인간으로 Epigenome 편집 도구의 효율적인 배달 lentiviral 벡터 플랫폼 유도 만능 줄기 세포 유래 질병 모델

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

타겟 DNA epigenome 나타냅니다 편집 강력한 치료 접근. 이 프로토콜에 설명 합니다 생산, 정화, 그리고 모든-에-하나의 lentiviral 벡터 인간 유도 만능 줄기 세포 (hiPSC)에서 epigenome 편집 응용 프로그램에 대 한 CRISPR-dCas9-DNMT3A transgene 은닉의 농도-신경 파생.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

HiPSC에서 파생 된 세포를 사용 하 여 인간의 신경 퇴행 성 질환을 연구 하는 귀중 한 접근 방식을 나타냅니다. 여기, 우리는 환자와 파 킨 슨 병 (PD)으로 알파 synuclein 유전자 (SNCA) 로커 스의 triplication에서에서 파생 된 hiPSCs의 분화에 대 한 최적화 된 프로토콜을 설명-관련 dopaminergic 신경 인구. 증거를 축적으로 나타났습니다 SNCA 의 상부는 충족 SNCA 표현의 규제 대상으로 하는 특히 그 PD를 위한 소설 치료 접근을 설치할 필요가 PD. Recognizing의 개발에 대 한 원인이 되는 우리 최근 epigenetically SNCA intron 1 규제 지역에서 메 틸 화 수준의 풍요로운 여 SNCA 전사를 조절 하는 CRISPR/dCas9-DNA 메 틸 화-기반 시스템 개발. 죽은의 구성 된 시스템을 제공 (비활성화) 버전 Cas9의 DNA methyltransferase 효소 3A의 촉매 도메인 (dCas9) 융합 (DNMT3A), lentiviral 벡터 사용 됩니다. 이 시스템 SNCA 로커 스의 triplication와 셀에 적용 되 고 SNCAmRNA와 단백질 수준 SNCA intron 1의 타겟된 DNA 메 틸 화를 통해 약 30% 감소 시킨다. SNCA 레벨의 미세 downregulation 질환 관련 세포 고기를 구출 하 고 현재 프로토콜에서 우리 hiPSCs 신경 조상 세포 (Npc)와 설립 SNCA 에서 메 틸 프로필의 평가 대 한 pyrosequencing 분석 실험의 유효성 검사로 차별화에 대 한 단계별 절차를 설명 하고자 intron 1. 좀 더 자세하게에서이 실험에서 사용 된 lentivirus-CRISPR/dCas9 시스템 개요,이 프로토콜에 설명 합니다 생산, 정화, lentiviral 벡터를 집중 하 고 epigenome 게놈 편집 응용 프로그램을 사용 하 여 그들의 적합성을 강조 하는 방법을 hiPSCs 및 Npc입니다. 프로토콜은 쉽게 적응 그리고 생체 외에서 그리고 vivo에서 응용 프로그램에 대 한 높은 titer lentiviruses를 생산 하는데 사용 될 수 있습니다.

Introduction

여러 epigenome 편집 플랫폼 최근 유전자 식1,2를 제어 하는 지역에서 어떤 DNA 시퀀스를 대상으로 개발 되었습니다. 만든된 epigenome 편집 도구는 (i) 전사 조절, (ii) 변경 posttranslational 히스톤 수정, (iii) 수정 DNA 메 틸 화, (iv) 규제 요소 상호 작용을 조절 하는 설계 되었습니다. 비활성화 (죽은) Cas9에 전사/chromatin 한정자를 접근 (dCas9) 발생 이전에서 아연 등 개발된 epigenome 편집 플랫폼, 단백질 (ZFPs) 및 녹음 방송 활성 제 같은 이펙터 (이야기), 손가락 은닉 강력한 transcriptional 이펙터 도메인 (ED) 디자인 DNA 바인딩 도메인 (DBD)3융합. 활성화 또는 억제 등 원하는 표현 형의 결과 생 loci (그림 1)에 고정 효과 기 분자에 의해 정의 됩니다. 프로그래밍 가능한 transcriptional 활성 제를 만들려면 dCas9/gRNA 모듈은 VP164,,56 (그림 1A), 폴 II 및 일반 전사 기계 신병 바이러스 활성화 도메인에 연결 됩니다. 이 시스템의 수정 VP64, VP16 도메인의 tetramer 제공 하는 더욱 강력한 활성화 속도5,6을 포함 했다. 시스템은 발기인 및 규정 요소를 대상으로 코딩 noncoding 지역 활성화를 성공적으로 고용 되었다. 중요 한 것은, VP64 분자 대상 지역에 염색 질 구조를 직접 수정 하지 않습니다, 비록 그것은 chromatin 한정자 액티브 (euchromatin) 마크, H3/H4 acetylation와 H3-K4 디 등의 증 착에 결과 묶는 신병 / 트라이-메 틸 화5,6. VP64, 뿐만 아니라 인간의 NF κB 복잡 한 p65 소 단위 dCas9/gRNA 모듈7에 닿는 되었습니다. 흥미롭게도, 상류 녹음 방송 시작 위치 (TSSs)과 발기인 내의 지역에 이러한 이펙터의 tethering 강한 유전자 유도 결과. 그럼에도 불구 하 고, VP64 및 p65 이펙터 있으며 하류 TSSs의 원심 강화7,8시 지역에 연결 되는 동안 activatory 효과 발휘 또한 수 있습니다. 더 강력한 transcriptional 응답을 유도, 여러 dCas9 VP64 또는 dCas9-p65 융해 단일 대상 로커 스9,10에 채용 될 필요가 있다. 따라서, 다음-세대 활성 제, 노, 등 단일 dCas9 gRNA 복잡 한에 의해 여러 이펙터 도메인 모집의 최근 개발 귀착되는 강한 활성화 기능 비교 dCas9 VP64 융합 대응11 , 12. 향상 된 transcriptional 활성화 VP64, p65, 및 Rta (VPR), 감마-herpesviruses에서 dCas913 (그림 1A)의 C-말단의 transactivation 도메인의 융합을 통해 얻은 되었습니다. 유사한 CRISPR/dCas9 시스템 대상별 억압 (그림 1B)에 대 한 개발 되었습니다.

내 생 유전자 억압 메커니즘 (그림 1B)의 다양 한 설계 진압 융해와 함께 얻을 수 있습니다. CRISPR/dCas9 시스템, (effector 도메인/s), 없이 진압 DBD에 연결 된 유전자 발현 발기인 또는 업스트림/다운스트림-TSS 지역3,6 에 곁에 하는 동안 침묵 효율적으로 수 있습니다 입증 되었습니다. 14. 녹음 방송에 영향 전사 인자 바인딩 및 RNA 중 합 효소 처리의 입체 장애에 의해 발생 합니다. 그럼에도 불구 하 고, 보다 포괄적인 접근 필요, 입체 방해 혼자 여 진 억압은 종종 강력한 입을 위한 충분 합니다. CRISPR/dCas9 시스템 transcriptional 진압 도메인 (TRDs), 히스톤 한정자를 기반으로 하는 달 았 죠의 다음 세대의 최근 개발 (H3-K9 디-/ 트라이-메 틸 화, H3 K27 디-/ 트라이-메 틸 화; H3-K36 디-/ 트라이-메 틸 화, H3/H4 deacetylation), 그리고 DNA (CpG) 메 틸 보다 강력한 효과4,5,,1516, 입을 수 있도록 하는 후 성적인 도구 건설에 17,18,,1920. 그것은 DNA에 이러한 epigenetic 한정자의 모집 일반적으로는 더 강력한 입을 결과21,22를 생성 하는 더 많은 폐쇄 하 고 압축 된 chromatin의 형성으로 이어질 수 있습니다 입증 되었습니다. DBDs와 함께 사용 하는 가장 일반적으로 입을 도메인 Krüppel 관련 상자 (리아)4,5입니다. 요인의 모집 chromatin 변경; 해당 입증 되었습니다. 그럼에도 불구 하 고, 이러한 개조의 메커니즘은 아직 해명된16,,1718수 있습니다. 최근에, 그것은 보였다 DNA에 리아의 지역화가 이러한 상호 작용 중재의 형성 가능성을 제안 하는 히스톤 methyltransferase SETDB1 및 히스톤 deacetylation (HDAC) NuRD 단지의 어셈블리를 홍보할 수 있습니다. chromatin 응축 그리고 transcriptional 입을3,13. 다른 접근 방법으로 이펙터 도메인 사용자 지정 후 입을 단백질을 만드는 DBDs에 융합 수 있습니다. 이 시스템은 직접 억압 적인 DNA 부호 또는 히스톤 수정 catalyzes.

최근, 곁에 DNMT3A 효소 합성 CRISPR/dCas9 시스템의 사용 transcriptional 비활성화 용도가 변경 했습니다. DNMT3A catalyzes DNA 메 틸 화 내 생 유전자 발기인 및 다른 규제 영역 (그림 1B)18,20에 섬으로의 형성을 통해 transcriptional 억제 한다. 맥도날드 외.18 Vojta 외20 했다 보고 epigenome 유전자 침묵 또는 억압, 플라스 미드 배달 dCas9-DNMT3A 퓨전 시스템 향상 potently 수 보여주는 DNA 메 틸 화를 사용할 수 있는 첫 번째 저자 TSS18,20주위 시 토 신 메 틸 화. 맥도날드와 동료 증명 고용 전략의 중요 한 감소 (약 40%)에서 발생할 수 있습니다. 종양 억제기 유전자에서 CDKN2A mRNA 레벨18. 마찬가지로, 바흐 또는 IL6ST 유전자의 unmethylated 발기인 지역 타겟팅 증가 CpG 메 틸을 유전자 식20두 감소와 상관 관계를 보여줍니다. 우리 연구소는 최근 약하게 SNCA overexpression (그림 2)23의 병 적인 결과 대 한 DNA 메 틸 화를 사용 하 여 다른 용도로. SNCA intron 1 지역 내에서 DNA 메 틸 화에 선택적 향상 전략 기반으로 그것은 이전 PD와 치 매 Lewy 몸 (DLB) 두뇌24,25, hypomethylated 이기 위하여 보고 되었다 26. 이 hypomethylation SNCA overexpression, 따라서 제공 하는 치료 적 개입24,,2728에 대 한 매력적인 대상에 연결 되었습니다. 우리가 최근에 보여주었다 DNA 메 틸 화의 저수준 SNCA intron 1에서에서 hiPSC 파생 dopaminergic NPCs에 지역 SNCA triplication23PD 환자에서 얻은. 이 실험적인 모델의 장점은 NPCs 튼튼하게 문화에서 전파 하 또는 더 성숙한 뉴런으로 분화 세포 고기, 산화 등을 중재 하는 유전 요인 식별 하는 효율적인 심사를 사용 수 있다 스트레스와 apoptosis29. 또한,이 모델 시스템 환자에서 증상 발병 전에 발생 하는 개발 이벤트를 정리 하는 과학자를 수 있습니다. 또한, hiPSC에서 파생 된 NPCs 유전자 발현과 관련 된 세포 및 분자 경로 테스트 하는 훌륭한 도구를 나타냅니다. 중요 한 것은, 최신의 CRISPR/Cas9-epigenome 기술과 결합 하는 hiPSC 파생 NPCs 많은 신경 퇴행 성 질환에 대 한 "다음-세대 약물" 개발 용이 하 게 크게 수 있습니다.

SNCA 식의 병 적인 수준을 줄이기 위해, 우리는 최근 dCas9 DNMT3A 융해 단백질과 특별히 대상 CpG 메 틸 화 SNCA intron 1 (그림 2A) 내에 gRNA lentivirus 기반 시스템을 개발23. 이 프로토콜은 lentiviral 벡터 (LV) 설계 및 생산 세부 사항에 설명 합니다. LVs 나타내는 여러 가지 이유로 CRISPR/dCas9 구성 요소를 제공 하는 효과적인 수단, 즉 (i) 자신의 능력을 부피가 큰 DNA를 수행 삽입, (ii)30 셀을 나누어 및 nondividing를 포함 하 여 셀의 광범위 한 범위를 시험의 고효율 , 그리고 (iii) 최소한의 세포 독성 및 면역성 응답을 유도 하는 능력. 최근, 우리 SNCA 로커 스의 triplication 가진 환자에서 hiPSC 파생 dopaminergic 신경에 LV 시스템을 적용 하 고 epigenome 편집의 배달에 대 한 정 맥 주사의 치료 잠재력을 시연 메 틸 화23 ( 도구 그림 2B). 실제로, LV-gRNA/dCas9-DNMT3A 시스템 SNCA intron 1 지역에서 DNA 메 틸 화에 상당한 증가 발생합니다. 이 증가 SNCA mRNA와 단백질23의 수준에 있는 감소와 일치합니다. 또한, SNCA downregulation PD 관련 고기 SNCA triplication/hiPSC-파생 dopaminergic 신경 (예, 미토 콘 드 리아 선생님 생산 및 세포 생존)23에 구출. 중요 한 것은, 우리 SNCA 식 LV-gRNA-dCas9-DMNT3A 시스템에서에서 감소는 고기는 누가 실시는 PD 환자에서 hiPSC 파생 dopaminergic 신경에 대 한 특성이 있다 반전의 능력을 증명 SNCA triplication, 미토 콘 드 리아 선생님 생산 및 세포 생존23등. 이 프로토콜의 목표 이며 1) 생산의 프로토콜와 높은 tittered 바이러스 준비를 생성 하기 위한 최적화 된 LV 플랫폼의 농도 2) 성숙한 dopaminergic 될 꽃무늬 NPCs에 hiPSCs의 차별화를 설명 하기 위해 신경31,32 그리고 SNCA intron 1에서 대상 영역의 메 틸 화 수준의 특성화.

Lentiviral 플랫폼 주요 이점을 가장 인기 있는 벡터 플랫폼, 즉 adeno 관련 벡터 (AAVs), 큰 유전자 삽입33,34에 맞게 전 능력은 있다. AAVs 상당히 높은 수익률에 생성 될 수 있습니다 하지만 낮은 포장 용량을 보유 (< 4.8 kb), 모든-에-하나의 CRISPR/Cas9 시스템을 제공 하기 위한 그들의 사용을 타협. 따라서, 그것은 정 맥 주사의 플랫폼 제공된 CRISPR/dCas9 도구를 응용 프로그램에서 선택 될 것 이라고 보인다. 따라서, 여기에 설명 된 프로토콜 효과적으로 세포와 장기에 epigenome 편집 구성 요소를 제공 하는 연구를 위한 유용한 도구가 됩니다. 프로토콜 추가 벡터 식 카세트30,35내 요소의 cis에 수정 통해 벡터의 생산 및 표현 기능을 증가 하기 위하여 전략을 설명 합니다. 전략을 기반으로 소설에 시스템 개발 및 연구소에서 공부 하 고 1010 바이러스 성 단위 (VU) /mL30,35의 범위에서 바이러스 성 입자를 생산 하는 능력을 강조.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 시스템 설계 및 바이러스 생산

  1. 플라스 미드 설계 및 건설
    참고: 모든-에-하나의 LV-gRNA-dCas9-DNMT3A 벡터의 건축 생산을 사용 하 여 수행 됩니다-및 Ortinski 외30여 출판 식 최적화 식 카세트. 벡터 카세트 녹음 방송 요인 s p 1와-의 상태--예술 삭제는 번역에서 인식 사이트의 반복 수행 (U3')는 터미널 3'-긴 반복 (LTR) (그림 2A)30,36의 지역. 벡터 백본 제공 하 고 CRISPR/Cas930,35표현에 효과적인 것으로 발견 되었습니다.
    1. SpCas9의 비활성화 (죽은) 버전 (dCas9) 사이트 감독 mutagenesis (데이터 표시 되지 않음)를 통해. PBK30129 AgeI BamHI 조각 (그림 3) 사이 교환에 활성 Cas9와 각각, 효소의 촉매 도메인 트 및 RuvC에서 D10A 및 H840A 돌연변이 은닉 하는 복제를 교체 합니다.
    2. PdCas9-DNMT3A-eGFP에서 파생 하는 DNMT3A 촉매 도메인 ( 재료의 표참조)는 DNMT3A 증폭 시켜 BamHI-429/R 5 '-GAGCGGATCCCCCTCCCG-3' BamHI-429/L 5'-CTCTCCACTGCCGGATCCGG-부분 3' (그림 3). DNMT3A를 포함 하는 영역을 증폭 하려면 다음 조건: 60 (1) 95 ° C s, 10 (2) 95 ° C s, 20 (3) 60 ° C s, 60 미 반복 조건 2 ~ 4 30 x (4) 68 ° C. 마지막 확장에 대 한 68 ° C를 사용 하 여 3 분 동안 누르고 4 ° c.
    3. 복제 dCas9를 들고 수정된 pBK301 벡터의 BamHI 사이트로 BamHI 제한 효소에 의해 소화 DNMT3A 조각. 직접 생어에 의해 복제 확인 연속. 참고 결과 플라스 미드 dCas9 DNMT3A p2a puromycin transgene 항구. 플라스 미드는 인간 U6 발기인 (그림 3)에서 gRNA 비 계를 표현합니다.
    4. 녹색 형광 단백질 (GFP)를 만드는 dCas9 DNMT3A p2a GFP에 puromycin 취재 원 유전자를 바꿉니다. FseI와 dCas9에 DNMT3A p2a 순수 하지 않아 플라스 미드를 소화. 젤 정화 방법을 사용 하 여 벡터 조각 정화. PBK201a 소화 하 여 삽입을 준비 (pLenti-GFP) FseI와 함께. FseI 조각 벡터에 클론. 결과 플라스 미드 pBK539 항만 dCas9 DNMT3A p2a GFP transgene (그림 3).
  2. HEK 293T 세포 배양과 transfection에 대 한 셀을 도금
    참고: 인간 미 발달 신장 293T (HEK 293T) 셀 교양 완전 한 높은 포도 당 Dulbecco의이 글의 중간으로 수정 (DMEM; 10% 소 송아지 혈 청, 1 x 항생제 antimycotic, 1 x 나트륨 pyruvate, 1 x 불필요 한 아미노산, 2 mM L-글루타민) 5 %37 ° C에서 CO 2. 프로토콜의 재현성에 대 한 것이 좋습니다 다른 많은/일괄 전환 시 송아지 혈 청 테스트. 6 15 cm까지 접시 lentiviral 생산을 위해 필요 합니다.
    1. 낮은 통로 세포를 사용 하 여 새로운 문화 (통로 20 보다 낮은) 시작. 일단 셀 도달 90%-95% 합류, 미디어를 발음 하 고 부드럽게에 그것을 세척 살 균 1 인산 염 버퍼 식 염 수 (PBS) x.
    2. 트립 신-EDTA (0.05%)의 2 개 mL를 추가 그리고 3-5 분 동안 37 ° C에서 품 어. 분리 시 비활성화, 완전 한 높은 포도 당 DMEM 그리고 10 mL 혈 청 학적인 피 펫 피 펫 10 x-15 x 4 x 106 셀/mL의 단일 세포 현 탁 액을 만들의 8 mL를 추가 합니다.
    3. Transfections, 15 cm 접시 0.2% 젤라틴 코트. 높은 포도 당 매체의 22.5 mL을 추가 하 고 셀의 셀 서 스 펜 션 (총 ~ 1 x 107 셀/접시) 2.5 mL을 추가 하 여 씨앗. 70%-80%의 합류를 도달할 때까지 5% CO2 와 37 ° C에서 접시를 품 어.
  3. HEK 293T 세포의 transfection
    1. BES 버퍼 솔루션 게시판 x 2와 1 M CaCl2, Vijayraghavan 및 칸 토35에 따라 준비 합니다. 0.22 μ m 필터를 통해 전달 하 여 솔루션을 필터링 및 4 ° c.에서 그들을 저장합니다 Transfection 혼합 셀에 그것의 추가 하기 전에 명확 하 게 있다. 혼합 되 면 흐린 인큐베이션 기간 동안, 준비 신선한 2 x BBS (pH = 6.95).
    2. 나열 된 4 개의 플라스 미드 사용 플라스 미드 믹스를 준비 하려면 (다음 혼합은 충분 한 15cm 접시): CRISPR/dCas9-전송 벡터의 37.5 µ g (pBK492 [DNMT3A-순수 하지 않아-노-gRNA] 또는 pBK539 [DNMT3A-GFP-노-gRNA]); pBK240의 25 µ g (psPAX2); pMD2.G;의 12.5 µ g pRSV-레 브 (그림 4A)의 6.25 µ g. 농도에 따라 하는 플라스 미드의 볼륨을 계산 하 고 15 mL 원뿔 튜브로 필요한 수량을 추가. 1 M CaCl2 312.5 µ L을 추가 1.25 mL를 최종 볼륨을가지고, vortexing 믹스 2 x BBS 솔루션의 1.25 mL를 추가 살 균 dd-H2o. 부드럽게를 사용 하 여. 실 온에서 30 분 동안 품 어. 일단 그들은 70%-80% 합칠 셀 transfection 준비 되어 있다.
    3. 미디어를 발음 하 고 혈 청 하지 않고 갓된 높은 포도 당 DMEM의 22.5 mL와 함께 그것을 대체. 각 15 cm 접시에 dropwise transfection 혼합물의 2.5 mL를 추가 합니다. 접시를 소용돌이 5% CO2 2-3 h 37 ° C에서 품 어.
    4. 3 h 후 추가 2.5 mL (10%) 접시 당 혈 청의 5% CO2와 37 ° C에서 밤새 품 어 고.
    5. Transfection는 후 1 일에는 되도록 세포 관찰 없이 또는 최소한의 세포 죽음과 셀 confluent 문화 (100%)을 형성.
      1. 각 접시에 갓된 높은 포도 당 DMEM과 10% 혈 청의 25 mL를 추가 하 여 미디어를 변경 합니다.
    6. 48 h에 대 한 5% CO2 와 37 ° C에서 품 어.
  4. 바이러스의 수확
    1. 상쾌한 모든 transfected 세포에서 수집 하 고 50 mL 원뿔 튜브에 그들을 풀. 10 분에 대 한 400-450 x g 에서 원심 분리기 필터 0.45 μ m 진공 필터 장치 통해 상쾌한. 여과 후에 상쾌한 단기 저장용 (4 일) 4 ° C에서 보관할 수 있습니다. 장기 저장을 위한 aliquots를 준비 하 고-80 ° c.에서 그들을 저장합니다
      참고: Nonconcentrated 바이러스 준비 2 ~ 10 배 될 것으로 예상 된다7 3 x 107 부/mL (1.5 titer 결정에 대 한 섹션 참조). 이후 여러 freeze-thaw 주기 기능 titers에 10%-20% 손실 귀 착될 것 이다 단일 사용 aliquots, 준비 매우 것이 좋습니다.
  5. 바이러스 성 입자의 농도
    참고: 고 정화에 대 한 자당 그라데이션 단계와 자당 쿠션 단계는 관련 된 두 단계 더블 자당 메서드 (그림 4B) 수행.
    1. 자당 기온 변화도 만들려면 다음 순서로 원뿔 ultracentrifugation 튜브 준비: 1 x PBS, DMEM, DMEM에 30% 자당의 1 mL 및 1 x PBS에 20% 자당의 2 mL에 60% 자당의 0.5 mL에에서 70% 자당의 0.5 mL.
    2. 신중 하 게, 상쾌한, 섹션 1.4에 따라 수집 된 그라데이션 추가. 4 15 cm 접시에서 수집한 총 볼륨 100 mL 이므로, 6 ultracentrifugation 튜브를 사용 하 여 바이러스 상쾌한 처리.
    3. 동등 하 게 각 ultracentrifugation 튜브 중 바이러스 상쾌한을 배포 합니다. 원심 분리 동안 튜브 파손을 피하기 위해, 적어도 3-4 그들의 총 볼륨 용량을 ultracentrifugation 관을 채우십시오. 1 x PBS 가진 튜브를 균형. 원심에서 70000 x g 2 h 17 ° c.에 대 한 샘플
      참고: 가속 및 감속 단계 동안 자당 레이어를 유지 하려면 천천히가 속하고 감속 회전자 0에서 200 g x와 0xg200에서은 스핀의 처음과 마지막 3 분 동안 각각 ultracentrifuge을 허용 합니다.
    4. 부드럽게 깨끗 한 튜브 (그림 4B) 30%-60% 자당 분수를 수집 합니다. 총 볼륨의 100 ml PBS (감기) 최대 x 1을 추가 합니다. 여러 번 pipetting으로 혼합.
    5. (1 x PBS)에서 20% 자당의 4 mL 튜브에 추가 하 여 자당 쿠션에 바이러스 준비를 신중 하 게, 충. 계속 pipetting ~ 20-25 mL의 각 관 당 바이러스 솔루션. 채워 튜브 1 x PBS 그들의 내용의 볼륨은 튜브 당 3-4 보다 작은 경우. 신중 하 게 튜브를 균형. 2 h 17 ° c.에 대 한 70000 x g 에서 원심 분리기 상쾌한을 나머지 수 있도록 종이 타 올에 튜브를 반전 액체 드레인.
    6. 남은 액체를 신중 하 게 발음 하 여 모든 액체를 제거 합니다. 이 단계에서 유의 알 약은 바이러스를 포함 하는 작은 반투명 반점으로 겨우 볼 수 있습니다. Resuspend 펠 릿을 첫 번째 튜브에 1 x PBS의 70 µ L를 추가 합니다. 완전히 플라스틱 정지 하 고 모든 펠 릿 resuspended 때까지 다음 튜브에 그것을 전송.
    7. PBS와 전에 믹스 x 1의 추가 50 µ L 튜브 세척. 참고는,이 단계에서 마지막 정지의 볼륨 ~ 120 µ L 이며 약간 밀키 나타납니다. 분명 서 스 펜 션을 얻기 위해 10000 x g에서 60 s 원심 분리 진행. 새로운 튜브에는 상쾌한 전송 5 µ L aliquots, 고-80 ° c.에서 그들을 저장합니다
      참고: Lentiviral 벡터 준비 중지 및 재개의 반복된 사이클에 민감합니다. 또한, 그것은 나머지 단계 조직 문화 봉쇄에는 또는 지정 biosafety 표준 (그림 4B)의 적절 한 수준에서 되는 측면에서 한정 된 지역에 좋습니다.
  6. 바이러스 titers의 정량화
    참고: 바이러스 titers 추정 (p24개 그 일 라) p24 효소 연결 된 immunosorbent 분석 결과 (ELISA) 메서드를 사용 하 여 수행 됩니다 및 국립 보건원 (NIH) 에이즈 백신 프로그램에는 HIV 1 p24 항 원 캡처 분석 결과 대 한 프로토콜 약간의 수정입니다.
    1. 0.05% 트윈 20 감기 1 x PBS (PBS-T)의 200 µ L 96 잘 접시 3의 우물을 세척을 사용 하 여 x.
    2. 플레이트 코트, 1 x PBS에 1:1,500에서 희석 하는 단일 클로 널 안티-p24 항 체의 100 µ L를 사용 합니다. 4 ° c.에 하룻밤 접시를 품 어
    3. 차단 시 (1% 소 혈 청 알 부 민 [BSA] 1 x PBS에) 약을 준비 하 고 200 µ L을 각 영역을 피하기 위해 일반적인 바인딩 추가. PBS-T의 200 µ L를 사용 하 여 실 온에서 1 시간 이상에 대 한 잘 3 배를 씻어.
    4. 샘플 준비와 진행. 집중된 벡터 준비를 사용할 경우, 사용 하 여 샘플의 1 µ L dd-H20, 89 µ L의 트라이 톤 X-100 10 µ L (10%의 최종 농도)에서 1: 100에 벡터를 희석. Nonconcentrated 준비에 대 한 1시 10분에서 샘플을 희석.
    5. 에이즈-1 표준 이중 직렬 희석 (시작 농도 5 ng/mL)을 사용 하 여 얻을.
    6. 희석 RPMI 1640를 1:10, 000, 0.2% 트윈 20, 1 %BSA 보완에 집중된 샘플 (1.6.4 단계에서 준비) 1:50, 000, 그리고 1:250,000 희석. 마찬가지로, 희석 RPMI 1640 설정 1: 500, 1:2, 0.2% 트윈 20, 1 %BSA 보완에 nonconcentrated 샘플 (준비 단계 1.6.4) 500, 및 1:12,500 희석.
    7. 샘플 및 표준 triplicates에 접시에 추가 합니다. 4 ° c.에서 밤새 품 어
    8. 다음 날 씻어 웰 스 6 x.
    9. Polyclonal 토끼 안티 p24 항 체, RPMI 1640, 10% 태아 둔감 한 혈 청 (FBS), 0.25 %BSA, 및 2% 정상 마우스의 혈 청 (NMS), 1:1,000에서 희석의 100 µ L을 추가 하 고 37 ° C 4 h에서 품 어.
    10. 씻어 웰 스 6 x. 염소 안티 토끼 양 고추냉이 과산화 효소 5% 정상 염소 혈 청, 2 %NMS, 0.25 %BSA 및 0.01% 보충 RPMI 1640 년에 1:10,000에서 희석 하는 IgG 추가 트윈 20. 1 시간 동안 37 ° C에서 품 어.
    11. 씻어 웰 스 6 x. TMB 과산화 효소 기질을 추가 하 고 15 분 동안 실 온에서 품 어.
    12. 반응을 중지, 1 N HCl의 100 µ L를 추가 합니다. Microplate 리더에서 450에서 흡 광도 측정 nm.
  7. 기자는 형광 강도 측정
    1. 1 x PBS에 (10-510-1 )에서 10 직렬 희석을 바이러스 성 현 탁 액을 사용 합니다.
    2. 6 잘 플레이트의 각 우물에서 5 x 105 HEK 293T 세포 격판덮개. 각 바이러스 희석의 10 µ L 셀에 적용 하 고 5% CO2 48 h에 대 한 37 ° C에서 품 어.
    3. (FACS) 분석을 다음과 같이 정렬 형광 활성화 된 세포를: 0.05% 트립 신-EDTA 용액의 200 µ L을 추가 하 여 세포를 분리. 5 분 동안 37 ° C에 세포를 품 어 고 (혈 청)과 DMEM 매체의 2 mL에 그들을 resuspend. 15 mL 원뿔 튜브와 4 ° c.에 400 x g 에서 원심 분리기 샘플 수집 감기 1 x PBS의 500 µ L에 펠 릿을 resuspend.
    4. 4 %paraformaldehyde (PFA)의 500 µ L을 추가 하 여 셀을 수정 하 고 실 온에서 10 분 동안 품 어.
    5. 4 ° C에 400 x g 에서 centrifuge 고 1 x PBS의 1 mL에 펠 릿을 resuspend. GFP 식 Ortinski 외.30에 설명 된 대로 FACS 악기를 사용 하 여 분석 합니다. 바이러스 기능 titer를 결정 하려면 다음 수식을 사용 합니다.
      Equation 1
      여기,
      Tg = GFP-긍정적인 세포;
      Tn = 셀;의 총 수
      N = 총 수 불리고 세포;
      V = (microliters)에서 변환에 사용 되는 볼륨.
  8. GFP-긍정적인 세포 계산
    참고: 변환에 대 한 고용 하는 감염 (MOI)의 복합성을 결정 합니다. MOIs의 넓은 범위를 테스트 (나 나 1 = = 10).
    1. 시드 3 x 10 6 잘 플레이트의 각 웰 당 4 x 105 HEK 293T 세포에5 .
    2. 셀에 도달할 때 > 80% 합류 관심의 나에서 벡터와 transduce.
    3. 5% CO2, 37 ° C에서 품 어 고 1-7 일에 대 한 셀에 GFP 신호를 모니터링 합니다.
    4. GFP-긍정적인 세포의 수를 계산 합니다. 형광 현미경을 사용 (계획 4 x 목표, 0.1 없음, 40 배 확대) GFP 필터를 사용 하 여 (여기 파장 = 470 nm, 방출 파장 = 525 nm). Untransduced 셀을 사용 하 여 GFP 음수가 셀의 제어 인구를 설정.
    5. 바이러스의 기능적 titer를 확인 하려면 다음 수식을 사용 합니다.
      Equation 2
      여기,
      N = GFP-긍정적인 세포;
      D = 희석 비율;
      M = 확대 비율;
      V = 변환에 사용 되는 바이러스의 볼륨.
      참고:이 예에서는 다음 결과 계산: 10 GFP-긍정적인 세포 (N) 10-4 (1:10, 000) 20 x 배율 (M) 10 µ L 샘플 (V)에 한 희석 (D)에서 계산, 밀리 리터 당 TU (10 x 104) 될 것입니다 (20) x (10) x (100) x = 2 x 108 vu/mL.

2입니다. dopaminergic 신경 조상 세포의 분화

  1. HiPSCs 배양
    참고: hiPSCs SNCA 로커 스, ND34391, triplication와 함께 환자에서 신경 성 질환의 국가 학회 및 치기 (NINDS) 카탈로그 (재료의 표 참조)에서 입수 했다.
    1. 급지대 무료 ESC-iPSC 문화 매체에 피더 독립 조건 hiPSCs 문화 ( 재료의 표참조) 기본 매트릭스 hESC 자격 막 (BMM)에-코팅 판 ( 재료의 표참조). DMEM/F12의 1 mL와 confluent 식민지를 세척, 분리 시 약의 1 mL을 추가 ( 재료의 표참조), 그리고 실내 온도에 3 분 동안 품 어.
    2. 분리 시 발음을 피더 무료 ESC-iPSC 문화 매체의 1 mL를 추가 합니다.
    3. 셀 리프 터를 사용 하 여 접시를 긁 고 pipetting 4 x-5 붕 규 산 펫을 사용 하 여 x 여 급지대 무료 ESC-iPSC 문화 매체의 11 mL에 식민지를 resuspend.
    4. BMM 코팅 접시에 식민지의 서 스 펜 션의 2 mL 접시 하 고 5% CO2와 37 ° C에서 접시를 놓습니다. 매일 중간 변화를 수행 하 고 5-7 일 마다 셀 분할.
  2. Dopaminergic 신경 조상 세포로 분화
    참고: Dopaminergic 신경 조상 세포 (MD NPCs)로 hiPSCs의 차별화는 약간의 수정31,32 (제조 업체의 지시 당 상용 신경 유도 중간 프로토콜을 사용 하 여 수행 재료의 표참조). 차별화의 첫 날은 0으로 간주 됩니다. 높은 품질 hiPSCs는 효율적인 신경 분화에 필요 합니다. MD NPCs의 유도 performedusing embryoid 몸 (EB)-프로토콜을 기반으로.
    1. HiPSCs의 분화를 시작 하기 전에 microwell 문화 접시 준비 ( 재료의 표참조)는 제조업체의 지침에 따라.
    2. Microwell 문화 접시를 준비 후 추가 10 µ M와 보충 신경 유도 매체 (님; 참조 테이블의 재료)의 1 mL Y-27632.
    3. 사용할 준비가 될 때까지 접시를 따로 설정 합니다.
    4. DMEM/f 12와 hiPSCs 세척, 세포 분리 솔루션의 1 mL을 추가 ( 재료의 표참조), 5% CO2와 37 ° C에서 5 분 동안 품 어 고.
    5. DMEM/F12에 단일 셀을 resuspend 하 고 5 분 동안 300 x g 에서 원심.
    6. 신중 하 게는 상쾌한 발음 하 고 resuspend 님 + 10 µ M에서 셀 3 x 106 셀/mL의 최종 농도를 Y-27632.
    7. Microwell 문화 접시의 한 우물을 단일 셀 서 스 펜 션의 1 mL을 추가 하 고 3 분 100 x g 에서 격판덮개 원심.
    8. 격판덮개는 microwell 중 셀의 동등한 배급을 보장 하기 위해 현미경을 검토 하 고 5% CO2와 37 ° C에서 세포를 품 어.
    9. 일 1-4에 일일 부분 중간 변경을 수행 합니다.
    10. 1 mL를 사용 하 여 micropipette, 매체의 1.5 mL을 제거 하 고 삭제. 천천히, Y-27632 없이 신선한 님의 1.5 mL를 추가 합니다.
    11. 하루 4까지 2.2.10 단계를 반복 합니다.
    12. 하루 5, 6 잘 플레이트 BMM. 와 한 잘 코트
    13. 37 µ m 가역 거르는 장소 ( 테이블의 자료를 참조) 50 mL 원뿔 튜브 (폐기물) 위에. 가역 여과기 위쪽의 화살표를 가리킵니다.
    14. 형성된 된 EBs를 방해 하지 않고 microwell 문화 판에서 매체를 제거 합니다.
    15. DMEM/F12의 1 mL를 추가 하 고 신속 하 게 붕 피펫으로와 EBs를 수집 하 고는 스 트레이너를 통해 필터링.
    16. 2.2.15 단계를 반복 하 여 모든 EBs microwell 문화 판에서 제거 됩니다.
    17. 새로운 50 mL 원뿔 튜브에는 여과기를 반전 하 고 모든 EBs를 수집 하는 님의 2 개 mL를 추가 합니다.
    18. BMM 코팅 판 붕 피 펫을 사용 하 여 단일 음에 EB 서 스 펜 션의 2 개 mL를 플레이트. EBs 5% CO2와 37 ° C에서 품 어.
    19. 하루 6, 님 + 200 ng/mL 쉬의 2 개 mL를 준비 ( 재료의 표참조) 매일 중간 변화를 수행 하 고.
    20. 주 8, 신경 유도의 비율을 확인 합니다.
    21. 연결 된 모든 EBs를 계산 하 고, 특히, 각 개별 EB 신경 근 엽으로 가득 수를 결정. 다음 수식을 사용 하 여 신경 근 엽 유도 계량.
      Equation 3
      참고: 신경 유도 경우 < 75%, 신경 근 엽 선택 효율적일 수 있습니다 없습니다.
    22. 하루 12, N2B27 매체의 250 mL neurobasal 매체, DMEM/F12 매체, GlutaMAX, NEAA, n 2 보충, 비타민 A 없이 B27의 5 mL 2.5 mL 2.5 mL 2.5 mL의 119 mL, Gentamicin (50 mg/mL)의 250 μ의 119 mL와 함께 준비 19. BSA (7 mg/mL)의 66 μ.
    23. 완전 한 N2B27 매체의 50 mL를 준비 하려면 추가 3 μ M CHIR99021, 2 μ M SB431542, 20 ng/mL bFGF, 20 ng/mL EGF, 및 200 ng/mL 쉬.
      참고: 준비 완료 하는 것이 중요 하다 사용 하기 바로 전에 중간.
    24. 신경 근 엽을 포함 하는 우물에서 매체를 발음 하 고 DMEM/F12의 1 mL로 씻어.
    25. 광고의 신경 근 엽 선택 시 약 1 mL ( 재료의 표참조) 및 5% CO2 1 h 37 ° C에서 품 어.
    26. 선택 시 약을 제거 하 고, 장미 클러스터를 직접 목표로 1 mL pipettor를 사용 하 여.
    27. 15 mL 원뿔 튜브에 정지를 추가 하 고 반복 단계 2.2.25 2.2.26 신경 장미 클러스터의 대부분까지 모았다.
      참고: Nonneuronal 셀 종류와 오염을 방지 하려면 overselect 하지 않습니다.
    28. 원심 350 x g 5 분 Aspirate에서 장미 정지는 상쾌한 고 resuspend N2B27 + 200 ng/mL 쉬 신경 근 엽. BMM 코팅 잘에 신경 근 엽 정지를 추가 하 고 5% CO2와 37 ° C에서 접시를 품 어.
    29. 13-17 일, 매일 매체 변경 완료 된 N2B27 매체를 사용 하 여 수행 합니다. 문화는 80%-90% 합칠 때 셀을 통과.
    30. 셀을 분할 하려면 BMM 코팅 접시를 준비 합니다.
    31. DMEM/F12의 1 mL로 세포 세척, 매체, 발음 및 분리 시 약의 1 mL을 추가 ( 재료의 표참조).
    32. 37 ° C에서 5 분 동안 incubate DMEM/F12의 1 mL을 추가 하 고 아래로 pipetting에 의해 연결 된 셀을 꺼내. 15 mL 원뿔 튜브에 NPC 정지를 수집 합니다. 5 분에 대 한 300 x g 에서 원심 분리기.
    33. 상쾌한 발음 하 고 완전 한 N2B27의 1 mL에 셀 + 200 ng/mL 쉬 resuspend.
    34. 셀을 계산 하 고 105 셀/cm2, x 1.25의 조밀도에 접시 5% CO2와 37 ° C에서 세포를 품 어.
    35. 변경 매체 매일, 완전 한 N2B27 + 200 ng/mL 쉬를 사용 하 여.
      참고: 이 대목에서 Npc 통과 (P)로 간주 됩니다 0. 쉬 p 2에서 N2B27 매체에서 철회 될 수 있다.
    36. 일단 80%-90% 합류 도달 하면 세포를 통과.
    37. 이 단계에서 세포 immunocytochemistry 및 정량 사용 하 여 Nestin 및 FoxA2 마커 익스프레스 확인 합니다. 이 프로토콜 Nestin 및 FoxA2 표식에 대 한 85% 두 배 긍정적인 세포의 생성을 지도 한다.
    38. 셀을 뿌리고에 대 한 2.2.31–2.2.36 단계를 반복 합니다.
    39. P2 통로에서 시작 셀을 고정 합니다. 세포의 동결에 대 한 2.2.31–2.2.36 단계를 반복 하 고 4 x 106 셀/ml 매체 얼어 차가운 신경 뿌리를 사용 하 여 2 x 106 셀 펠 릿 resuspend ( 재료의 표참조).
    40. 각 cryovial에 세포 현 탁 액 1 mL를 전송 하 고 표준 느린 속도 제어 하는 냉각 시스템을 사용 하 여 셀을 동결. 장기 저장을 위한 액체 질소에 셀을 계속.
  3. MD NPCs 녹고
    1. BMM 코팅 접시를 준비 하 고 완벽 한 N2B27 따뜻한. 15 mL 원뿔 튜브에 따뜻한 DMEM/F12의 10 mL를 추가 합니다. 2 분 동안 37 ° C 열 블록에는 cryovial를 배치 합니다.
      1. DMEM/F12 포함 된 튜브에는 cryovial에서 셀을 전송. 5 분에 대 한 300 x g 에서 원심 분리기.
      2. 상쾌한 발음, resuspend N2B27의 2 개 mL에 셀 고 BMM 코팅 접시의 한 우물을 세포 현 탁 액을 추가 합니다. 5% CO2와 37 ° C에서 세포를 품 어.

3. 변환 MD NPCs 및 메 틸 화 변화 분석

  1. MD NPCs의 변환
    1. LV-gRNA/dCas9-DNMT3A 벡터 나에와 70% 합류에 MD NPCs transduce = 2. N2B27 중간 16 h posttransduction을 교체 합니다.
    2. 5 µ g/mL puromycin, 변환 후 48 h와 N2B27를 추가 합니다. N2B27 플러스 puromycin 안정적인 MD NPC 라인을 얻기에 3 주 동안 셀 문화. 셀 (DNA, RNA, 단백질 분석, phenotypic 특성23, 동결 및 뿌리고) 다운스트림 응용 프로그램에 대 한 준비가 되었습니다.
  2. SNCA intron 1의 메 틸 프로필의 특성
    1. 안정적으로 transduced 각 세포에서 DNA를 추출 DNA 추출을 사용 하 여 라인 키트 ( 재료의 표참조).
    2. 상업적으로 사용할 수를 사용 하 여 황산 변환을 수행 하려면 DNA의 사용 800 ng 키트 ( 재료의 표참조). 변환 후에 황산, 황산 변환 DNA 20 ng / µ L을 elute.
  3. Pyrosequencing 분석을 위한 PCR
    1. Nuclease 무료 튜브에 PCR 마스터 믹스를 준비 합니다. 각 반응에 대 한 역방향 뇌관 (10 µ M), 앞으로 뇌관 (10 µ M), MgCl2 (25 m m), CoralLoad 집중, 2 x PCR 마스터 믹스의 10 µ L, 5의 4 µ L x 10의 2 µ L의 1.6 µ L의 0.4 µ L의 0.4 µ L를 사용 하 여 Q-솔루션, DNA의 1 µ L x 그리고 0.6 µ L nuclease 무료 물.
    2. 반응 플레이트는 thermocycler 전송 하 고 다음 조건을 사용 하 여 PCR을 수행: 30 94 ° C의 50 주기 15 분 동안 95 ° C s, 56 ° C 30에 대 한 s, 그리고 30 대 72 ° C s, 72 ° c.에 마지막 10 분 확장 단계 뇌관 SNCA intron 1의 pyrosequencing에 사용 되는 표 1, 그림 7A보충 그림 1에 나열 됩니다.
    3. 증폭 후 amplicons ethidium 평범한 사람 얼룩이, 다음 agarose 젤 전기 이동 법으로 PCR 제품의 2 µ L를 사용 하 여 시각화.
    4. Pyrosequencing 분석 실험 unmethylated (U)의 혼합물을 사용 하 여 유효성을 검사 하 고 갠 다음 비율, 즉 100U:0M, 75U:25M, 50U:50M, 25U:75M, 및 0U:100M ( 재료의 표참조)에 황산 변환 DNAs (M).
    5. Pyrosequencing pyrosequencing 시 약 ( 재료의 표참조)를 사용 하 여 수행 하 고 pyrosequencing 소프트웨어를 사용 하 여 각 CpG 사이트에 대 한 메 틸 화 값을 계산 합니다. 자세한 pyrosequencing 프로토콜에 대 한 Bassil 외37참조.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

순진한 GFP 대응에 비해 LV-dCas9-DNMT3A-GFP/순수 하지 않아 벡터의 생산 titers의 유효성 검사

우리 p24개 그 ELISA 순진한 GFP/순수 하지 않아 대조 물과 LV-dCas9-DNMT3A-GFP/순수 하지 않아의 물리적 titers 사이 비교를 수행 합니다. 그림 5A에 대표 결과 여기 설명 된 프로토콜을 사용 하 여 생성 된 벡터의 실제 수익률 비교는 보여줍니다. 이 최적화 된 생산 프로토콜 함께 최적화 된 벡터 등뼈의 유틸리티 CRISPR/dCas9 벡터의 높은 수율 titer에서 결과 나왔다. 바이러스 성 입자로 dCas9 DNMT3A transgene의 포장의 효율성을 평가 하기 위해 우리는 HEK 293T 세포 (그림 5B)로 집중된 벡터의 변환 수행. 도 불구 하 고, 그림 5A 에 보고 된 결과 LV-dCas9-DNMT3A-GFP 벡터의 변환 속도 (그림 5B) 순진한 GFP 벡터의 그것 보다 훨씬 낮은 했다 보여주었다. 사실, LV-dCas9-DNMT3A-GFP 벡터의 기능 titer 순진한 대응, CRISPR/dCas9 RNA의 포장 효율성 감소 제안 보다 4 배 낮은 했다. 또한, LV-dCas9 DNMT3A 순수 하지 않아 벡터 이었던 오부 순-순수 하지 않아 국가 비해 낮은 속도로 puromycin 저항력이 식민지를 형성. 우리는 또한 MD NPCs에 LV dCas9 DNMT3A 순수 하지 않아 벡터의 변환의 효율성을 테스트 했습니다. 이 위해, 세포는 순진한 LV GFP 벡터와 LV-dCas9-DNMT3A-순수 하지 않아 나에 불리고 했다 = 1. 그림 5C같이 순수 하지 않아 제어 벡터의 변환 속도 됐다 오부 높은 dCas9 DNMT3A 벡터와 비교. 이러한 결과 (그림 5D) 벡터의 GFP 버전을 사용 하 여 확인 되었다. 여기서 설명 하는 LV epigenome 편집 시스템의 낮은 포장/식 특성을 가진 토론 섹션에서 제안 그 레벨 대상 시퀀스에 지속 가능한 DNA 메 틸 화를 유도 충분 하다. 또한, 이러한 특성 생산 절차를 확장 하 여 향상 시킬 수 있습니다.

MD NPCs의 차별화

여기에 설명 된 EB 기반 프로토콜 MD NPCs (그림 6A)의 차별화 수 있습니다. 우리는 여러 단계에서 특정 마커를 사용 하 여 차별화 과정 평가. hiPSCs 표현 pluripotency 마커 OCT4, MD NPCs Nestin와 FOXA2 표현 하는 동안 (그림 6B, C). 우리 이전 보고이 분화 프로토콜 83.3 %Nestin 및 FOXA2 마커31, 대 한 두 배 긍정적인 세포의 생성이 세포의 성공적인 차별화를 확인. 적어도 75%-80%는 셀의 셀 전용 마커를 표시 해야 합니다. 낮은 수율 (< 50%) 표식에 대 한 긍정적인 셀의 또 다른 분화 프로토콜을 요구할 것 이다.

1 메 틸 프로필 SNCA intron에 대 한 분석 실험에서 pyrosequencing의 유효성 검사

7 pyrosequencing 분석 실험 (표 1, 보충 그림 1, 그림 7A) 설계 되었고 SNCA intron 1에서에서 메 틸 화 상태의 정량화에 대 한 검증. Chr4: 89,836,150 89,836,593 (GRCh38/hg38) 지역에는 23 cpgs 내 겠을 포함 되어 있습니다. 설계 분석 실험 했다 unmethylated (U)의 다른 혼합물을 사용 하 여 선형성에 대 한 유효성을 검사 하 고 표준으로 (M) 황산 변환 DNAs 갠. 혼합물은 다음 비율, 즉 100U:0M, 75U:25M, 50U:50M, 25U:75M, 및 0U:100M에서에서 사용 되었다. 모든 7 개의 분석 실험 했다 (그림 7B)의 유효성을 검사 하 고 선형 상관 R2 > 0.93을 보였다. 유효성이 검사 되지 했다 분석 실험은 재설계 했다. 검증 된 분석 실험을 사용 하 여, SNCA intron 1 (그림 ℃)에서 23 cpgs 내 겠에서 메 틸 화 수준을 결정 가능 했다.

Figure 1
그림 1: 유전자 활성화 및 억압 Epigenome 편집 도구. (A) 닫힌된 구조 DNA의 섬으로 조직 보여줍니다. 이펙터 분자, 등 VP64, P65, rta, DNA demethylation 효소, tet-1 dCas9 gRNA 시스템으로 페어링 통해 규제 지역 (발기인, introns, 등)을 모집 수 있습니다. 시스템의 채용 chromatin 개장 오픈 chromatin 조직 (euchromatin) 유전자 활성화와 관련 된의 설립에 이르게 발생 합니다. (B) 입을 Epigenome 기반 dCas9 repressory 단지, 리아, HDACs, 및 DNA 메 틸 화 효소, DNMT3A gRNA 구성 요소와 tethering을 통해 규제 지역 (발기인, introns, 등) 등을 모집 하 여 얻을 수 있습니다. (침묵), 유전자 비활성화 시스템의 채용 관련 DNA chromatin 개장, 그리고 염색 질 구조에 일반적인 전사 기계의 어려움. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 디자인 SNCA 내 타겟된 DNA 메 틸 화에 대 한 lentiviral 벡터의 triplicated loci. (A)는 생산 및 식-최적화 된 벡터 백본 칸 토 외.23, Ortinski 그 외 여러분30, 및 Vijayraghavan 및 칸 토35자세하게 설명 됩니다. 벡터의 cis 요소의 주석 벡터 포장 요소 (ψ, psi), 레 브 응답 요소 (RRE), Sp1 바인딩 사이트 (Sp1), 인간의 U6 발기인 (hU6), 코어-신장 요인 1α 발기인 (EFS-NC), 그리고 마 형 간염 바이러스는 posttranscriptional 규제 요소 (WPRE)입니다. (B) SNCA 의 도식 대표 로커 스triplicated. DNA 메 틸 화는 직접 또는 간접적으로 DNA 접근성21제한 하는 중요 한 transcriptional 규칙 메커니즘입니다. 증가 SNCA 식 CpG 메 틸 화 저급 SNCA intron 1에서에서 우연히 관찰 되었다 (녹색 화살표 라벨 triplicated SNCA 로커 스의 활성화 유전자 식 상태). LV-gRNA/dCas9-DNMT3A 벡터의 모집 SNCA intron 1 지역에 methyltransferase 효소 동요. SNCA (빨간색 화살표)의 transcriptional downregulation 귀착되는 닫힌된 chromatin의 조립에이 결과. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: dCas9 DNMT3A transgene 들고 lentiviral 벡터 식 카세트의 건설. 부모의 벡터, pBK301, Ortinski 외.30에 설명 되어 있습니다. Vector dCas9-DNMT3A-순수 하지 않아 (pBK492)와 복제 했다 또는 dCas9-DNMT3A-GFP (pBK539) (복제 흐름 찾을 수 있습니다 프로토콜 및 칸 토 외.23). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: Lentiviral 벡터 포장, 생산, 및 정화. LV-gRNA/dCas9-DNMT3A의 생산에 사용 되는 (A) 과도 transfection 프로토콜. 벡터를 생성 하려면 HEK 293T 세포 vesicular 구내 염 바이러스 (VSV-G), G-단백질 페 했다 포장, 그리고 식 플라스 미드23. 바이러스 성 입자는 문화 supernatants에서 수집 했다. 패키징 시스템의 두 번째 세대 식 카세트를 보완 하기 위해 사용 되었다. 시스템 숨겨 문신와 Rev 단백질. 레 브 플라스 미드 pRSV-레 브, 별도로 보충 되었다. 약어: pCMV = 세포 발기인; LTRs = 긴 단말기 반복; VSV G = vesicular 구내 염 바이러스 G-단백질; RRE = 계 응답 요소; Sp1 녹음 방송 요인 s p 1-바인딩 사이트; = Ψ = 벡터 포장 요소 (psi); WPRE = 마 간염 바이러스 posttranscriptional 규제 요소; EFS NC = 코어 신장 요인 1α 발기인; hU6 = 인간의 U6 발기인. (B) 벡터 정화 및 농도 실행 다음과 같습니다: 더블 자당 그라데이션 프로토콜 정화 하 고 일시적인 transfection (위 참조) 다음 바이러스 성 입자를 집중 하는 데 사용 되었다. 간단히, 문화 상쾌한 (SN) 수집 되었고 자당 기온 변화도에 로드. 그라디언트를 만들려면 70%, 60%, 30%, 및 20% 자당 해결책 1 x 사용 되었다 PBS에에서 용 해. 정화의 두 번째 단계 포함 20% 자당의 쿠션에 대 한 ultracentrifugation. 형성된 된 펠 릿 1 x PBS에 resuspended 이었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: 바이러스 titers의 평가. (A) p24 ELISA 분석 결과. 칸 토 외.23에 의해 설명 된 대로 tittering 절차 수행 되었습니다. 순진한 (GFP) 벡터 검정색 막대 강조 표시 됩니다. LV-dCas9 DNMT3A 순수 하지 않아 벡터 (밝은 파란색 막대)와 LV-dCas9-DNMT3A-GFP 벡터 (녹색 막대) 또한 강조 표시 됩니다. 벡터의 물리적 입자 생산 평가 하고있다. 여기서 1 밀리 리터, 당 복사 숫자에 결과 기록 됩니다 p24개 그 의 ng 1 x 104 바이러스 성 입자를 =. 막대 그래프 데이터는 3 개의 독립적인 실험에서 평균 ±를 SD를 나타냅니다. (B) 평가 기능 titers HEK 293T 세포로 변환 다음. 순수 하지 않아 포함 된 LVs 대표 결과에 설명 된 대로 HEK 293T 세포로 불리고 있었다. 바이러스 생산의 기능 titers puromycin 선택 다음 식민지의 수를 세어 서 측정 되었다. 결과 lentiviral 벡터-순수 하지 않아 (제어 벡터) dCas9 DNMT3A 순수 하지 않아 대응 기준에서 얻은 식민지의 수의 비로 계산 했다. 막대 그래프는 3 개의 독립적인 실험에서 평균 ±를 SD를 나타냅니다. (C) 평가 변환 효율과 HEK 293T 세포 (위 패널)와 Npc (하단 패널) 벡터의 표현. 왼쪽된 패널 순진한 (GFP) 벡터 transductions를 나타냅니다. 오른쪽 패널 dCas9 DNMT3A GFP 벡터의 transductions를 나타냅니다. 3 일 posttransduction, 이미지 형광 현미경 (40 x)를 사용 하 여 수집 되었다. (D) 평가 기능 titers Npc로 변환 다음. 순수 하지 않아 포함 된 LVs 결과 대표에 설명 된 대로 Npc로 불리고 있었다 고 결과 패널 B에서 계산 했다. 막대 그래프는 평균 ±를 SEM 3 생물의 복제를 나타냅니다. 약어: HEK 293T 인간 미 발달 신장 293T; = Npc = 신경 조상 세포. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6: 차별화 및 특성화 hiPSC 파생 MD NPCs의. (A) Timeline 마커의 hiPSC 파생 MD NPCs. 정량화의 MD NPC (BC) immunocytochemistry (DE) 실시간 (RT) PCR 사용 하 여 차별화를 보여주는. 각 mRNA의 레벨 GAPDHmRNA와 2-ΔΔCT 메서드를 사용 하 여 PPIAmRNA 참조 컨트롤의 기하학적 의미를 기준으로 계산 했다. 각 열 두 생물 학적 및 기술 복제의 의미를 나타냅니다. 오차 막대는 SEM. 대표 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 7
그림 7: 양적 유효성 검사는 pyrosequencing의 분석 실험 대상 SNCA intron 1. (A)는 SNCA intron 1에에서 pyrosequencing 분석 실험의 개요. (B)는 설계 분석 실험 했다 unmethylated (U)의 다른 비율을 사용 하 여 유효성을 검사 하 고 갠 (M) 황산 변환 DNA, 즉 100U:0M, 75U:25M, 50U:50M, 25U:75M, 및 0U:100M. (C) Validated 분석 했다 SNCA 로커 스의 triplication와 함께 환자에서 hiPSC 파생 MD NPCs에 SNCA intron 1에서에서 23 cpgs 내 겠의 메 틸 화의 비율을 측정 하는 데 사용 됩니다. 바 갠 cpgs 내 겠 두 독립적인 실험에서의 비율의 평균을 나타내고 오차 막대 표시는 SEM. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

# 시험 앞으로 뇌관 (5'-3') 뇌관 리버스 (5'-3') 시퀀싱 뇌관 (5'-3') CpG 덮여
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7, 8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9, 8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 20, 21, 22, 23
biotyniliated 프라이 머를 나타냅니다.

표 1: Pyrosequencing의 SNCA intron 1 CpG 메 틸 화 수준 평가 위한 분석 실험.

보충 그림 1: SNCA intron 1에서에서 분석 실험에서 pyrosequencing의 개요. 이 파일을 다운로드 하려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

LVs 유전 질병의 맥락에서 특히 epigenome 편집을 위한 선택의 차량으로 등장 하기 시작 했습니다, (i) 수용 하기 위해 그들의 능력 때문에 주로 큰 DNA 페이로드 및 (ii) 효율적으로 transduce 다양 한 분할 및 nondividing 셀. 정 맥 주사의 큰 포장 효능은 특히 대형은 CRISPR/dCas9 시스템의 포장을 포함 하는 응용 프로그램에 대 한 유용 합니다. 이 관점에서 정 맥 주사 모두 한 CRISPR/Cas9 시스템의 배달에 대 한 선택의 플랫폼을 나타냅니다. 실제로, 일반적으로 전 임상 및 임상 유전자 치료 응용 프로그램에 대 한 고용, AAV 플랫폼, 완전히 dCas9 이펙터 시스템의 큰 포장 크기에 맞게 수는 없습니다. 사실, AAV 벡터의 엄격한 포장 요구 사항 CRISPR/dCas9 부품의 납품에 대 한 그들의 사용을 금지 됩니다. AAV 포장 기능을 개선 하기 위해, 여러 가지 새로운 AAV 기반 플랫폼 개발 되었습니다. 예를 들어 두 AAV 카세트로 시스템 최근 되었습니다 Cas9를 분리 하는 분할 intein 접근38건설. 접근은 전체 증가 했다 포장 용량; 그러나, 그것은 생산 및 cotransduction 두 AAV 벡터38의 필요합니다. SaCas9, 황색 포도상구균에서 파생 된의 발견 SaCas9/가이드 RNA 시스템39,40의 개발 허용. SaCas9 짧은, 그러나 동등 하 게 강력한 Cas9 효소, AAV 벡터에 쉽게 패키지입니다. 생체 조건 실험이이 시스템 효율적으로 콜레스테롤 규제 유전자 PCSK940을 대상으로 나타났습니다. 그럼에도 불구 하 고, 모든-에-하나의 AAV 벡터의 포장 효율성 향상 더 필요합니다. LV 전달 시스템의 명확한 이점을 고려 하면 우리는 최근 개발 하 고 lentiviral 백본 숨겨 dCas9 DNMT3A transgene gRNA 비 계 사용. 이 새로운 시스템의 치료 가능성을 테스트 하려면 우리 PD hiPSC 파생 뉴런 실시 SNCA loci triplication23에 그것을 적용. 우리는 SNCA-mRNA와 단백질 수준23의 미세 downregulation 결과이 시스템의 효율 검증. 중요 한 것은, 시스템 구조 질환 관련 세포 고기,23epigenome 기반 요법 대 한 접근의 중대 한 잠재력을 제안 하는 능력을 보여주었다.

벡터의 생산을 증가, 위해 우리는 최근에 Sp1 사이트, 3 ' LTR, 삭제 및 식 플라스 미드 (다음 단락 참조)의 다운 사이징의 통합을 포함 하 여 벡터 식 카세트에 몇 가지 수정을 도입30 .

기존 플랫폼을 수정

여기에 제시 된 생산 메서드는 1 x 1010 부/mL (그림 5)의 범위에서 titers에서 LV-CRISPR/dCas9 벡터의 생성을 수 있습니다. 위에 강조, 높은 생산 titers를 달성 하기 위해 우리는 모두 한 CRISPR/Cas9 식 벡터 카세트에 녹음 방송 요인 Sp1 바인딩 사이트의 반복을 추가 고 소개의 3' LTR U3 지역으로-의 상태--예술 삭제. 이러한 수정 결과 상당한 upregulation 벡터 포장 효율성 (~2.5x)에 있는 transgene 식 뿐만 아니라 (약 칠 배의)30,35. 이러한 개선 이전에 생성 된 데이터41,42,,4344에 있습니다.

중요 한 단계 및 문제 해결

바이러스 성 입자로 포장 최적화 된 벡터 카세트 titers 약 1 x 1010 부/mL 당 5 ~ 107 프로듀서 셀 x의 생성 합니다. 낮은 titers에서 벡터의 생산의 경우 다음과 같은 향상을 고려해 야 합니다. 1) 낮은 통로 번호에서 HEK 293T 세포를 사용 합니다. ≥20 통행 후 정기적으로 셀을 교체 합니다. 또한, 그들은 느린 성장 속도 표시 하는 경우 셀을 교체 합니다. 이후 그들은 바이러스 titer에 변화에 기여할 수 있습니다 2) 정기적으로 매체의 구성 요소를 확인 합니다. 대체 비용 효율적인 우주 송아지 혈 청으로 태아 혈 청. 3) 다른 셀 라인 벡터 생성에 사용 된 고유 생산 피트 니스를 보여 줍니다. 예를 들어 HEK 293T 세포 3 배 HEK 293 피트 셀 보다 더 높은 수준에서 벡터를 생성 할 수 있다 (데이터 표시 되지 않음). 4) 최적의 transfection 70%-80% 합류에 셀 때 달성 될 것 이다. 낮은 밀도 바이러스 독성의 요인으로 조 세포 죽음 귀 착될 것 이다. 그러나, 높은 밀도 생산 효율성 상당한 감소에 발생할 것 이다. 일반적으로 세포 밀도 transfection 전에 완전히 confluent 문화를 수립 하기 전에 한 번 분열 세포를 허용 해야 합니다. 5) transfection titers는 또한 BBS 시 약의 pH에 따라 달라 집니다. 일반적으로 그것의 사용 이전 파일럿 transfection 설정에서 게시판의 새로운 배치를 테스트 하는 것이 좋습니다. 2 x BBS pH 6.95 이어야 한다입니다.

변환 효율/식 대 생산 수율

그것은 해야 지적도 Sp1 LVs 운반 CRISPR/dCas9 transgenes는 1 x 1010 vu/mL 당 5 ~ 107 프로듀서 셀, 배 순 진 벡터 (그림 5A)와 비교는 주변 titers를 생성할 수는 바이러스 RNA의 포장의 효율은 dCas9 DNMT3A transgene로 크게 손상 된다. 실제로, 우리는 입증 한 약 오부 감소 기능 titers에 LV-dCas9-DNMT3A-순수 하지 않아/GFP 벡터 (그림 5B-D)의 식 기능. 포장 효율성과 벡터의 표현에서 감소 DNMT3A overexpression의 결과일 수 있습니다. 이와 관련, DNA 메 틸 화 hiv-1 복제 및 그것의 유전자 발현 조절에 중요 한 역할을 재생할 수 있습니다 입증 되었습니다. 따라서, LVs 비슷한 규정이 적용 여부 및 벡터 생산 단계에서 유도할 수 있는 침묵 DNMT3A 활동 전략을 개발 하는 경우 결정 하는 데 필요한 것입니다. 낮은 생산 수율에도 불구 하 고 벡터 (낮은 109 범위에서 필요한 생체 조건 납품을 포함 하 여 많은 응용 프로그램을 충분 해야 한다) 괜찮은 기능 titers을 보여 줍니다. 그것은 다른 식 시스템으로 얻은 titers에 일치 하는 것을 허용 해야 검토에서 언급 했 듯이 그 생산 절차 쉽게 upscaled 수, 지적 가치가 있다.

벡터 처리 및 안전

LVs를 생성 하려면 다음과 같은 안전 포인트를 고려 한다. 우선, LVs biosafety 수준 2 containments 필요합니다. LVs (이 그들의 죄를 자연에서 유래)의 상대적 안전에도 불구 하 고 잔여 transcriptional 활동 시연된22되었습니다. 또한, LV 게놈 에이즈-122에 의해 구출 될 수 있다. 모든이 때문에 (특히에 집중된 준비) 복제 능력 분석 실험을 수행 것이 좋습니다. 안전은 lentiviruses의 처리에 관한 절차, 우리가 여기를 참조 Microbiological에 Biosafety 및 생물 의학 실험실, 제 4 판, 질병 통제 센터에 의해 출판 (CDC, 사용 가능한 온라인). 임상 응용 프로그램에 대 한 포장 시스템의 제 3 세대를 사용 합니다. 그럼에도 불구 하 고, 포장 시스템의 제 3 세대를 사용 하 여 2 세대 포장 시스템 비교 낮은 titers 연관 주목 한다.

의미와 향후 방향

여기에 설명 된 새로운 플랫폼 epigenome 편집 구성 요소 제공 및 세포와 장기에 다른 분자 화물에 대 한 적-확대 도구를 향상 시킵니다. 개발 에이즈-1-기반 시스템의 최근 발전에도 불구 하 고 몇 가지 플랫폼만 바이러스 생산의 지속 가능한 수익률을 보여 줍니다. 벡터 등뼈의 최적화 보고 여기 일부의 벡터의 상대적으로 낮은 생산 효율성과 관련 된 문제를 해결 하기 위해 가능 하 게 했다. 추가로 벡터 생산 특성을 개선 하기 위해, 그것은 벡터 및 식 멀티 복사 반복 동일한 바인딩 모티브의 또는 인식 사이트와 Sp1 모티브를 멀티플렉싱 하 여 추가 통해 향상 시킬 수 있는지 여부를 테스트 하려면 가치가 있을 것 이라고 대 한 다른 요인. 이와 관련, 여기에 제시 된 결과 인간 나 (hSyn)와 CamKIIa synapsin 등 상대적으로 약한 조직 특정 발기인의 개선에 대 한 일반적인 전략을 제공할 수 있습니다.

우리는 최근 LV 전달 Cas9/가이드 RNA의 장기 표현 바람직하지 않은 오프 대상 효과30으로 이어질 수 있습니다 입증. 비록이 개념 셀 분할에 주로 적용, 뚜렷이 치료 화물을 배달할 수 episomal 벡터 시스템을 개발 하는 매우 유익한 것입니다. 위의 언급, AAV 벡터는 매우 가치 있는, 뚜렷이 제공 차량; 그럼에도 불구 하 고, 낮은 포장 능력에 크게 영향을 특히 epigenome 편집 응용 프로그램에 대 한 그들의 사용. 이러한 이유로, integrase 불충분 한 lentiviral 벡터 (IDLVs) 납품 및 epigenome 편집 도구 CRISPR/dCas9에 따라 식에 대 한 매력적인 수단을 제공할 것입니다. IDLV 플랫폼의 다음 특성은 특히 매력적 이다: (i) 광범위 한 세포와 장기; 유전 화물을 전달 하는 능력 (2) 우수한 포장 용량-는 상당한 이점을 AAV 벡터; (iii) 일시적인 성격의 배달 (이 integrase 유능한 LVs에 비해 상당한 이점을)45,30. IDLV 유전자의 episomal 자연 그들의 매우 낮은 통합 속도 강조 되며, 따라서, insertional mutagenesis의 위험 감소에 크게 도움이. 우리는 최근에 안전 하 고 효율적인 CRISPR/Cas9 구성 요소30의 배달에 대 한 플랫폼을 만드는 IDLV 생산 및 식 특성 최적화. 실제로, 향상 된 IDLVs HEK 293T 세포 및 postmitotic 두뇌 신경 세포를 편집 하는 신속 하 고 지속적인 게놈을 유도 할 수 있었다. 시스템 그리고 과도 식 특징은 해당 integrase 유능한 LVs 보다 안전할 것을 발견 했다. IDLV 벡터 epigenome 편집 조작을 포함 하는 응용 프로그램에 대 한 적응 유전자 치료 분야에 대 한 매우 유리한 것입니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

듀크 대학이이 연구에 관련 된 임시 특허 출원을 제기 했다.

Acknowledgments

이 작품은 칸 Neurotechnology 개발 상 (O.C.)을 국립 연구소의 건강/국립 연구소의 신경 장애 및 뇌졸중 (NIH/NINDS) 일부 자금 O.C. (R01 NS085011).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics