komplekset. For at forbedre effektiviteten og sporing af FRET, fluorophores og biosensorer med forbedret lysstyrke og fotostabilitet er af stor interesse, som er aktivt udviklet og studeret28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi takker Shu-Ou Shan (California Institute of Technology) for indsigtsfulde diskussion om udviklingen af FRET assay. M.G., Y.Z. og X.L. blev finansieret af startup midler fra Purdue University til Y.Z. og X.L.This arbejde blev delvist understøttet af et frø tilskud fra Purdue University Center for Plantebiologi.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics