In-vitro-Fluoreszenz Resonanz Energietransfer verwenden, um die Dynamik der Proteinkomplexe auf einer Millisekunde Zeitskala studieren

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Protein-Protein-Interaktionen sind von entscheidender Bedeutung für biologische Systeme, und Studien der verbindliche Kinetik geben Einblicke in die Dynamik und Funktion von Proteinkomplexen. Wir beschreiben eine Methode, die die kinetischen Parameter von einem Proteinkomplex mit Fluoreszenz-Resonanz-Energie-Transfer und die gestoppt-Flow-Technik quantifiziert.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Proteine sind die primären Betreiber von biologischen Systemen, und sie in der Regel interagieren mit anderen Makro oder kleine Moleküle, deren biologische Funktionen durchzuführen. Solche Interaktionen können sehr dynamisch, d. h. die interagierenden Untereinheiten sind ständig verbunden und getrennt zu bestimmten Preisen sein. Während Messen der Bindungsaffinität mit Techniken wie quantitative Pulldown-Menü zeigt die Stärke der Wechselwirkung, studieren die verbindliche Kinetik Einblicke darüber, wie schnell gibt die Interaktion erfolgt und wie lange jede Anlage bestehen kann. Darüber hinaus messen die Kinetik einer Interaktion in der Gegenwart ein zusätzlicher Faktor, wie ein Protein-Austausch-Faktor oder ein Medikament hilft den Mechanismus zu offenbaren, die Interaktion durch den anderen Faktor geregelt ist, wichtige Erkenntnisse für die Bereitstellung, der Förderung der biologischen und medizinischen Forschung. Hier beschreiben wir ein Protokoll zur Messung der verbindliche Kinetics von einem Proteinkomplex, das hat eine hohe intrinsische Verband und kann schnell durch ein anderes Protein getrennt werden. Die Methode verwendet Fluoreszenz Resonanz Energietransfer um zu melden, die Bildung von in-vitro-Protein-Komplex, und es ermöglicht die Überwachung der schnelle Assoziation und Dissoziation des Komplexes in Echtzeit auf einem gestoppt-Flow Fluorimeter. Mit diesem Test, werden die Assoziation und Dissoziation Geschwindigkeitskonstanten von dem Proteinkomplex quantifiziert.

Introduction

Biologische Aktivitäten erfolgt letztlich durch Proteine, die meisten davon mit anderen für richtige biologische Funktionen interagieren. Mit einem rechnerischen Ansatz, der Gesamtbetrag der Protein-Protein-Interaktionen in der menschlichen wird voraussichtlich 650.000 ~1und Störung dieser Interaktionen oft führt zu Krankheiten2. Durch ihre entscheidende Rolle bei der Kontrolle der zellulärer und organismal Prozessen wurden zahlreiche Methoden entwickelt, um Protein-Protein-Wechselwirkungen, wie Hefe-zwei-Hybrid, bimolekulare Fluoreszenz Komplementierung, Split-Luciferase studieren Ergänzung und co-Immunopräzipitation Assay3. Während diese Methoden gut entdecken und Bestätigung von Protein-Protein-Interaktionen sind, sie sind in der Regel nicht-quantitative und somit bieten nur begrenzte Informationen über die Affinität zwischen den Interaktionspartnern Protein. Quantitative Pulldown-Menüs können zur Messung der Bindungsaffinität (z. B. die Dissoziationskonstante Kd), aber es misst nicht die Kinetik der Bindung, noch kann es angewendet werden, wenn die K-d sehr niedrig, da eine unzureichende ist Signal-Rausch-Verhältnis4. Surface Plasmon-Resonanz (SPR)-Spektroskopie quantifiziert die verbindliche Kinetik, aber es erfordert eine spezifische Oberfläche und Immobilisierung von einem Reaktionspartner auf der Oberfläche, die potenziell die Binding-Eigenschaft der Reaktanten5ändern können. Darüber hinaus ist es schwierig für SPR schnell Assoziation und Dissoziation Preise5messen, und es ist nicht angebracht, SPR verwenden, um die Charakterisierung der Veranstaltung zum Austausch von Protein-Untereinheiten in einem Proteinkomplex. Hier beschreiben wir eine Methode, die erlaubt Messraten von Protein komplexe Montage und Demontage auf einer Millisekunde Zeitskala. Diese Methode war wesentlich für die Bestimmung der Rolle von CUllin - Warnformate -Nedd8 -dIssociated Protein 1 (Cand1)als die F-Box Protein Austausch Faktor6,7.

Cand1 regelt die Dynamik der Skp1•Cul1•F-Box-Protein (SCF) E3 Ligases, die zu der großen Familie von Cullin-RING Ubiquitin Ligases gehören. SKSF bestehen aus den cullin, Cul1, die das RING Domain Protein Rbx1 bindet, und eine austauschbare F-Box Protein, das Rekruten Substrate und Cul1 durch den Adapter Protein Skp18bindet. Als eine E3-Ligase SCF katalysiert die Konjugation des Ubiquitin an seinem Substrat, und es ist aktiviert, wenn das Substrat durch die F-Box Protein rekrutiert und Cul1 des Proteins Ubiquitin-artigen Nedd89geändert wird. Cand1 bindet unmodifizierten Cul1 und bei der Bindung, stört es sowohl der Verband der Skp1•F-Box-Protein mit Cul1 und die Konjugation von Nedd8 bis Cul110,11,12,13. Infolgedessen Cand1 schien ein Inhibitor der SCF Aktivität in vitro, aber Cand1 Mangel in Organismen verursacht Mängel, die eine positive Rolle des Cand1 schlägt bei der Regulierung der SCF Aktivitäten in Vivo14,15,16 , 17. dieses Paradox erklärt sich schließlich durch eine quantitative Studie, die die dynamische Interaktionen zwischen Cul1, Cand1 und Skp1•F-Box-Protein enthüllt. Mit Fluoreszenz Resonanz Energie Transfer (FRET) Assays, die die Bildung der SCF und Cul1•Cand1 komplexe erkennen, der Assoziation und Dissoziation bewerten konstanten (kauf und kab, beziehungsweise) wurden einzeln gemessen. Die Messungen ergaben, dass Cand1 und Skp1•F-Box Protein Form extrem engen Komplex mit Cul1, aber die kaus der SCF durch Cand1 drastisch erhöht wird und die kaus der Cul1•Cand1 wird drastisch erhöht Skp1•F-Box Protein6,7. Diese Ergebnisse unterstützen die aus- und kritische Bestimmung der Rolle der Cand1 als ein Protein Austausch Faktor, der die Bildung von neuen SCF-komplexe durch recycling von Cul1 aus der alten SCF komplexe katalysiert.

Hier präsentieren wir Ihnen das Verfahren der Entwicklung und Verwendung der Bund-Assay, um die Dynamik der Cul1•Cand1 Komplex7zu studieren, und das gleiche Prinzip kann angewendet werden, um die Dynamik der verschiedenen Biomolekülen zu studieren. Bund tritt auf, wenn ein Spender freut sich mit der entsprechenden Wellenlänge, und ein Akzeptor mit Anregungsspektrums Überlappung der Spender Emissionsspektrum in einer Entfernung von 10-100 ist Å. Die angeregten Zustand wird in den Akzeptor, wodurch abnehmender Spender Intensität und Akzeptor Intensität18übertragen. Die Effizienz der Bund (E) hängt der Förster-Radius (R0) und der Abstand zwischen Donor und Akzeptor Fluorophore (R) und zeichnet sich durch: E = R06/ (R0 6 + R6). Der Förster-Radius (R0) hängt von einigen Faktoren, einschließlich der Dipol Winkelorientierung, die spektrale Überlappung der Donor-Akzeptor-paar und die Lösung verwendet,19. Um die Bund-Assay auf einem Fluorimeter gestoppt-Flow anwenden, die die Änderung der Spender Emission in Echtzeit überwacht und ermöglicht Messungen der schnelle kauf und kaus, ist es notwendig, effiziente Bund, Ergebnisse einer signifikanten Reduktion der Spender Emission. Daher gestalten effiziente Bund durch die Wahl der entsprechenden paar fluoreszierende Farbstoffe und Websites auf die Zielproteine um die Farbstoffe zu befestigen ist wichtig und in diesem Protokoll diskutiert werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Entwurf der Bund-Assay.

  1. Download der Strukturdatei der komplexen Cul1•Cand1 von der Protein Data Bank (Datei 1U6G).
  2. Zeigen Sie die Struktur des Komplexes in PyMOL Cul1•Cand1.
  3. Die Messfunktion unter Menü " Assistenten " von PyMOL verwenden, um den Abstand zwischen der ersten Aminosäure des Cand1 und die letzten Aminosäure des Cul1 zu schätzen (Abbildung 1).
  4. Laden Sie die Online-Spektren-Viewer (siehe Tabelle der Materialien) und Anregung und Emission-Spektren von 7-amino-4-Methylcumarin (AMC) und Blitz gleichzeitig anzeigen (Abbildung 2). Beachten Sie, dass AMC der Bund-Spender ist und Blitz die Bund-Akzeptor ist.

Figure 1
Abbildung 1: die Kristallstruktur des Cul1•Cand1 und Messung des Abstandes zwischen Potenzial Kennzeichnung Websites. Die Kristall-Struktur-Datei wurde heruntergeladen von Protein Data Bank (Datei 1U6G) und in PyMOL angesehen. Messungen zwischen ausgewählten Atome wurden von PyMOL ausgeführt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: die Anregung und Emission-Spektren von Fluoreszenzfarbstoffen für Bund. Spektren von AMC (7-amino-4-Methylcumarin) und FlAsH werden angezeigt. Gestrichelte Linien zeigen Erregung Spektren, und durchgezogenen Linien zeigen Emissionsspektren. Das Bild wurde ursprünglich durch die Fluoreszenz-SpectraViewer generiert und für eine bessere Übersichtlichkeit geändert wurde. Bitte klicken Sie hier für eine größere Version dieser Figur.

2. Vorbereitung des Cul1AMC•Rbx1, FRET-Spender-Protein

  1. Plasmide für den Ausdruck von menschlichen Cul1Sortase•Rbx1 in E. Coli Zellen zu konstruieren. Beachten Sie, dass die beiden Plasmide Co Ausdruck menschlicher Cul1•Rbx1 in E. Coli Zellen in einem früheren Bericht20detailliert beschrieben sind.
    1. Hinzufügen einer DNA-Sequenz, die Codierung "LPETGGHHHHHH" (Sortase, seine6 Tag) bis zum 3' Ende des Cul1 kodierende Sequenz durch standard-PCR und Klonen Methoden21,22.
    2. Sequenz das neue Plasmid zu bestätigen, die gen-Einlage genau ist.
  2. Co Express Cul1Sortase•Rbx1 in E. Coli Zellen. Die Methode wird von einem vorherigen Bericht20abgeleitet.
    1. Mix 100 ng von zwei Plasmide mit BL21 (DE3) chemisch kompetente Zellen für Co-Transformation mit der Hitze Schock Methode23. Wachsen Sie Zellen auf LB-Agar-Platte mit 100 µg/mL Ampicillin und 34 µg/mL Chloramphenicol bei 37 ° C über Nacht.
    2. 50 mL LB-Kultur mit frisch transformierte Kolonien zu impfen und wachsen über Nacht bei 37 ° C mit 250 u/min schütteln. Dies gibt eine Starterkultur.
    3. 6 Flaschen, jeweils mit 1 L LB-Medium mit 5 mL Starterkultur jeder impfen und wachsen bei 37 ° C mit 250 u/min schütteln bis die OD600 ~ 1.0 ist. Die Kultur auf 16 ° C abkühlen und 0,4 mM Isopropyl-β-D-Thiogalactoside (IPTG) hinzufügen. Halten Sie die Kultur bei 16 ° C über Nacht mit 250 u/min schütteln.
    4. Ernten Sie die E. Coli -Zellen durch Zentrifugation bei 5.000 X g für 15 min zu und sammeln Sie Zelle Pellets in 50 mL konische Röhrchen.
      Hinweis: Die Zelle-Pellets für Proteinreinigung verarbeitet werden können oder bei-80 ° C, bevor Sie fortfahren, die Protein-Reinigungsschritte eingefroren werden.
  3. Reinigung von Cul1Sortase•Rbx1 komplexe. Diese Methode wird von einem vorherigen Bericht20abgeleitet.
    1. Das Pellet von E. Coli Zellen mit dem Ausdruck Cul1Sortase•Rbx1 fügen Sie 50 mL Lyse-Puffer (30 mM Tris-HCl, 200 mM NaCl, 5 mM DVB-t, 10 % Glycerin 1 Tablette der Protease-Inhibitor cocktail, pH 7.6 hinzu).
    2. Lösen Sie die Zellen mit Beschallung bei 50 % Amplitude auf Eis. Wechseln Sie zwischen 1 Sekunde und 1 Sekunde aus und 3 min laufen lassen.
    3. Wiederholen Sie Schritt 2.3.2 2-3x.
    4. Übertragen der Zelle lysate in ein 50-mL-Zentrifugation Rohr und entfernen Sie die Zelle Verschmutzungen durch Zentrifugation bei 25.000 X g 45 min.
    5. Inkubieren Sie die klare Zelle lysate mit 5 mL Glutathion Perlen bei 4 ° C für 2 h.
    6. Zentrifugieren Sie die Perlen-lysate Mischung bei 1.500 X g für 2 min bei 4 ° C. Den Überstand zu entfernen.
    7. Waschen Sie die Perlen mit 5 mL Lyse-Puffer (mit keine Proteaseinhibitoren) und Entfernen des Überstands nach Zentrifugation bei 1.500 X g für 2 min bei 4 ° C.
    8. Wiederholen Sie Schritt 2.3.7 2 X.
    9. Die gewaschenen Perlen 3 mL Lyse Puffer hinzu und übertragen Sie die Perle Gülle in eine leere Spalte.
    10. 5 mL der Elution Buffer (50 mM Tris-HCl, 200 mM NaCl, 10 mM reduziert Glutathion, pH 8.0) in der Spalte hinzufügen. 10 min inkubieren und das Eluat zu sammeln.
    11. Wiederholen Sie Schritt 2.3.10 3-4 X.
    12. Fügen Sie 200 µL 5 mg/mL Thrombin (siehe Tabelle der Materialien), das Eluat von Glutathion-Perlen und über Nacht bei 4 ° c inkubieren
      Hinweis: Das Protokoll kann hier angehalten werden.
    13. Verdünnen Sie die Protein-Probe mit Puffer A (25 mM HEPES, 1 mM DVB-t, 5 % Glycerin, pH 6,5) verdreifacht.
    14. Equilibrate ein Kationenaustausch Chromatographiesäule (siehe Tabelle der Materialien) auf einem FPLC System mit Puffer A.
    15. Laden Sie die Protein-Probe zur äquilibriert Kationenaustausch-Chromatographie Spalte bei 0,5 mL/min Durchfluss.
    16. Eluieren Sie das Protein mit einer Steigung von NaCl in 40 mL Puffer A und 0 bis 50 % Puffer B (25 mM HEPES, 1 M NaCl, 1 mM DVB-t, 5 % Glycerin, pH 6,5) bei 1 mL/min Durchfluss.
    17. Überprüfen des eluierten Proteins in verschiedene Fraktionen mit SDS-PAGE24.
      Hinweis: Das Protokoll kann hier angehalten werden.
    18. Das Eluat Brüche mit Cul1Sortase•Rbx1 zu bündeln.
    19. Konzentrieren Sie die gepoolte Cul1Sortase•Rbx1 Probe 2,5 mL durch die Übergabe des Puffers durch eine Membran Ultrafiltration (30 kDa cutoff).
  4. Fügen Sie AMC an den C-Terminus des Cul1 durch Sortase-vermittelten Transpeptidation21,22.
    1. Ändern Sie den Puffer in der Cul1Sortase•Rbx1 Probe Sortase Puffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7,5) eine Entsalzung Spalte verwenden (siehe Tabelle der Materialien).
      1. Equilibrate eine Entsalzung Spalte mit 25 mL Sortase Puffer.
      2. Laden Sie 2,5 mL Cul1Sortase•Rbx1 Probe in der Spalte. Entsorgen Sie den Durchfluss.
      3. Eluieren Sie die Probe mit 3,5 mL Sortase Puffer. Die Flow-through zu sammeln.
    2. Fügen Sie in 900 µL der Cul1Sortase•Rbx1 Lösung im Sortase Puffer 100 µL 600 µM gereinigt Sortase eine Lösung und 10 µL 25 mM GGGGAMC Peptid. Inkubieren Sie die Reaktionsmischung bei 30 ° C in der dunklen Nacht. Beachten Sie, dass dieser Schritt Cul1 generieren wirdAMC•Rbx1.
      Achtung: Fluoreszierende Farbstoffe reagieren empfindlich auf Licht, also vermeiden sie Umgebungslicht während der Protein- und Probe Vorbereitung so weit wie möglich.
      Hinweis: Das Protokoll kann hier angehalten werden.
    3. Das Reaktionsgemisch 50 µL der Ni-NTA Agarose Korne hinzu und bei Zimmertemperatur 30 min inkubieren.
    4. Pellet-Ni-NTA-Agarose-Perlen durch Zentrifugation bei 5.000 X g für 2 min und den Überstand zu sammeln.
    5. Equilibrate eine Größe Ausgrenzung Chromatographiesäule (siehe Tabelle der Materialien) mit Puffer (30 mM Tris-HCl, 100 mM NaCl, 1 mM DVB-t, 10 % Glycerin) auf dem FPLC-System.
    6. Laden Sie die Cul1AMC•Rbx1 Probe auf die Ausgrenzung Chromatographie Spalte "Größe". Eluieren Sie mit 1,5 X Spalte Volumen des Puffers.
    7. Überprüfen Sie das Eluat Brüche durch SDS-PAGE24.
    8. Das Eluat Brüche mit Cul1 PoolAMC•Rbx1.
    9. Messen die Konzentration des Proteins mit der Absorption bei 280 nm mit einem Spektrophotometer.
    10. Aliquot der Proteinlösung und Store bei-80 ° C.
      Hinweis: Das Protokoll kann hier angehalten werden.

3. Vorbereitung des Flash-Cand1, das Bund-Akzeptor-protein

Hinweis: Die meisten Schritte in diesem Teil sind identisch mit Schritt2. Bedingungen, die sich unterscheiden werden nachfolgend detailliert beschrieben.

  1. Das Plasmid für den Ausdruck von menschlichen TetraCysCand1 in E. Coli Zellen zu konstruieren.
    1. DNA-Sequenz, die Codierung "CCPGCCGSG" (Tetracysteine/TetraCys Tag) hinzufügen, bevor die 15th Aminosäure des Cand1 durch regelmäßige PCR25 (Primer-Sequenzen: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. Legen Sie das PCR-Produkt in ein pGEX-4 t-2-Vektor. Folge das Plasmid zu bestätigen, die gen-Einlage ist korrekt und im Rahmen.
  2. Drücken Sie TetraCysCand1in E. Coli Zellen in der gleichen Weise wie Schritt 2.2, aus, außer dass das Plasmid in Rosetta kompetente Zellen umgewandelt wird.
  3. Reinigung von TetraCysCand1 aus den E. Coli -Zellen.
    1. Lysiert die E. Coli Zelle Pellets und TetraCysCand1using Glutathion Perlen zu extrahieren. Diese Schritte sind identisch mit den Schritten 2.3.1–2.3.12.
    2. Verdünnen Sie das Protein Eluat von Glutathion-Perlen mit Puffer C (50 mM Tris-HCl, 1 mM DVB-t, 5 % Glycerin, pH 7,5) durch drei Falten. Equilibrate ein Anion Austausch Chromatographiesäule (siehe Tabelle der Materialien) auf dem FPLC System mit Puffer C und Last der verdünnten Protein-Probe bei 0,5 mL/min Durchfluss.
    3. Eluieren Sie das Protein mit einer Steigung von NaCl in 40 mL durch Mischen von Puffer C und 0 bis 50 % Puffer D (50 mM Tris-HCl, 1 M NaCl, 1 mM DVB-t, 5 % Glycerin, pH 7,5) bei 1 mL/min Durchfluss. Überprüfen Sie des eluierten Proteins in verschiedene Fraktionen mit SDS-PAGE24und bündeln Sie die Fraktionen mit TetraCysCand1. Beachten Sie, dass TetraCysCand1 einen größeren Retentionsvolumen als kostenlose GST.
    4. Konzentrieren Sie die gepoolte TetraCysCand1 Probe durch die Übergabe des Puffers durch eine Membran Ultrafiltration (30 kDa cutoff).
    5. Equilibrate der Größe Ausgrenzung Chromatographiesäule mit Kennzeichnung Puffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM DÄMMUND, 1 mM EDTA, 5 % Glycerin) auf dem FPLC-System. Laden Sie TetraCysCand1 Probe (500 µL jedes Mal) und überprüfen Sie das Eluat Brüche durch SDS-PAGE24.
    6. Bündeln Sie die Fraktionen, die mit TetraCysCand1 und konzentrieren Sie das Protein zu ~ 40 µM durch Übergabe des Puffers durch eine Membran Ultrafiltration (30 kDa cutoff). Schätzen Sie die Konzentration des Proteins mit der Absorption bei 280 nm. Speichern Sie das Protein als 50 µL-Aliquots bei-80 ° C.
      Hinweis: Das Protokoll kann hier angehalten werden.
  4. Erstellung von Flash-Cand1.
    1. Hinzufügen von Flash-Lösung 1 µL (siehe Tabelle der Materialien) zu 50 µL TetraCysCand1 Lösung.
    2. Gut mischen und die Mischung bei Raumtemperatur im Dunkeln für 1-2 h zu FlAsHCand1 inkubieren.
      Hinweis: Das Protokoll kann hier angehalten werden.

4. Vorbereitung der Cand1, der Bund-Chase-protein

Hinweis: Das Protein-Vorbereitung-Protokoll ist ähnlich wie bei Schritt 3 mit den folgenden Änderungen.

  1. Legen Sie die kodierende Sequenz des abendfüllenden Cand1 in pGEX-4 t-2-Vektor.
  2. Ändern Sie den Puffer in Schritt 3.3.5 auf einen Puffer mit 30 mM Tris-HCl, 100 mM NaCl, 1 mM DVB-t, 10 % Glycerin verwendet.
  3. Beseitigen Sie Schritte 3.3.7 und 3.3.8.

5. Testen Sie und bestätigen Sie die Bund-assay

  1. Bereiten Sie den Bund-Puffer mit 30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DVB-t, 1 mg/mL Ovalbumin, pH 7.6, und bei Raumtemperatur verwenden.
  2. Testen Sie den Bund zwischen Cul1AMC•Rbx1 und Flash-Cand1 auf einem Fluorimeter.
    1. In 300 µL Puffer FRET, fügen Cul1AMC•Rbx1 (Bund Spender), eine Endkonzentration von 70 nM. Übertragen Sie die Lösung in einer Küvette.
    2. Legen Sie die Küvette in den Probenhalter von einem Fluorimeter. Die Probe mit 350 nm Anregungslicht begeistern und scannen die Emission Signale von 400 nm bis 600 nm auf 1 nm-Schritten.
    3. Wiederholen Sie Schritt 5.2.1 aber Änderung Cul1AMC•Rbx1, Flash-Cand1 (Bund Akzeptor). Scannen Sie die Flash-Cand1-Probe mit der gleichen Methode wie in Schritt 5.2.2.
    4. (Optional) Die Flash-Cand1 mit 510 nm Anregungslicht begeistern, und scannen die Emission Signal von 500 nm bis 650 nm.
    5. In 300 µL Bund Puffer, fügen Sie beide Cul1AMC•Rbx1 und Flash-Cand1, eine Endkonzentration von 70 nM. Analysieren Sie die Probe auf die gleiche Weise wie in Schritt 5.2.2.
  3. Bestätigen Sie den Bund zwischen Cul1AMC•Rbx1 und Flash-Cand1 durch Zugabe von Chase (unbeschriftete Cand1) Protein (Abbildung 3).
    1. Fügen Sie in 300 µL Puffer FRET, 70 nM Cul1AMC•Rbx1 und 700 nM Cand1. Scannen Sie die Probe-Emission wie in Schritt 5.2.2.
    2. Fügen Sie in 300 µL Puffer FRET, 70 nM FlAsHCand1 und 700 nM Cand1. Scannen Sie die Probe-Emission wie in Schritt 5.2.2.
    3. Fügen Sie in 300 µL Puffer FRET, 70 nM Cul1AMC•Rbx1 und 70 nM FlAsHCand1 und der Probe bei 5 min bei Raumtemperatur inkubieren. Fügen Sie dann 700 nM Cand1, und Scannen Sie sofort nach der Zugabe die Probe-Emission wie in Schritt 5.2.2). Beachten Sie, dass dieser Schritt für Schritt 5.2.5 ähnelt.
    4. In 300 µL Bund Puffer, nacheinander hinzufügen 70 nM Cul1AMC•Rbx1, 700 nM Cand1 und 70 nM FlAsHCand1. Inkubieren Sie die Probe bei Raumtemperatur für 5 min, und Scannen Sie die Probe-Emission wie in Schritt 5.2.2. Beachten Sie, dass dies die Chase-Probe (grüne Linie in Abbildung 3).

6. Messen Sie die Vereinigung Geschwindigkeitskonstante (kauf) von Cul1•Cand1

Hinweis: Details für den Betrieb einer gestoppt-Flow Fluorimeter wurde in einem früheren Bericht26beschrieben.

  1. Messung der gestoppt-Flow Fluorimeter vorbereiten.
    1. Schalten Sie die gestoppt-Flow Fluorimeter nach Anweisungen des Herstellers.
    2. Legen Sie das Anregungslicht auf 350 nm und Verwendung ein Bandpass-Filter, der 450 nm Emission ermöglicht, Licht passieren und 500-650 nm Emission Licht blockiert.
    3. Halten Sie die Probe-Ventile an der Position zu füllen , und schließen Sie eine 3 mL Spritze mit Wasser gefüllt. Waschen Sie die zwei Probe-Spritzen (A und B) durch verschieben den Probe Spritze Antrieb nach oben und unten mehrmals mit Wasser. Entsorgen Sie das Wasser, die in diesem Schritt verwendet.
    4. Halten Sie die Probe-Ventile an der Position zu füllen , und schließen Sie eine 3 mL Spritze mit Bund Puffer gefüllt. Waschen Sie die zwei Probe-Spritzen mit dem Bund-Puffer durch verschieben den Probe Spritze Antrieb nach oben und unten mehrmals. Entsorgen Sie alle Bund-Puffers in diesem Schritt.
  2. Nehmen Sie eine Kontrollmessung (Abbildung 4).
    1. Schließen Sie eine 3 mL Spritze und laden Sie Spritze A mit 100 nM Cul1AMC-•Rbx1 im Bund Puffer zu. Drehen Sie das Ventil Probe fahren .
    2. Schließen Sie eine 3 mL Spritze und laden Sie Spritze B mit dem Bund-Puffer zu. Drehen Sie das Ventil Probe fahren .
    3. Mithilfe der Systemsteuerung unter erwerben in der Software zu fünf Schüsse (mischen gleiches Volumen an Proben aus Spritze A und B Spritze) auf die gestoppt-Flow Fluorimeter ohne Aufzeichnung der Ergebnisse.
    4. Öffnen Sie das Control Panel unter erwerben in der Software und die Emission von Cul1 aufnehmen programmierenAMC über 60 s. Dann nehmen Sie einen einzigen Schuss.
    5. Wiederholen Sie Schritt 6.2.4 2 X.
    6. Drehen Sie das Ventil Probe füllen . Spritze B entleeren und waschen mit dem Bund-Puffer.
  3. Maßnahme beobachtet Verband Geschwindigkeitskonstanten (kObs) des Cul1•Cand1 (Abbildung 4 b).
    1. Halten Sie die Probe in Spritze A das gleiche wie in Schritt 6.2.1.
    2. 3 mL Spritze zu verbinden und laden Sie Spritze B mit 100 nM FlAsHCand1 im Bund Puffer. Drehen Sie das Ventil Probe fahren .
    3. Verwenden Sie die Systemsteuerung unter erwerben in der Software, um fünf Schüsse zu nehmen, ohne die Ergebniserfassung.
    4. Öffnen Sie das Control Panel unter erwerben in der Software und die Emission von Cul1 aufnehmen programmierenAMC über 60 s. Dann nehmen Sie einen einzigen Schuss.
    5. Wiederholen Sie Schritt 6.3.4 2 X.
    6. Spritze B entleeren und waschen mit dem Bund-Puffer.
    7. Wiederholen Sie die Schritte 6.3.1–6.3.6 mehrmals mit steigenden Konzentrationen von FlAsHCand1 im Bund Puffer.
    8. Passen Sie die Änderung (Abnahme) in fluoreszierenden Signale gemessen im Laufe der Zeit aus jedem Schuss auf eine exponentielle Kurve. Dadurch erhalten kObsbei jeder Messung, und das Gerät ist s-1. Beachten Sie, dass die Grundlage dieser Berechnung auch in einem früheren Bericht27diskutiert worden ist.
  4. Berechnung der Mittelwert und die Standardabweichung der kObsfür jede Flash-Cand1-Konzentration verwendet. Plotten der durchschnittliche kObsgegen Cand1 Konzentration (Abbildung 4), und die Steigung der Linie repräsentiert das kauf der Cul1•Cand1, mit einer Einheit von M-1 s-1.

7. Messen Sie die Dissoziation Geschwindigkeitskonstante (koff) des Cul1•Cand1 in Gegenwart von Skp1•F-Box-Protein.

Hinweis: Dieser Schritt ist ähnlich wie bei Schritt 6 mit den folgenden Änderungen.

  1. In Spritze A, unter der Position zu füllen , laden, eine Lösung von 100 nM Cul1AMC•Rbx1 und 100 nM FlAsHCand1 im Bund Puffer. Drehen Sie das Beispiel der "DRIVE"-Position.
  2. Laden Sie in Spritze B unter der Position zu füllen , eine Lösung des Skp1•Skp2 (nach einem vorherigen Bericht20vorbereitet). Drehen Sie das Beispiel der "DRIVE"-Position.
  3. Öffnen Sie das Control Panel unter erwerben in der Software und die Emission von Cul1 aufnehmen programmierenAMC über 30 s. Dann nehmen Sie einen einzigen Schuss. Die fluoreszierende Signale erhöhen im Laufe der Zeit nach dem Mischen Lösungen A Spritze und Spritze B (Abbildung 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Testen Sie den Bund zwischen Cul1AMC und FlAsHCand1 wir zunächst ermittelt die Emissionsintensität 70 nM Cul1AMC (Spender) und 70 nM FlAsHCand1 (Akzeptor), bzw. (Abb. 3A-C, blaue Linien). In jeder Analyse nur eine Emission Peak Gegenwart und die Emission von FlAsHCand1 war, war (Akzeptor) niedrig. Wenn 70 nM der Cul1AMC und FlAsHCand1 waren gemischt, um Bund zu generieren, zwei Emission Spitzen in den Emissions-Spektren anwesend waren und der Höhepunkt des Cul1AMC wurde niedriger und die Spitze des FlAsHCand1 wurde höher (Abbildung 3A -C, rote Linien). Als Full-length Cand1 Bund, diente der Spender Höhepunkt zeigte eine Ermäßigung von 10 % in ihrer Intensität (Abb. 3A, rote Linie), und Cand1 mit seine erste Helix abgeschnitten verwendet wurde, wurde die Reduzierung der Spender-Peak-Intensität auf 30 % (Abb. 3 b erhöht. -D, rote Linien), was auf höhere FRET-Effizienz. Zu bestätigen, dass die Signaländerungen wurden vom Bund zwischen Cul1 führteAMC und Flash-Cand1, 70 nM Cul1AMC (Spender) mischte mit 700 nM stumme Cand1 (Chase) und 70 nM FlAsHCand1 (Akzeptor). Infolgedessen die Spender-Gipfel wurde vollständig restauriert und der Akzeptor-Gipfel wurde verringert (Abbildung 3, grüne Linie), die bestätigt, dass die beobachteten Bund auf die Bildung von der Cul1 abhängtAMCFlAsHCand1 Komplex. Hinzufügen von 700 nM Skp1•Skp2 bis 70 nM Cul1AMCFlAsHCand1 auch vollständig restauriert den Spender Gipfel (Abbildung 3D, grüne Linie), was darauf hindeutet, dass der Cul1•Cand1-Komplex vollständig durch Skp1•Skp2 im Gleichgewicht gestört wurde.

Figure 3
Abbildung 3: repräsentative Bund Assay für Cul1•Cand1 Komplexbildung. Proben im Bund Puffer (30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DVB-t, 1 mg/mL Ovalbumin, pH 7.6) waren begeistert, bei 350 nm und die Emissionen wurden gescannt von 400 nm bis 650 nm. (A) Emissionsspektren von 70 nM Cul1AMC, 70 nM FlAsHCand1 (voll) und eine Mischung aus beidem (FRET). Cand1 (voll) steht für Cand1 in voller Länge. (B) Emissionsspektren von 70 nM Cul1AMC, 70 nM FlAsHCand1 und eine Mischung aus beidem (FRET). Cand1 mit seiner ersten Helix gelöscht wurde in diesem Experiment und danach eingesetzt. (C) Emissionsspektren von 70 nM Cul1AMC, 70 nM FlAsHCand1, eine Mischung aus beidem (FRET), und Kontrolle für Bund (Chase) zu jagen. Die Chase-Probe enthielt 70 nM Cul1AMC, 700 nM Cand1 und 70 nM FlAsHCand1. (D) Emissionsspektren von 70 nM Cul1AMC, eine Mischung von 70 nM Cul1AMC und 70 nM FlAsHCand1 (Bund) und 700 nM Skp1•Skp2 hinzugefügt, um die 70 nM Cul1AMCFlAsHCand1 Komplex. In jeder Parzelle, die Emission Signale wurden normiert auf die Emission von 70 nM Cul1AMC bei 450 nm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Zur Messung der kauf der Cul1•Cand1 mit der etablierten FRET-Test durch die Reduzierung der Geber-Signal im Laufe der Zeit auf die gestoppt-Flow Fluorimeter überwachen wir zuerst getestet und bestimmt die Konzentration des Proteins verwendet werden. Wenn 5 nM der Cul1AMC und FlAsHCand1 dienten, sehr wenig Signalwechsel beobachtet (Abb. 4A), in der Erwägung, wenn die Konzentration jedes Proteins auf 50 erhöht wurde nM, die Reduzierung des Signals im Laufe der Zeit wurde beobachtet ( Abbildung 4 b) und diese Änderung wurde abgeschafft, wenn Puffer ohne FlAsHCand1 (Abbildung 4) hinzugefügt wurde. Daher 50 nM Cul1AMC für weitere Analysen verwendet wurde, und eine Reihe von beobachteten Vereinigung Geschwindigkeitskonstanten (kObs) wurden gemessen, durch das Mischen von 50 nM Cul1AMC mit steigenden Konzentrationen von FlAsHCand1. KObs für jedes Experiment wurde durch den Einbau der verweist auf eine exponentielle Kurve berechnet, und die kObs erhalten von der gleichen FlAsHCand1 Konzentration wurden gemittelt. Plotten der durchschnittliche kObs mit der Cand1-Konzentration und eine lineare Regression (Abbildung 4) durchführen, war die kauf entschlossene7,27.

Figure 4
Abbildung 4: repräsentative Messung des Vereins Geschwindigkeitskonstante. (A) die Fluoreszenz von 5 nM Cul1AMC wurde durch eine gestoppt-Flow Fluorimeter überwacht, im Laufe der Zeit nach Zugabe von 5 nM FlAsHCand1. (B) die Fluoreszenz von 50 nM Cul1AMC wurde durch eine gestoppt-Flow Fluorimeter überwacht, im Laufe der Zeit nach Zugabe von 50 nM FlAsHCand1. (C) die Fluoreszenz von 50 nM Cul1AMC wurde durch eine gestoppt-Flow Fluorimeter im Laufe der Zeit nach Zugabe des Puffers Bund überwacht. (D) kauf für die Cand1 Bindung an Cul1. k-Obs von Cul1•Cand1 bei verschiedenen Konzentrationen von Cand1 werden dargestellt. Lineare Steigung gibt kauf 1,8 x 107 M-1 s-1. Fehlerbalken darzustellen ±SEM; n = 4. Alle Proben wurden im Bund Puffer vorbereitet und begeistert bei 350 nm. Ein Bandpass-Filter wurde verwendet, um Signale von AMC zu sammeln und Blitz Signale ausschließen. Keine Daten wurden normalisiert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Ähnlich wie bei der Messung von kauf, wir die Geschwindigkeitskonstante beobachteten Dissoziation des Cul1•Cand1 durch Überwachung der Anstieg (Wiederherstellung) des Spenders Signals im Laufe der Zeit auf die gestoppt-Flow Fluorimeter gemessen. Cul1AMC und FlAsHCand1 wurden zunächst gemischt und dann Skp1•Skp2 wurde hinzugefügt, um die vormontierte Cul1AMCFlAsHCand1 auf gestoppt-Flow Fluorimeter. Die Geber-Signal schnell erhöht und es offenbart ein kObs von 0,4 s-1 (Abbildung 5). Im Gegensatz dazu wenn Puffer wurde hinzugefügt, um die vormontierte Cul1AMCFlAsHCand1, keine Erhöhung der Signal wurde beobachtet, was darauf hindeutet die schnelle Dissoziation des Cul1•Cand1 durch Skp1•Skp2 ausgelöst wurde.

Figure 5
Abbildung 5: repräsentative Messung der Dissoziation Geschwindigkeitskonstante. Die Veränderung der Spender Fluoreszenz im Vergleich zur Zeit gemessen wurde, nach Zugabe von 150 nM Skp1•Skp2 oder den Bund Puffer zu 50 nM Cul1AMCFlAsHCand1 Komplex. Signaländerungen wurden an eine exponentielle Kurve anpassen, und es gibt beobachteten Dissoziation Geschwindigkeitskonstante 0,4 s-1. Die experimentellen Bedingungen waren ähnlich dem in Abbildung 4beschrieben. Bitte klicken Sie hier für eine größere Version dieser Figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

FRET ist ein physikalisches Phänomen, das von großem Interesse für Studium und das Verständnis biologischer Systeme19ist. Hier präsentieren wir Ihnen ein Protokoll für die Prüfung und Verwendung von Bund, um die verbindliche Kinetik der zwei interagierenden Proteine zu studieren. Beim Bund zu entwerfen, wir hielten drei Hauptfaktoren: die spektrale Überlappung zwischen Emission und Akzeptor Erregung Spender, der Abstand zwischen den zwei Fluorophore und die Dipol-Ausrichtung der Fluorophore28. Wählen Sie die Fluorophore für Bund, wir Anregung und Emission-Spektren von der Fluorophore überlagert, und suchten nach einem Fluorophore, deren Emission Gipfel gut getrennt sind, während das Emissionsspektrum des Spenders erheblich überschneidet sich mit der Anregung Spektrum an den Akzeptor (Abbildung 2). Zur Optimierung der Interfluorophore Abstand und Orientierung, wir nutzten die Kristallstruktur für Hilfe, und wir in erster Linie als Befestigung Fluorophore Protein Termini, vor allem wegen der geringeren Gefahr der Störung der Protein-Struktur und Aktivität. Da der Abstand zwischen der N-Terminus des Cand1 (Cand1NTD) und der C-Terminus des Cul1 (Cul1CTD) ist kürzer als die Entfernung zwischen dem C-Terminus des Cand1 und der N-Terminus des Cul1 (Abbildung 1), beschlossen wir, Cand1 beschriftenNTD und Cul1CTD. Weil wir 80 – 90 % Kennzeichnung der N-Terminus eines Proteins mit der Tetracysteine Tag25erreichen konnten, wir entschieden uns für Cand1 beschriftenNTD mit Blitz durch das Tetracysteine-Tag. Wir zunächst mit der Bezeichnung der Cul1CTD mit Cyan fluoreszierenden Proteins (GFP), die einige Vorteile gegenüber AMC hat. Erstens ist es eine genetisch codierte fluoreszierende Tag, so ist es nicht erforderlich zusätzliche Kennzeichnung Prozess noch Schritte, die das beschriftete fluoreszierende Protein von seinem unbeschriftete Vorläufer zu reinigen. Zweitens: GFP ist heller als AMC, und bietet somit, höheren Empfindlichkeit der Assay (siehe Diskussion unten). Drittens hat GFP eine größere Bandbreite mit Blitz, potenziell Gewinnung effizienter Bund mit Blitz überlappen. Trotz dieser Vorteile ist GFP Protein jedoch viel größer als das AMC-Tag, das die Protein-Konformation und Inter molekulare Interaktion stören kann. In der Tat, wir waren nicht darauf bedacht Bund zwischen Cul1GFP und FlAsHCand1 in unserem Test, der wahrscheinlich durch unzureichende Dipol Orientierung oder Störung der Cul1-Cand1 Wechselwirkung durch das GFP-Tag. Wir dann mit der Bezeichnung der Cul1CTD mit AMC, und wir beobachteten Bund zwischen Cul1AMC und Flash-Cand1. Den ersten Bund mit der Full-length Cand1 zu 10 % Reduktion Spender (Abbildung 3A) geführt. Weiter fanden wir, dass durch das Löschen der ersten Schraubenlinie des Cand1, der Abstand zwischen Cul1 und Cand1 von 26,8 Å, Å 15,5 (Abbildung 1) und Cand1 verkürzt ist fehlt der ersten Helix ergab a viel stärker Bund mit Cul1, mit 30 % Reduzierung des Ausstoßes Spender Spitze (Abb. 3 b). Darüber hinaus kann man der FRET-Effizienz verbessern, durch die Wahl eines Spenders Fluorophor mit höheren Quantenausbeute und ein Akzeptor Fluorophor mit einem größeren Aussterben Koeffizienten.

Ein charakteristisches Merkmal der Bund ist das tritt FRET, die Emission des Spenders abnimmt und die Emission der Akzeptor erhöht (Abb. 3 b). Jedoch Fluorophore kann Empfindlichkeit ihrer Umgebung anzeigen und somit kann die Emissionsintensität ändern, wenn ein anderes Protein, auch in Abwesenheit der Bund29vorliegt. Zu bestätigen, dass die geänderten Emission wir beobachteten wegen Bund zwischen Cul1AMC und FlAsHCand1 wir 10 x übersteigende Betrag der unbeschrifteten Akzeptor Protein (Cand1) als eine Verfolgungsjagd hinzugefügt. Die Jagd wandelt die Emission des Spenders und der Akzeptor zurück auf das normale Niveau (Abbildung 3), die das unterstützt die geänderte Emissionen von Cul1AMC und FlAsHCand1 hängen Proteinprotein Interaktion, und daher dieses Ergebnis bestätigt, dass wir einen Bund-Assay etabliert, der die Assoziation und Dissoziation des Cul1•Cand1 berichtet. Darüber hinaus wir der vormontierten Cul1 Skp1•Skp2 hinzugefügtAMCFlAsHCand1 komplex und Skp1•Skp2 nennt man in der Lage sein, die Cul1-Cand1 Wechselwirkung6zu stören. Wir fanden, dass der Bund zwischen Cul1AMC und FlAsHCand1 verschwand (Abbildung 3D, grüne Linie) und das Emissionsspektrum wurde ähnlich wie das Emissionsspektrum der Chase-Probe (Abbildung 3, grüne Linie), was darauf hindeutet Cul1AMCFlAsHCand1 ist durch Skp1•Skp2 und Cul1 getrenntAMC zeigt keine abnormale Ausstoß, wenn Skp1•Skp2 vorhanden ist.

Durch die Veränderung der Spender Emission überwachen, können wir direkt beobachten der Assoziation und Dissoziation des Cul1AMCFlAsHCand1 auf einem gestoppt-Flow Fluorimeter. Das gestoppt-Flow-System funktioniert durch Injektion von Reaktanden zu einer Mischkammer, rasch die Reaktanden zu mischen, und den Fluss zu stoppen, sobald die gemischte Reaktionspartner in einer Beobachtung Kammer5verschoben werden. Die Signalerkennung beginnt in der Regel 1 bis 2 Millisekunden (ms) nach dem Mischen, die es ermöglicht, die Interaktionen, die auftreten, auf die Millisekunde Zeitskala studieren. Jedoch wenn die Halbwertszeit der beobachteten Reaktion kürzer als der Zeitaufwand zum Mischen der Edukte auf einem bestimmten Gerät ist, dieser Ansatz ist nicht empfindlich genug, und ist nicht mehr angemessen30. Gestoppt-Flow-Analysen wurden zur Geschwindigkeitskonstanten 10-6– 106 s-1 für Reaktionen erster Ordnung und 1 / 109 M-1 s-1 für Reaktionen zweiter Ordnung5bis hin zu bestimmen. Um zuverlässige Messung der kinetischen Parameter mit Hilfe der gestoppt-Flow Fluorimeter zu erhalten, ist eine wesentliche Änderung des fluoreszierenden Signals zwischen dem Start und Gleichgewicht notwendig. Wir nutzten die Flash-Cand1 die erste Helix als den Akzeptor fehlt, weil es bessere Bund mit Cul1 ergibtAMCund wir testen die Konzentration der Proteine für die Messung verwendet werden. Wenn 5 nM der Cul1AMC und FlAsHCand1 waren gemischt, keine Änderung in Cul1AMC Signal beobachtet (Abb. 4A), schlägt diese Konzentration für die Messung nicht ausreicht. Wann wurden die Proteinkonzentrationen auf 50 erhöht nM, der Rückgang der Cul1AMC -Signal im Laufe der Zeit wurde offensichtlich (Abbildung 4 b), und diese Änderung tritt nicht auf, wenn das Akzeptor-Protein fehlt (Abbildung 4) war. Basierend auf diesem Ergebnis, wir nutzten Cul1AMC auf 50 nM Konzertierung der kauf Maß für Cul1•Cand1. Die Konzentration des Spenders Proteins zur Messung kann variieren, wenn verschiedene Fluorophore verwendet werden. Zum Beispiel, wenn Cul1 beschriftet mit GFP, 5 nM der GFPCul1 reicht für die Messung von kam6. Daher die optimale Konzentration des Proteins sollte getestet werden, für jedes Paar von Bund und im Prinzip heller Fluorophore erlauben den Einsatz von niedrigeren Proteinkonzentrationen und bieten besseren Signal-Rausch-Verhältnis31.

Um Protein-Protein-Wechselwirkungen von Bund zu untersuchen, bedarf es Proteine an den entsprechenden Positionen ohne Störung der Protein-Struktur und Tätigkeit, die möglicherweise die Verwendung von Bund schränkt Fluorophore zuweisen. In diesem Protokoll wir beschriftet N-Terminus des Cand1 mit einem Tetracysteine-Tag, der speziell den Flash-Farbstoff bindet und der Flash-Farbstoff wird fluoreszierende, erst nachdem es Ziel Protein32bindet. Wir beschrifteten Cul1 mit Sortase-vermittelten Transpeptidation, der eine kurze Peptid tragen ein Fluorophor Sortase Tag am C-Terminus des Cul121,22angefügt wird. Nach dem Entfernen nicht umgesetztes Proteins mit Ni-NTA-Perlen (Schritte 2.4.3–2.4.4) ist die Kennzeichnung Effizienz > 80 % mit dem Tetracysteine-Tag, und fast 100 % mit dem Sortase, seine6 Tag. Beide Methoden hinzufügen das Zielprotein, minimale Änderungen der Proteinstruktur Einführung ein paar Aminosäuren. Ähnliche Ansätze, wie die Transglutaminase Anerkennung Sequenz (Q-Tag)33 und die YbbR Tag34, können auch verwendet werden, das Zielprotein in gewissem Sinne ortsspezifische beschriften. Photostabilität von fluoreszierenden Farbstoffen kann darüber hinaus auch die Verwendung von Bund beschränken. Wiederholte oder längere Exposition gegenüber Anregungslicht führen zu Immunofluoreszenz Fluorophor, was zu ungenauen Quantifizierung Ergebnisse35. Daher sollte die Donor und Akzeptor Proteine während der Zubereitung und Lagerung Schritte vor Licht geschützt werden. Beim Bund mit um zu messen, Ereignisse, die langsam, statt ständig beobachten die Veränderung der Spender Emission im Laufe der Zeit kurzen Lesungen der Spender-Emission auftreten sollte in längeren Zeitabständen genommen werden und die Probe sollte im Dunkeln gehalten werden, während der gesamten Experiment6.

Da Bund empfindlich und quantitative ist, ist es ein wichtiges Instrument für die Untersuchung der Wechselwirkung zwischen Makromolekülen geworden. Dieses Protokoll stellt ein Beispiel der Verwendung von Bund, um die Dynamik der Proteinkomplex in Lösung zu studieren. Bund ist auch verwendet worden zusammen mit live Cell imaging zur Untersuchung der molekularen Interaktionen in lebenden Zellen36, das ist mächtig in die Dynamik der Proteinkomplexe unter physiologischen Bedingungen enthüllt. Darüber hinaus kann Bund auch auf der Einzelmolekül-Ebene verwendet werden, die Echtzeit-Dynamik der makromolekularen komplexe37,38, Studium Einblicke in die Konformationsänderung des Komplexes. Zur Verbesserung der Effizienz und Erkennung von Bund, Fluorophore und Biosensoren mit Helligkeit und Photostabilität sind von großem Interesse, die aktiv entwickelt und studierte28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Wir danken Shu-Ou Shan (California Institute of Technology) für aufschlussreiche Diskussion über die Entwicklung des Bund-Assays. M.G., Y.Z und X.L. wurden durch Start-Fonds von der Purdue University, Y.Z finanziert und X.L.This Arbeit wurde teilweise durch einen Zuschuss der Samen von Purdue University Center für Pflanzenbiologie unterstützt.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics