Protein kompleksleri milisaniyelik zaman ölçekte dinamikleri çalışmaya vitro Floresans rezonans enerji transferi içinde kullanma

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Protein-protein etkileşimleri biyolojik sistemleri için kritik olan ve bağlama Kinetik çalışmalar dynamics ve protein kompleksleri fonksiyonu sağlar. Floresans rezonans enerji transferi ve durdu-akış tekniği kullanarak karmaşık bir proteinin Kinetik parametrelerin quantifies bir yöntemi açıklanmaktadır.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Proteinler biyolojik sistemleri Birincil operatörler, ve genellikle diğer makro veya onların biyolojik iþlevlerini küçük moleküller ile etkileşim. Bu tür etkileşimler son derece dinamik, etkileşen alt birimleri sürekli ilişkili ve belirli oranlarda ayrışmış anlamı olabilir. Nicel açılan bağlama Kinetik eğitim etkileşimin gücünü ortaya çıkarır gibi teknikleri kullanarak bağlama benzeşme ölçme anlayışlar üzerinde nasıl hızlı sağlarken etkileşim oluşur ve ne kadar her karmaşık bulunabilir. Ayrıca, bir etkileşim bir protein Döviz Çarpanı veya bir ilaç gibi ek bir faktör huzurunda Kinetik ölçme hangi etkileşim için önemli bilgi sağlayan diğer bir faktör tarafından düzenlenmiş mekanizması ortaya çıkarmak yardımcı olur biyolojik ve tıbbi araştırma ilerlemesi. Burada, biz yüksek iç Derneği oranına sahip ve hızlı bir şekilde başka bir protein tarafından ayrışmış bir protein kompleksi bağlama Kinetik ölçmek için bir iletişim kuralı tanımlamak. Protein kompleksi tüp bebek oluşumu raporlamak için Floresans rezonans enerji transferi yöntemi kullanır ve hızlı Derneği ve gerçek zamanlı olarak durdu-akış fluorimeter kompleks ayrılma izleme sağlar. Bu tahlil kullanarak, protein kompleksi Derneği ve ayrılma hızı sabitler sayısal.

Introduction

Biyolojik etkinlikler sonuçta proteinler, en hangisinin uygun biyolojik fonksiyonlar için başkalarıyla etkileşim tarafından yapılmaktadır. Hesaplamalı bir yaklaşım kullanarak, insan protein-protein etkileşimler toplam miktarı ~ 650.0001olduğu tahmin edilmektedir ve bozulma bu etkileşimlerin kez hastalıklar2' ye yol açar. Hücresel ve organizma işlemlerin denetlenmesinde önemli rolleri nedeniyle, Maya-iki-hibrid, bimolecular floresan uluslara, Böl-luciferase gibi protein-protein etkileşimleri çalışmak için çeşitli yöntemler geliştirilmiştir uluslara ve co-immunoprecipitation tahlil3. Bu yöntemler keşfetmek ve protein-protein etkileşimleri onaylayarak, iyi olmakla birlikte, genellikle sigara nicel ve böylece etkileşen protein ortakları arasında benzeşme hakkında sınırlı bilgi sağlar. Nicel çekme-çıkışlar bağlama benzeşim (örneğin, ayrışma sabiti Kd) ölçmek için kullanılabilir ama bağlama Kinetik ölçmek değil, ne de Kd bir yetersiz nedeniyle çok düşük olduğunda uygulanabilir Sinyal-gürültü oranı4. Yüzey plasmon rezonans (SPR) spektroskopisi bağlama Kinetik quantifies ama bir belirli yüzey ve potansiyel olarak reaksiyona5bağlama özelliğini değiştirebilirsiniz yüzeyi bir reaksiyona immobilizasyon gerektirir. Ayrıca, SPR hızlı Derneği ve ayrılma oranları5ölçmek zor ve SPR bir protein kompleksi protein alt alışverişi olay karakterize etmek için kullanmak için uygun değildir. Burada, protein karmaşık montaj ve demontaj, bir milisaniye zaman ölçeği oranları ölçme sağlayan bir yöntem açıklanmaktadır. Bu yöntem F-box protein Satım faktörü6,7 Cullin - ssociated -Nedd8 -dissociated protein 1 (Cand1)rolünü belirlemek için gerekliydi.

Cand1 Cullin-RING Ubikuitin ligazlar büyük ailesine ait Skp1•Cul1•F-box protein (SCF) E3 ligazlar dinamikleri düzenlemektedir. Yüzük etki alanı proteini Rbx1 bağlar, Cul1 ve yüzeylerde acemi ve Cul1 adaptör protein Skp18ile bağlar değiştirilebilir bir F-box protein, cullin ve SCFs oluşur. Bir E3 ligaz olarak SCF Ubikuitin, substrat için konjugasyon tromboksan ve ne zaman belgili tanımlık substrate F-box protein tarafından oluşturulmuştur ve Cul1 gibi Ubikuitin protein Nedd89tarafından değiştirildiğinde etkinleştirilir. Cand1 değiştirilmemiş Cul1 bağlar ve bağlayıcı, hem Skp1•F-box protein Cul1 ile dernek ve Nedd8 fiil Cul110,11,12,13bozan. Sonuç olarak, Cand1 bir inhibitörü SCF faaliyet tüp bebek olduğu ortaya çıktı, ama Cand1 eksikliği organizmalarda in vivo14,15,16 SCF faaliyetleri düzenleyen Cand1 olumlu bir rol göstermektedir kusur neden , 17. Bu paradoksun sonunda Cul1, Cand1 ve Skp1•F-box protein arasındaki dinamik etkileşimler ortaya bir nicel araştırma tarafından açıklandı. SCF ve Cul1•Cand1 komplekslerinin oluşumu tespit Floresans rezonans enerji transferi (FRET) deneyleri kullanarak, dernek ve ayrılma oranı sabitleri (kTarih ve kkapalı, sırasıyla) olduğunu tek tek ölçülür. Cand1 ve Skp1•F-box protein formu son derece sıkı kompleks Cul1, ama kkapalı SCF ile Cand1 tarafından önemli ölçüde artar ve kkapalı Cul1•Cand1 önemli ölçüde artırılır ölçümleri ortaya tarafından Skp1•F-box protein6,7. Bu sonuçlar Cul1 eski SCF kompleksleri geri dönüşüm yoluyla yeni SCF kompleksleri tromboksan protein Satım faktör olarak Cand1 rolü tanımlamak için ilk ve kritik destek sağlar.

Burada, biz geliştirme ve Cul1•Cand1 karmaşık7dinamiklerini incelemek için FRET tahlil kullanma prosedürü mevcut ve çeşitli biomolecules dinamiklerini incelemek için aynı prensip uygulanabilir. FRET oluşur uygun dalga boyu ile heyecan verici ve bir alıcısı donör emisyon spektrum örtüşen uyarma spektrum ile 10-100 bir mesafe içinde varsa Å. Heyecan durumu böylece donör yoğunluğu azalan ve artan alıcısı yoğunluğu18alıcısı için aktarılır. PERDE (E) verimliliğini Förster RADIUS (R0) ve donör ve alıcısı fluorophores (r) arasındaki mesafe bağlıdır ve tanımı: E = R06/ (R0 6 + r6) Donör-alıcısı çifti ve çözüm spektral çakışma19kullanılan, Förster RADIUS (R0) dipol açısal yönlendirme gibi birkaç etkene bağlıdır. Donör emisyon gerçek zamanlı olarak değişiklik izler ve hızlı kTarih ve kkapalı, bir durdu-akış fluorimeter perde tahlil uygulamak için verimli FRET kurmak gereklidir bu donör emisyon önemli bir azalma sonuçlarında. Bu nedenle, boyalar takmak için uygun çift floresan boyalar ve hedef proteinler sitelerinde seçerek verimli perde tasarımı önemlidir ve bu protokol için ele alınacak.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. tasarım perde tahlil.

  1. Cul1•Cand1 karmaşık yapısı dosyayı Protein veri bankasından (dosya 1U6G) yükleyin.
  2. Cul1•Cand1 PyMOL içinde karmaşık yapısını görüntüleyin.
  3. Cand1 ilk amino asit ve Cul1 son amino asit arasındaki uzaklık PyMOL Sihirbazı menüsünden Ölçüm işlevini kullanın (şekil 1).
  4. Online spectra Görüntüleyici yükler ( Tablo malzemelerigörmek) ve uyarma ve emisyon spectra 7-amino-4-methylcoumarin (AMC) ve FlAsH aynı anda görüntüleyebilirsiniz (Şekil 2). AMC FRET donör ve flaş perde alıcısı olduğunu unutmayın.

Figure 1
Şekil 1: Cul1•Cand1 ve etiketleme siteleri potansiyel arasındaki mesafe ölçümü kristal yapısını. Kristal yapısı dosya Protein veri bankasından (dosya 1U6G) indirilen ve PyMOL içinde görüntülenebilir. Seçili atomlar arasındaki ölçümleri PyMOL tarafından yapıldı. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: uyarma ve floresan boyalar için FRET emisyon spectra. Spectra AMC (7-amino-4-methylcoumarin) ve FlAsH gösterilir. Kesik çizgiler uyarma spectra gösterir ve düz çizgiler emisyon spectra gösterir. Görüntü aslında floresan SpectraViewer tarafından oluşturulan ve daha iyi anlaşılır olması için güncellenmiştir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

2. Cul1 hazırlanmasıAMC•Rbx1, FRET donör protein

  1. Plazmid E. coli hücrelerdeki insan Cul1sortase•Rbx1 ifade etmek için inşa. E. coli hücrelerdeki insan Cul1•Rbx1 ortak ifade iki plazmid ayrıntılı bir önceki rapor20olarak açıklanan unutmayın.
    1. "LPETGGHHHHHH" (sortase-O'nun6 etiketi) kodlama bir DNA dizisi ile standart PCR ve kopyalama yöntemleri21,22Cul1 kodlama dizisi 3' sonuna ekleyin.
    2. Gen ekleme doğru olduğunu onaylamak için yeni plazmid sıra.
  2. Cul1sortase•Rbx1 E. coli hücrelerdeki co hızlı. Yöntem bir önceki rapor20türetilmiştir.
    1. Mix 100 ng her iki Plasmid'ler ile BL21 in (DE3) kimyasal olarak yetkili hücreleri ortak dönüşüm kullanarak ısı şok yöntemi23. Hücreleri 100 µg/mL Ampisilin ve 34 µg/mL kloramfenikol 37 ° C'de gecede içeren LB agar plaka üzerinde büyür.
    2. 50 mL taze dönüştürülmüş koloniler ile LB kültürünün aşılamak ve gecede 37 ° C'de 250 d/d sallayarak ile büyür. Bu bir starter kültür verir.
    3. 6 şişeler, her biri 1 L LB orta, 5 mL starter kültür her ile aşılamak ve 37 ° C'de 250 OD600 ~ 1.0 olana sallayarak rpm ile büyür. 16 ° c kültür serin ve izopropil-β-D-thiogalactoside (IPTG) eklemek için 0.4 mM. Kültür 16 ° C'de gecede 250 d/d sallayarak ile devam et.
    4. Santrifüjü 5000 x g 15dk için de ile E. coli hücreleri hasat ve hücre granül 50 mL konik tüpler toplamak.
      Not: Hücre topakları protein arıtma işlenebilir veya protein saflaştırma adımlara geçmeden önce-80 ° C'de donmuş olabilir.
  3. Cul1sortase•Rbx1 karmaşık arıtma. Bu yöntem bir önceki rapor20türetilmiştir.
    1. 50 mL lizis arabelleği (30 mM Tris-HCl, 200 mM NaCl, 5 mM DTT, % 10 gliserol, 1 tablet proteaz inhibitörü kokteyl, pH 7,6) Cul1sortase•Rbx1 ifade E. coli hücreleri Pelet için ekleyin.
    2. Sonication % 50 genlik, buzla sayfasındaki hücreleri parçalayıcı. 1-ikinci açık ve 1 saniye kapalı arasında geçiş ve 3 dakikadır çalıştırın.
    3. 2.3.2 x 2-3 arasındaki adımları yineleyin.
    4. Hücre lysate 50 mL aralıklarla tüp içine aktarmak ve hücre artıkları Santrifüjü 25.000 x g için 45 dk de kaldırmak.
    5. Açik Hücre lysate ile 5 mL glutatyon boncuk 4 ° c 2 h için kuluçkaya.
    6. 1.500 x g 4 ° C'de 2 min için boncuk lysate karisimin santrifüj kapasitesi Süpernatant kaldırın.
    7. Boncuk 5 mL lizis arabelleği (ile hiçbir proteaz inhibitörleri) ile yıkama ve süpernatant Santrifüjü 1.500 x g 4 ° C'de 2 min için de sonra kaldırın
    8. 2.3.7 adımı yineleyin 2 x.
    9. 3 mL lizis arabellek yıkanmış boncuk ekleyin ve boncuk Bulamaç boş bir sütuna aktarmak.
    10. Elüsyon arabellek (50 mM Tris-HCl, 200 mM NaCl, 10 mM indirgenmiş glutatyon, faz 8.0) 5 mL sütuna ekleyin. 10 dakikadır kuluçkaya ve eluate toplamak.
    11. 2.3.10 x 3-4 arasındaki adımları yineleyin.
    12. 5 mg/mL Trombin 200 µL ekleyin ( Tablo malzemelerigörmek) glutatyon boncuk üzerinden eluate için ve bir gecede 4 ° C'de kuluçkaya
      Not: Protokol burada duraklatılmış.
    13. Protein örnek (25 mM HEPES, 1 mM DTT, %5 gliserol, pH 6,5) arabelleği A ile üç katı oranında seyreltin.
    14. Bir ba * exchange Kromatografi sütun equilibrate ( Tablo malzemelerigörmek) arabelleği A. ile bir FPLC sistemde
    15. Dengelenmiş katyon değişim Kromatografi sütun bir 0.5 mL/dk akış hızı, protein örneğe yükleyin.
    16. Protein ile 40 mL NaCl Gradyanda arabellek A ve 1 mL/dk akış hızı % arabellek B (25 mM HEPES, 1 M NaCl, 1 mM DTT, %5 gliserol, pH 6,5) 0-50 karıştırarak elute.
    17. Eluted protein farklı kesirler SDS-sayfa24kullanarak kontrol edin.
      Not: Protokol burada duraklatılmış.
    18. Cul1sortase•Rbx1 içeren eluate kesirler havuz.
    19. Arabelleğin bir Ultrafiltrasyon membran (30 kDa kesme) üzerinden geçerek havuza alınan Cul1sortase•Rbx1 örnek 2.5 ml konsantre.
  4. AMC Cul1 C-terminus sortase-aracılı transpeptidation21,22ekleyin.
    1. Sortase arabellek (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7.5) Cul1sortase•Rbx1 örnek arabellekte değiştirmek desalting sütun kullanarak ( Tablo malzemelerigörmek).
      1. Sortase arabellek 25 mL desalting bir sütun equilibrate.
      2. Cul1sortase•Rbx1 örnek 2.5 mL sütuna yerleştirin. Akışı aracılığıyla atın.
      3. Sortase arabellek 3,5 mL ile örnek elute. Akışı aracılığıyla toplamak.
    2. İçinde 900 µL Cul1sortase•Rbx1 çözüm sortase arabellek 600 saf µM sortase bir çözüm 100 µL ve 25 mM GGGGAMC peptid 10 µL ekleyin. Reaksiyon karışımı 30 ° C'de karanlık geceleme kuluçkaya. Not Bu adımda Cul1 çıkarılırAMC•Rbx1.
      Dikkat: Floresan boyalar ışık, bu yüzden onları mümkün olduğunca protein ve örnek hazırlama sırasında ortam ışığına kullanılmasını önlemek için duyarlıdır.
      Not: Protokol burada duraklatılmış.
    3. Ni-NTA özel boncuk 50 µL tepki karışıma ekleyin ve 30 dk için oda sıcaklığında kuluçkaya.
    4. Ni-NTA özel boncuk tarafından Santrifüjü 5000 x g 2 min için de cips ve süpernatant toplamak.
    5. Bir boyut dışlama Kromatografi sütun equilibrate ( Tablo malzemelerigörmek) arabelleği (30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, % 10 gliserol) FPLC sistemi ile.
    6. Tüm Cul1 yükAMC•Rbx1 örnek boyutu dışlama Kromatografi sütun. 1.5 x sütun hacmi arabellek ile elute.
    7. Eluate kesirler SDS-sayfa24' kontrol edin.
    8. Cul1 içeren eluate kesirler havuzAMC•Rbx1.
    9. Protein konsantrasyonu 280 onun Absorbans kullanarak ölçmek nm bir Spektrofotometre ile.
    10. Aliquot protein çözüm ve mağaza-80 ° C'de
      Not: Protokol burada duraklatılmış.

3. FlAsHCand1, FRET alıcısı protein hazırlanması

Not: Çoğu adımları bu bölümünde, adım 2 ile aynıdır. Farklı koşullar aşağıda ayrıntılı olarak açıklanmıştır.

  1. İnsan TetraCysCand1 E. coli hücrelerdeki ifade etmek için plazmid oluşturmak.
    1. "CCPGCCGSG" (tetracysteine/TetraCys etiketi) kodlama DNA dizisi 15inci amino asit Cand1 ile düzenli PCR25 önce Ekle (astar sıraları: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. PCR ürünü pGEX-4T-2 vektör takın. Doğru ve çerçevede gen ekleme onaylamak için plazmid sıra.
  2. Plazmid Rosetta yetkili hücrelere dönüştürülür dışında olduğunu TetraCysCand1in E. coli hücreleri adım 2.2, aynı şekilde ifade eder.
  3. E. coli hücrelerden TetraCysCand1 arıtma.
    1. E. coli hücre topakları parçalayıcı ve TetraCysCand1using glutatyon boncuk ayıklayın. Aşağıdaki adımları adımları 2.3.1–2.3.12 aynıdır.
    2. Protein eluate arabellek C (50 mM Tris-HCl, 1 mM DTT, %5 gliserol, pH 7.5) ile glutatyon boncuk üç folds tarafından gelen sulandırmak. Bir anyon Satım Kromatografi sütun equilibrate ( Tablo malzemelerigörmek) arabellek C ve yük seyreltilmiş protein örneği bir 0.5 mL/dk akış hızı'ile FPLC sistemde.
    3. Protein ile 40 mL NaCl Gradyanda arabellek C ve 1 mL/dk akış hızı % arabellek D (50 mM Tris-HCl, 1 M NaCl, 1 mM DTT, %5 gliserol, pH 7.5) 0-50 karıştırarak elute. SDS-sayfa24kullanarak farklı kesirler eluted protein denetleyin ve TetraCysCand1 içeren kesirleri havuz. TetraCysCand1 ücretsiz GST daha büyük bir saklama hacim olduğuna dikkat edin.
    4. Havuza alınan TetraCysCand1 örnek arabellek Ultrafiltrasyon membran (30 kDa kesme) üzerinden geçerek konsantre.
    5. Boyutu dışlama Kromatografi sütun etiketleme arabelleği (20 mM Tris-HCl, 100 mM NaCl, 2 mM TCEP, 1 mM EDTA, %5 gliserol) ile FPLC sistemde equilibrate. TetraCysCand1 örnek (500 µL her zaman) yük ve eluate kesirler SDS-sayfa24' kontrol edin.
    6. TetraCysCand1 içeren tüm kesirler havuz ve arabelleğin bir Ultrafiltrasyon membran (30 kDa kesme) üzerinden geçerek ~ 40 µM için protein konsantre. Onun Absorbans 280 kullanarak protein konsantrasyonu tahmin nm. Protein 50 µL aliquots-80 ° C'de olarak saklamak
      Not: Protokol burada duraklatılmış.
  4. FlAsHCand1 hazırlanması.
    1. FlAsH çözüm 1 µL ekleyin ( Tablo malzemelerigörmek) 50 µL TetraCysCand1 çözüm için.
    2. İyice karıştırın ve 1-2 h FlAsHCand1 almak için karanlık oda sıcaklığında karisimin kuluçkaya.
      Not: Protokol burada duraklatılmış.

4. Cand1, FRET chase protein hazırlanması

Not: Protein hazırlık protokolü aşağıdaki değişiklikleri ile adım 3'e benzer.

  1. Tam uzunlukta Cand1 kodlama dizisi pGEX-4T-2 vektör yerleştirin.
  2. 30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, % 10 gliserol içeren bir arabellek 3.3.5. adımda kullanılan arabellek değiştirin.
  3. Adım 3.3.7 ve 3.3.8 ortadan kaldırmak.

5. test ve perde tahlil onaylayın

  1. 30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL ovalbumin, pH 7,6, içeren FRET arabellek hazırlamak ve oda sıcaklığında kullanın.
  2. Cul1 arasında perde testAMC•Rbx1 ve FlAsHCand1 üzerinde bir fluorimeter.
    1. İçinde 300 µL FRET arabelleği Cul1 eklemekAMC•Rbx1 (FRET donör) son konsantrasyonu 70 nM. Çözüm bir küvet aktarın.
    2. Küvet yer bir fluorimeter örnek tutucu. 350 nm uyarma ışık ile örnek heyecanlandıracak ve emisyon sinyal--dan 400 tarama 600 nm 1 nm aralıklarla nm'de.
    3. 5.2.1 adımı yineleyin ama değişiklik Cul1AMC•Rbx1 FlAsHCand1 için (FRET alıcısı). Adım 5.2.2 olduğu gibi aynı yöntemi kullanarak FlAsHCand1 örnek inceden inceye gözden geçirmek.
    4. (İsteğe bağlı) 510 nm uyarma ışık ile FlAsHCand1 heyecanlandıracak ve emisyon sinyal 500 üzerinden tarama nm 650 nm.
    5. Her iki Cul1 300 µL FRET arabellekte eklemekAMC•Rbx1 ve FlAsHCand1 son konsantrasyonu 70 nM. Adım 5.2.2 olduğu gibi aynı şekilde örnek analiz.
  3. Cul1 arasında perde onaylamakAMC•Rbx1 ve chase (etiketsiz Cand1) protein (şekil 3 c) ekleyerek FlAsHCand1.
    1. 70 300 µL FRET arabelleği eklemek nM Cul1AMC•Rbx1 ve 700 nM Cand1. Adım 5.2.2 olduğu gibi örnek emisyon inceden inceye gözden geçirmek.
    2. 70 300 µL FRET arabelleği eklemek nM FlAsHCand1 ve 700 nM Cand1. Adım 5.2.2 olduğu gibi örnek emisyon inceden inceye gözden geçirmek.
    3. 70 300 µL FRET arabelleği eklemek nM Cul1AMC•Rbx1 ve 70 nM Cand1, FlAsHve 5 min için oda sıcaklığında örnek kuluçkaya. Sonra ekleyin 700 nM Cand1 ve hemen eklenmesinden sonra adım 5.2.2 olduğu gibi örnek emisyon tarama). Bu adım adım 5.2.5 benzer olduğunu unutmayın.
    4. 300 µL FRET arabellekte sırayla ekleyin 70 nM Cul1AMC•Rbx1, 700 nM Cand1 ve 70 nM FlAsHCand1. Örnek 5 min için oda sıcaklığında kuluçkaya ve adım 5.2.2 olduğu gibi örnek emisyon tarayın. Bu chase örnek ( şekil 3 ciçinde yeşil hat) olduğuna dikkat edin.

6. Cul1•Cand1 (küzerinde) Derneği hızı sabiti ölçmek

Not: durdu-akış fluorimeter faaliyet detayları bir önceki rapor26yılında tarif edilmiştir.

  1. Durdu-akış fluorimeter ölçüm için hazırlayın.
    1. Üreticinin yönerge göre durdu-akış fluorimeter açın.
    2. Işık uyarma 350 nm ve 450 nm emisyon olanak tanıyan bir bant geçiren Filtre geçmesine ışık ve 500-650 nm emisyon ışık engeller kullanım ayarlamak.
    3. Örnek vanalar DOLDURMAK konumda tutmak ve su 3 mL şırınga bağlayın. İki örnek şırınga (A ve B) örnek şırınga sürücü birkaç kez yukarı ve aşağı hareket ettirerek su ile yıkayın. Bu adımda kullanılan su atın.
    4. Örnek vanalar DOLDURMAK konumda tutmak ve perde tampon ile dolu bir 3 mL şırınga bağlayın. İki örnek şırınga FRET arabelleği ile örnek şırınga drive birkaç saat boyunca taşıyarak yıkayın. Bu adımda kullanılan tüm perde tampon atmak.
  2. Bir denetim ölçüm (şekil 4 c) alın.
    1. 3 mL şırınga bağlanmak ve şırınga A 100 nM Cul1AMC•Rbx1 perde tampon yükleyin. Örnek Vana sürücü konumuna dön.
    2. 3 mL şırınga bağlanmak ve şırınga B ile perde tampon yüklemek. Örnek Vana sürücü konumuna dön.
    3. Edinme altında Denetim Masası (şırınga A ve şırınga B örnekleri eşit miktarda karıştırın) beş üzerinde durdu-akış fluorimeter sonuçları kayıt olmadan çekim için yazılımı kullanın.
    4. Edinme altında Denetim Masası yazılımı açın ve programı Cul1 emisyon kayıt içinAMC 60 s. O zaman tek bir atış yap.
    5. 6.2.4 adımı yineleyin 2 x.
    6. Örnek kapak DOLDURMAK pozisyonuna dön. Şırınga B boş ve perde tampon ile yıkayın.
  3. Ölçü Derneği hızı sabitler (kobs) Cul1•Cand1 görülmektedir (şekil 4B).
    1. Örnek A şırıngada tutmak adım 6.2.1 aynıdır.
    2. 3 mL şırınga bağlanmak ve şırınga B 100 ile yük nM FlAsHCand1 perde tampon. Örnek Vana sürücü konumuna dön.
    3. Edinme altında Denetim Masası sonuçları kayıt olmadan beş çekim için yazılımı kullanın.
    4. Edinme altında Denetim Masası yazılımı açın ve programı Cul1 emisyon kayıt içinAMC 60 s. O zaman tek bir atış yap.
    5. 6.3.4 adımı yineleyin 2 x.
    6. Şırınga B boş ve perde tampon ile yıkayın.
    7. Adımları 6.3.1–6.3.6 birkaç kez FlAsHCand1 perde tampon konsantrasyonları artan ile yineleyin.
    8. Değiştir (azalış) floresan sinyallerini tek bir üstel eğriyi kareden, her zaman içinde ölçülen uygun. Bu her ölçüm kobsverecektir ve s-1birimdir. Not Bu hesaplama temeli bir önceki rapor27' de tartışıldı.
  4. Ortalama ve kobsher FlAsHCand1 yoğunlaşması kullanılan standart sapmasını hesaplar. Cand1 konsantrasyonu (şekil 4 d) karşı ortalama kobsarsa ve çizgisinin eğimini küzerinde Cul1•Cand1, M-1 s-1birimi ile temsil eder.

7. ayrılma hızı sabiti (kkapalı) Cul1•Cand1 Skp1•F-box protein huzurunda ölçmek.

Not: Bu adım adım 6 için aşağıdaki değişiklikleri ile benzerdir.

  1. Yük DOLDURMAK konum'un altında şırınga A, içinde 100 nM Cul1AMC•Rbx1 bir çözüm ve 100 nM FlAsHCand1 perde tampon. Örnek Vana "Sürücü" pozisyonuna dön.
  2. Şırınga B DOLDURMAK konumu'nun altında Skp1•Skp2 (bir önceki rapor20hazırlanan) bir çözüm yükleyin. Örnek Vana "Sürücü" pozisyonuna dön.
  3. Edinme altında Denetim Masası yazılımı açın ve programı Cul1 emisyon kayıt içinAMC 30 s. O zaman tek bir atış yap. Floresan sinyallerini şırınga A ve şırınga B (şekil 5) çözümler karıştırma sonra zamanla artırın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

PERDE arasında Cul1 test etmek içinAMC ve FlAsHCand1, biz ilk 70 emisyon yoğunluğu tespit nM Cul1AMC (donör) ve 70 nM FlAsHCand1 (alıcısı), sırasıyla (şekil 3A-C, mavi çizgiler). Sadece bugünü ve FlAsHCand1 emisyon bir emisyon zirve oldu her analizde, (alıcısı) düşük. 70 zaman her Cul1 nM FRET oluşturmak için karışıkAMC ve FlAsHCand1, iki emisyon zirveleri vardı emisyon spectra ve Cul1 en yüksekAMC alt oldu ve daha yüksek (şekil 3A FlAsHCand1 zirvesine oldu -c, kırmızı çizgiler). Tam uzunlukta Cand1 perde için donör en yüksek yoğunluk (şekil 3A, kırmızı hat), % 10 azalma gösterdi kullanıldığında ve Cand1 kesildi onun ilk helix ile kullanıldığında, donör en yüksek yoğunluk azalması (şekil 3B % 30 arttı -D, kırmızı çizgiler), daha yüksek perde verimlilik öne. Sinyal değişiklikleri FRET arasında Cul1 dan sonuçlandı onaylamak içinAMC ve FlAsHCand1, 70 nM Cul1AMC (donör) 700 ile karışık oldu Cand1 etiketsiz nM (kısa) ve 70 nM FlAsHCand1 (alıcısı). Sonuç olarak, donör tepe tamamen restore edildi ve alıcısı tepe düşmüştür (şekil 3 c, yeşil hat), teyit gözlenen FRET Cul1 oluşumu üzerinde bağlıdırAMCFlAsHCand1 karmaşık. Ekleme 700 nM Skp1•Skp2 70 nM Cul1AMCFlAsHCand1 için de tam olarak Cul1•Cand1 kompleksi tamamen Equilibrium'da Skp1•Skp2 tarafından kesilmiş düşündüren donör tepe (3D şekil, yeşil hat), geri.

Figure 3
Şekil 3: temsilcisi FRET tahlil Cul1•Cand1 karmaşık oluşumu için. Örnekleri perde tampon (30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL ovalbumin, pH 7,6) 350 heyecanlı nm ve emisyon 400 taranan nm 650 nm. (A) emisyon spectra 70 nM Cul1AMC, 70 nM Cand1 (tam) FlAsHve ikisinin bir karışımı (FRET). Cand1 tam uzunlukta Cand1 (tam) kısaltmasıdır. (B) emisyon spectra 70 nM Cul1AMC, 70 nM FlAsHCand1 ve ikisinin bir karışımı (FRET). Cand1 silinmiş onun ilk helix ile bu deney ve bundan sonra kullanılmıştır. (C) emisyon spectra 70 nM Cul1AMC, 70 nM FlAsHCand1, ikisinin bir karışımı (FRET) takip kontrolü için FRET (Chase). Chase örnek bulunan 70 nM Cul1AMC, 700 nM Cand1 ve 70 nM FlAsHCand1. (D) emisyon spectra 70 nM Cul1AMC, 70 karışımı nM Cul1AMC ve 70 nM FlAsHCand1 (perde) ve 700 nM Skp1•Skp2 70 nM Cul1AMCFlAsHCand1 kompleksi için eklendi. Her mezarlığına emisyon sinyalleri 70 emisyon için normalleştirilmiş nM Cul1AMC 450 nm. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Donör sinyal azaltılması üzerinde durdu-akış fluorimeter zamanla izleme tarafından kurulan FRET tahlil kullanarak küzerinde Cul1•Cand1, ölçmek için ilk test ve kullanılmak üzere protein konsantrasyonu belirlenir. 5 zaman her Cul1 nMAMC ve FlAsHCand1 kullanıldı, ne zaman her protein konsantrasyonu 50'ye yükseltilmiştir ise çok az sinyal değişiklik (şekil 4A), gözlendi nM, sinyal azaltma zaman içinde ( gözlenen yapıldı. Rakam 4B) ve arabellek olmadan FlAsHCand1 (şekil 4 c) eklediyseniz bu değişiklik kaldırıldı. Bu nedenle, 50 nM Cul1AMC daha fazla analizler için kullanıldı ve gözlenen Derneği hızı sabitler (kobs) bir dizi ölçülen 50 karıştırılarak nM Cul1 FlAsHCand1 konsantrasyonları artanAMC . Her deneme için kobs tek bir üstel eğri noktalarına yaklaştırarak hesaplanır ve aynı FlAsHCand1 konsantrasyon elde edilen kobs ortalama olarak. Küzerinde Cand1 konsantrasyon ile ortalama kobs komplo ve doğrusal regresyon (şekil 4 d) gerçekleştirerek, kararlı7,27yapıldı.

Figure 4
Şekil 4: dernek oranı sabit temsilcisi ölçümü. (A) floresan 5 nM Cul1AMC 5 eklenmesi üzerine zaman içinde durdu-akış fluorimeter tarafından izlenen nM FlAsHCand1. (B) floresan 50 nM Cul1AMC 50 eklenmesi üzerine zaman içinde durdu-akış fluorimeter tarafından izlenen nM FlAsHCand1. (C) floresan 50 nM Cul1AMC FRET arabellek eklenmesi üzerine zaman içinde durdu-akış fluorimeter tarafından izlenir. (D) küzerinde Cul1 için Cand1 bağlamak için. Cand1 farklı konsantrasyonlarda Cul1•Cand1 kobs çizilen. Doğrusal eğim küzerinde 1.8 x 107 M-1 s-1in verir. Hata çubukları ±SEM temsil eder; n = 4. Tüm örneklerini FRET arabellekte hazırlanan ve heyecanlı 350 nm. Bant geçiren Filtre AMC sinyalleri toplayıp sinyalleri flaş hariç için kullanıldı. Hiçbir veri normalleştirilmiş. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Küzerindeölçüm benzer, biz durdu-akış fluorimeter üzerinde zamanla donör sinyal (geri yükle) artış izleyerek Cul1•Cand1 gözlenen ayrılma hızı sabiti ölçülür. Cul1AMC ve FlAsHCand1 ilk karışık ve Skp1•Skp2 preassembled Cul1 sonra eklendiAMCFlAsHCand1 üzerinde durdu-akış fluorimeter. Donör sinyal hızla artan ve bir kobs 0.4 s-1 (şekil 5) ortaya koymuştur. Buna ek olarak, ne zaman arabellek eklendi preassembled Cul1AMCFlAsHCand1, hiçbir sinyal artışı gözlenen, Cul1•Cand1 hızlı ayrılma düşündüren Skp1•Skp2 tarafından tetiklenen.

Figure 5
Şekil 5: ayrılma oranı sabit temsilcisi ölçümü. Donör Floresans karşı saat değişikliği 150 ilavesi ölçüldü nM Skp1•Skp2 veya perde arabellek 50 nM Cul1AMCFlAsHCand1 karmaşık. Sinyal değişiklikleri tek bir üstel eğriyi uydurmak ve gözlenen ayrılma hızı sabiti 0.4 s-1verir. Deneysel koşullar şekil 4' te açıklanan benzer. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

PERDE eğitim ve biyolojik sistemleri19anlamak için büyük ilgi olduğunu fiziksel bir olgudur. Burada, test etme ve iki etkileşen protein bağlayıcı Kinetik çalışmaya FRET kullanma için bir iletişim kuralı mevcut. PERDE tasarımı yaparken, biz üç önemli faktörler olarak kabul: donör emisyon ve alıcısı uyarma, iki fluorophores ve fluorophores28dipol yönünü arasındaki mesafe arasında spektral örtüşme. Fluorophores perde için seçmek için uyarma ve fluorophores emisyon spectra overlaid ve emisyon spektrum bağış önemli ölçüde uyarma ile çakışıyor ise olan emisyon tepeler de ayrılır fluorophores için arama spektrum alıcısı (Şekil 2). Yardım için kristal yapısı kullandık interfluorophore mesafe ve yön en iyi duruma getirmek için ve biz öncelikle protein yapısı ve faaliyet esas olarak daha düşük riski nedeniyle protein termini için fluorophores bağlama kabul. Çünkü Cand1, N-terminus arasındaki mesafe (Cand1Nöral tüp defekti) ve C-terminus, Cul1 (Cul1CTD) C-terminus, Cand1 ve Cul1, N-terminus arasındaki mesafe kısadır (şekil 1), Cand1 etiket kararNöral tüp defekti ve Cul1CTD. Cand1 etiketlemek seçtik çünkü biz % 80-%90 N-terminus tetracysteine etiket25kullanarak bir protein etiketleme verimliliğini ulaşmak mümkün olmuştu,Nöral tüp defekti ile tetracysteine etiketi ile birden parlamak. Başlangıçta Cul1 etiketliCTD AMC üzerinde birkaç avantajları vardır camgöbeği floresan protein (CFP), ile. İlk olarak, o does değil istemek ek etiketleme işlemi ne de onun etiketlenmemiş habercisi etiketli floresan protein arındırmak adımları Yani genetik olarak kodlanmış bir floresan etiketi var. İkinci olarak, CFP AMC parlak ve bu nedenle, daha yüksek tahlil hassasiyet sunar (aşağıdaki konuya bakın). Üçüncü olarak, daha geniş bir spektrum ile birden parlamak, potansiyel olarak daha verimli FRET FlAsH ile verimli üst üste CFP vardır. Bu avantajlara rağmen ancak, CFP çok protein uyum ve arası moleküler etkileşim ile girişime neden olabilir AMC etiketi daha büyük proteindir. Gerçekten de, biz değil gözlemlemek FRET Cul1 arasındaCFP ve FlAsHCand1 yetersiz dipol yönünü veya Cul1-Cand1 etkileşim tarafından CFP tag bozulma nedeniyle büyük olasılıkla bizim test. O zaman Cul1 etiketliCTD AMC ile ve biz perde Cul1 arasında gözlenenAMC ve FlAsHCand1. İlk tam uzunlukta Cand1 kullanarak FRET donör emisyon (şekil 3A) % 10 azalma yol açtı. Biz daha fazla Cand1 ilk helix silerek, Cul1 ve Cand1 arasındaki mesafe 26,8 15,5 Å için Å (şekil 1) ve Cand1 kısaltılır olduğunu bulundu ilk helix eksik % 30 indirim donör emisyon gösterilen çok daha güçlü perde Cul1 ile a vermiştir tepe (şekil 3B). Buna ek olarak, bir fluorophore daha yüksek kuantum verim ile ve bir alıcısı fluorophore daha büyük bir yok olma katsayısı ile bir donör seçim yaparak FRET verimliliği artırabilir.

PERDE nin karakteristik bir özelliği olduğunu zaman FRET oluşur, emisyon verici azalır ve emisyon alıcısı artar (şekil 3B). Ancak, fluorophores onların çevreye duyarlılık görüntüleyebilir ve başka bir protein, FRET29olmadığında da olmadığı durumlarda böylece, emisyon yoğunluğu değişebilir. Biz gözlenen değiştirilen emisyon FRET arasında Cul1 nedeniyle olduğunu doğrulamak içinAMC ve Cand1, FlAsH10 x etiketlenmemiş alıcısı protein (Cand1) aşırı miktarda bir takip eklendi. Chase emisyon verici dönüştürür ve alıcısı geri bu destekleyen normal seviyeye (şekil 3 c), Cul1 değiştirilmiş emisyonlarıAMC ve FlAsHCand1 bağlı protein-protein etkileşim ve bu nedenle, bu sonuç Biz dernek ve Cul1•Cand1 ayrılma raporları bir FRET tahlil kurulan onaylar. Ayrıca, preassembled Cul1 Skp1•Skp2 eklendiAMCFlAsHCand1 kompleksi ve Skp1•Skp2 Cul1-Cand1 etkileşim6bozabilir edebilmek için bilinir. Cul1 arasında perde buldukAMC ve FlAsHCand1 kayboldu (şekil 3D, yeşil hat) ve emisyon spektrum chase örnek (şekil 3 c, yeşil hat), emisyon spektrumu benzer oldu düşündüren Cul1AMCFlAsHCand1 ayrışmış Skp1•Skp2 ve Cul1 tarafındanAMC anormal emisyon Skp1•Skp2 olmadığı durumlarda görüntü yok.

Donör emisyon değişiklik izleme, biz doğrudan Derneği ve Cul1 ayrılma gözlemleyebilirsinizAMCFlAsHCand1 üzerinde durdu-akış fluorimeter. Reaktanları hızla Reaktanları karıştırmak için bir karıştırma odasına enjekte ve karışık Reaktanları bir gözlem odası5taşınır bir kez akışını durdurma tarafından durduruldu-akış sistemi çalışır. Sinyal algılama genellikle karıştırma, hangi sağlar milisaniyelik zaman ölçeğinde ortaya etkileşimleri eğitim sonra 1-2 milisaniye (ms) başlar. Ancak, gözlenen tepki half-life Reaktanları belirli bir aygıt üzerinde karıştırmak için gereken süreyi daha kısa olduğunda, bu yaklaşım yeterince duyarlı değildir ve artık uygun30' dur. Durdu-akış analizleri 10-6–106 s-1 birinci dereceden reaksiyonlar için ve 1 – 109 M-1 s-1 ikinci dereceden reaksiyonlar5arasında değişen hızı sabitler belirlemek için kullanılmıştır. Güvenilir ölçüm Kinetik parametrelerin durdu-akış fluorimeter kullanarak elde etmek için floresan sinyal başlangıç ve denge noktaları arasında önemli bir değişiklik gereklidir. Biz FlAsHCand1 kullanılan Cul1 ile daha iyi FRET verimleri çünkü ilk helix alıcısı olarak eksikAMCve ölçüm için kullanılmak üzere protein konsantrasyonu test. 5 zaman her Cul1 nMAMC ve FlAsHCand1, karışık Cul1 bir değişiklik yokAMC sinyal görülmektedir (şekil 4A), bu konsantrasyon düşündüren ölçüm için yetersiz. Ne zaman protein konsantrasyonları 50'ye artan nM, Cul1 azalmaAMC sinyal zaman içinde belirgin (şekil 4B) oldu ve bu değişiklik (şekil 4 c) alıcısı protein olduğunu oluşmaz. Bu sonuca göre biz Cul1 kullanılan küzerinde Cul1•Cand1 için ölçmek 50 nM concertation,AMC . Farklı fluorophores kullanıldığında ölçüm için kullanılan donör protein konsantrasyonu değişebilir. Örneğin, ne zaman Cul1 etiketli CFP, 5 nM CFPCul1 küzerinde6ölçüm için yeterli. Bu nedenle, en iyi protein konsantrasyonu her perde çifti için test edilmelidir ve prensip olarak, parlak fluorophores daha düşük protein konsantrasyonları kullanılmasına izin ve daha iyi sinyal-gürültü oranı31sağlamak.

Protein-protein etkileşimler tarafından FRET çalışmaya, bu faaliyetle, potansiyel olarak FRET kısıtlar ve protein yapısını bozmadan fluorophores proteinler uygun pozisyonlarda bağlama gerektirir. Bu iletişim kuralı, N-terminus özellikle FlAsH boya bağlar tetracysteine etiketini kullanarak Cand1, etiketli ve yalnızca hedef protein32bağlar sonra FlAsH boya floresan olur. Cul1 etiketli Cul121,22C-terminus adlı bir fluorophore sortase etiketi taşıyan kısa bir peptid verdiği sortase-aracılı transpeptidation kullanarak. Etiketleme verimliliği > %80 tetracysteine etiketiyle ve neredeyse %100 sortase O'nun6 etiketiyle Ni-NTA boncuk (adımları 2.4.3–2.4.4) kullanarak unreacted protein çıkardıktan sonra olduğunu. Her iki yöntem birkaç amino asitler protein yapısı için en az değişiklik tanıtan hedef protein ekleyin. Transglutaminase tanıma dizisi (Q-etiket)33 ve34ybbR etiketi, gibi benzer yaklaşımlar hedef protein siteye özgü bir şekilde etiketlemek için de kullanılabilir. Buna ek olarak, floresan boyalar photostability da FRET kullanımını sınırlayabilirsiniz. Yineleyici ya da uzun ışığa maruz kalma uyarma hatalı miktar sonuçları35kaynaklanan fluorophore, photobleaching yol açabilir. Bu nedenle, donör ve alıcısı proteinler hazırlık ve depolama adımları sırasında ışıktan korunmalıdır. Ve perde ölçmek için kullanırken sürekli donör emisyon donör emisyon kısa okuma, zaman içinde değişiklik izleme yerine, yavaş yavaş oluşan olaylar daha uzun zaman aralıklarında alınması gereken örnek karanlıkta sırasında tüm tutulmalıdır deney6.

Çünkü FRET hassas ve nicel oluştururlar arasındaki etkileşimi eğitimi için önemli bir araç haline gelmiştir. Bu iletişim kuralı bir protein çözümde karmaşık dinamiklerini incelemek için FRET kullanarak bir örnek sunar. PERDE de kullanılan canlı hücre ile birlikte yaşayan moleküler etkileşimleri çalışmaya Imaging36, protein kompleksleri fizyolojik koşullar altında dinamiklerini ortaya güçlü olduğu hücreleri. Ayrıca, perde de tek molekül düzeyinde kompleks konformasyonal değişim anlayışlar sağlayan makromoleküllerin kompleksleri37,38, gerçek zamanlı dinamiklerini incelemek için kullanılabilir. FRET tespiti ve verimliliği artırmak için parlaklık fluorophores ve biyosensörler ile gelişmiş ve photostability aktif olarak tasarlanmıştır ve28,39okudu büyük ilgi vardır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Shu-Ou Shan (Kaliforniya Teknoloji Enstitüsü) perde tahlil gelişimi üzerinde anlayışlı tartışma için teşekkür ediyoruz. M.G., Y.Z. ve X.L. Y.Z. Purdue Üniversitesi'nden başlangıç fonlar tarafından finanse edilmiştir ve X.L.This iş kısmen bitki Biyoloji için Purdue Üniversitesi Merkezi bir tohum hibe tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics