코드 혈액 파생에서 3D 피부 Organoid의 생성 유도 만능 줄기 세포

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

우리는 이러한 keratinocytes 및 섬유 아 세포를 사용 하 여 유도 만능 줄기 세포 유래 keratinocytes 및 섬유 아 세포 분화 및 3D 피부 organoid, 생성 하는 방법을 보여 주는 프로토콜을 제안 합니다. 이 프로토콜 humanized 마우스 모델을 생성 하는 추가 단계를 포함 합니다. 여기에 제시 된 기술 피부과 연구를 향상 됩니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

피부는 신체의 가장 큰 기관 이다 하 고 많은 기능을가지고 있다. 피부 물리적 장벽 및 시체의 수호자로 서 역할을 하며 신체 기능을 조절. Biomimetics 모델, 시스템 및 복잡 한 인간의 문제1을 해결 하기 위해 자연의 모방 이다. 피부 biomimetics 생체 외에서 질병 연구 그리고 vivo에서 재생 의학에 대 한 유용한 도구입니다. 인간 유도 만능 줄기 세포 (Ipsc) 무제한 확산의 특성 있고 3 개의 세균 층을 차별화의 능력. 인간의 Ipsc는 다양 한 기본 세포, 혈액 세포, keratinocytes, 섬유 아 세포 등에서 생성 됩니다. 그 중, 탯 줄 혈액 단 세포 (CBMCs) 수용자 재생 의학의 관점에서 다른 셀 원으로 떠오르고 있다. 셀 뱅킹 시스템에 필수적 이다 인간 백혈구 항 원 (HLA) 입력 하기 때문에 CBMCs는 재생 의학에 유용 합니다. 우리 섬유 아 세포와 keratinocytes CBMC Ipsc의 차별화 및 3D 피부 organoid의 생성을 위한 메서드를 제공합니다. CBMC iPSC 파생 keratinocytes 및 섬유 아 세포 1 차 셀 라인에 유사한 특성이 있다. 3D 피부 organoids는 피부 층에 표 피 레이어 overlaying에 의해 생성 됩니다. 이 3D 피부 organoid, 이식으로 인간 답게 마우스 모델 생성 됩니다. 이 연구는 3 차원 인간의 iPSC 파생 피부 organoid 피부과 연구 생체 외에서 그리고 vivo에서 소설, 대체 도구가 될 수 있습니다 보여줍니다.

Introduction

피부는 신체의 가장 바깥쪽 표면 커버 하 고 내부 장기를 보호 한다. 피부는 병원 체에 대 한 보호, 흡수, 저장 물 등 다양 한 기능, 체온을 조절 하 고 신체를 검출 낭비2. 피부 이식 피부 소스;에 따라 분류 될 수 있다 다른 기증자 로부터 피부를 사용 하 여 이식 이식, 불린다 고 이식 환자 자신의 피부를 사용 하 여 autografts. autograft는 그것의 낮은 거부 위험으로 인해 선호 하는 치료, 피부 생 검은 심한 병 변 가진 환자 또는 피부 세포의 수가 부족에 수행 하기 어렵다. 환자에서 심한 화상, 피부 세포의 수 3 배 큰 부위를 커버 하는 데 필요한 있습니다. 환자의 몸에서 피부 세포의 제한 된 가용성 allogenous 식은 필요한 경우에 발생 합니다. 그것은 일반적으로 약 1 주3후 숙주의 면역 체계에 의해 거부 이후 자가 이식을 수행할 수 있습니다 때까지 일시적으로 이식 사용 됩니다. 환자의 면역 시스템에 의해 거부를 극복 하기 위해 이식 환자4같은 면역 정체성과 소스에서와 야 한다.

인간의 Ipsc는 줄기 세포 치료5셀의 신흥 소스입니다. 인간의 Ipsc OCT4, SOX2, Klf4, 및 c-Myc6등 재활 요소를 사용 하 여 신체 세포에서 생성 됩니다. 인간의 Ipsc를 사용 하 여 배아 줄기 세포 (ESCs)7,8의 윤리 문제와 면역 극복. 인간의 Ipsc pluripotency 있고 3 개의 세균 층9으로 분화 할 수 있다. HLA, 재생 의학에 중요 한 요인의 존재는 면역 반응과 거부10의 가능성을 결정합니다. 환자 파생 Ipsc 사용 하 여 셀 소스 제한 및 면역 시스템의 문제를 해결합니다. CBMCs는 또한 재생 의학11에 대 한 대체 셀 원본으로 나왔다. 필수 HLA 타이핑, CBMC 은행 중 발생 하는 연구와 이식에 대 한 쉽게 사용할 수 있습니다. 더, homozygous HLA 형 Ipsc 널리 다양 한 환자12에 적용할 수 있습니다. CBMC iPSC 은행 소설 및 세포 치료 및 재생 의학 allogenic12,,1314에 대 한 효율적인 전략 이다. 이 연구에서 우리는 CBMC-Ipsc, keratinocytes 및 섬유 아 세포로 분화를 사용 하 고 층 화 3D 피부 레이어를 생성. 이 연구에서 결과 3D 피부 CBMC iPSC 파생 organoid 생체 외에서 그리고 vivo에서 피부과 연구를 위한 새로운 도구는 것이 좋습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

동물 관련 된 모든 절차는 실험실 동물 복지 행위, 관리 및 실험 동물의 사용에 대 한 가이드에 따라 수행 했다 그리고 기관 동물 관리에서 지침 및 설치류 실험에 대 한 정책을 제공 하 고 한국 가톨릭 대학의 학부의 위원회 (IACUC)를 사용 합니다. 연구 프로토콜은 가톨릭 대학교의 한국 (CUMC-2018-0191-01)의 기관 검토 위원회에 의해 승인 되었다. Songeui 캠퍼스 2017 및 취득 협회 평가 대 한 식품 및 의약품 안전 청의 한국 우수 동물 실험실 시설 인가 IACUC, 가톨릭 대학교의 실험실 동물 (DOLA)의 부 고 2018 년에서 실험실 동물 케어 인터내셔널 (AAALAC) 국제 전체 인증 인가

1. 피부 세포 분화 유도 만능 줄기 세포에서

  1. 중간 준비
    참고: 어두운 환경에서 최대 3 개월까지 4 ° C에서 모든 매체를 저장 합니다. 살 균을 위해 사용 하기 전에 0.22 μ m polyethersulfone 필터 시스템을 사용 하 여 모든 매체를 필터링 합니다. 모든 매체의 500 mL 전체 볼륨에서 사용할 수 있었습니다.
    1. KDM1 준비 (keratinocyte 차별화 매체 1). 혼합 Dulbecco의 수정이 글의 중간 (DMEM) / 2% 태아 둔감 한 혈 청 (FBS), 0.3 m m o l/L L-아 스 코르 빈 산, 5 μ g/mL 인슐린, 그리고 24 µ g/mL 아데닌과 F12 매체 (3:1).
    2. KDM2 준비 (keratinocyte 차별화 중간 2). 혼합 정의 keratinocyte 중간 혈 청 무료 ( 재료의 표참조)와 0.3 m m o l/l L-아 스 코르 빈 산, 5 μ g/mL 인슐린, 10 μ g/mL 아데닌.
      참고: 정의 된 keratinocyte 혈 청 자유로운 매체 성장과 keratinocytes의 확장을 지원 하기 위해 최적화 되어 있습니다.
    3. KDM3 준비 (keratinocyte 차별화 매체 3). 혼합 정의 keratinocyte 혈 청 무료 매체 그리고 keratinocyte 혈 청 무료 매체 (1:1) 대 한 자세한 내용은 테이블의 자료 를 참조 하십시오.
      참고: Keratinocyte 혈 청 자유로운 매체의 성장 및 keratinocytes의 유지 보수에 대 한 최적화 됩니다.
    4. FDM1 준비 (구와 차별화 매체 1). 5 %FBS, 5 μ g/mL 인슐린, 0.18 m m 아데닌 그리고 10 ng/mL 표 피 성장 인자 (EGF)와 함께 믹스 DMEM/F12 매체 (3:1).
    5. FDM2 준비 (구와 차별화 중간 2). 5%와 1 %FBS 불필요 한 아미노산 믹스 DMEM/F12 매체 (1:1).
    6. EP1 준비 (상피 매체 1). 믹스 DMEM/F12 (3:1)와 4 mM L-글루타민, 40 μ M 아데닌, 10 μ g/mL 올려진다, 10 μ g/mL 인슐린, 0.1 %FBS.
    7. EP2 준비 (상피 중간 2). EP1 1.8 m m 염화 칼슘을 믹스.
    8. E p 3를 준비 (상피 매체 3, cornification 매체). 믹스 F12 매체와 4 mM L-글루타민, 40 μ M 아데닌, 10 μ g/mL 올려진다, 10 μ g/mL 인슐린, 2 %FBS, 1.8 m m 칼슘 염화 물.
  2. 배아 바디 생성
    1. CBMC-Ipsc 이전 연구12에 표시 된 프로토콜을 사용 하 여 생성 합니다.
    2. 문화 요리, vitronectin를 사용 하 여 코트. 100 mm 접시 코트 5 mL를 준비 합니다.
      1. 해 동 및 50 μ 0.5 mg/mL vitronectin의 resuspend (최종 농도: 5 µ g/mL) 5 mL의 멸 균 인산 염 버퍼 식 염 수 (PBS)와 함께. 요리에 솔루션을 추가 하 고 1 h. Aspirate 사용 (건조 안) 하기 전에 코팅 소재에 대 한 실 온 (RT)에서 품 어.
    3. CBMC 파생 Ipsc vitronectin 코팅 100 mm 접시 10% CO2와 37 ° C에서 매일 iPSC 매체 (E8)를 변경 유지.
    4. 미 발달 기관 (EBs) (설명 간단히 다음과 같이) 이전 연구15 에 표시 된 프로토콜을 사용 하 여 생성 합니다. Ipsc 셀 80% 합류에 도달 될 때까지 매체를 변경 하 여 확장 합니다. 80% 합류에 매체를 제거 하 고 PBS로 세척 합니다.
    5. 셀 1 m m ethylenediaminetetraacetic 산 (EDTA)의 1 mL을 처리 합니다. 5% CO2 2 분 동안 37 ° C에서 품 어 그리고 E8 매체의 3 mL를 사용 하 여 셀을 수확. 250 x g 2 분 동안에 세포 원심
    6. 상쾌한 발음을 E8 매체의 5 mL는 셀에 적용 됩니다. hemocytometer를 사용 하 여 셀을 계산 하 고 새로운 15 mL 원뿔 튜브에 1 x 106 셀을 전송. 250 x g 2 분 동안에 세포 원심
    7. 10 μ M로 관련 된 키 (바위) 억제제와 EB 대형 매체의 2.5 mL로 전송 된 셀 resuspend 1 x 104 의 세포 (25 µ L/드롭) 10-100 μ 멀티 채널 피 펫을 사용 하 여 noncoated 문화 접시 뚜껑에 드롭. 1 x 106 셀 (1 x 104 셀/1 EB)에서 양식 100 EBs. 접시를 뒤집어 놓고 뚜껑은 방울에 걸어.
      참고: 락 억제제 단계에서 첨부 파일의 유지와 분화 과정에서 필요 합니다. EB 집계 단계에만 록 억제제를 추가 합니다.
    8. 1 일 5% CO2 와 37 ° C에서 물방울을 품 어.
    9. 다음 날, 수확 100 EBs 차별화에 대 한 그들을 사용 하 여. IPSC 매체 (E8 매체) 또는 PBS를 가진 접시의 뚜껑을 세척 하 고 그 내용을 50 mL 원뿔 튜브에 수확. 그들을 정착 1 분 RT에 EBs를 유지 합니다. 발음은 상쾌한, E8 매체와 EBs resuspend 고 분화까지 90 mm 페 트리 접시에에서 그들을 유지 합니다.
  3. Keratinocytes로 CBMC Ipsc의 차별화
    참고: CBMC Ipsc에서 keratinocyte 차별화의 체계, 그림 1A를 참조 하십시오.
    1. 베스트 100 EBs iPSC 매체 또는 PBS 50 mL 원뿔 튜브를. RT EBs 정착 1 분 동안에 유지 합니다. 그들은 정착 원뿔 튜브의 하단에 다는 것을 확인 하십시오. 발음은 상쾌한 고 E8 매체 1 ng/mL 뼈 morphogenetic 단백질 4 (BMP4)와 EBs를 resuspend. EBs 90 mm 페 트리 접시에 전송 하 고 1 일 5% CO2 와 37 ° C에서 그들을 유지 합니다.
    2. 문화 요리, 유형 IV 교원 질을 사용 하 여 코트. 유형 IV 콜라겐 100 mm 접시를 코트의 5 mL을 준비 합니다.
      1. 해 동 및 유형 IV 콜라겐 솔루션 resuspend (최종 농도: 50 µ g/mL) 0.05 N HCl. 요리에 솔루션을 추가 그리고 1 헤에 대 한 RT에서 품 어와 발음 사용 (건조 안) 하기 전에 코팅 소재.
        참고: 격판덮개를 사용 하기 전에 설거지 3 x 어떤 산을 제거 하는 PBS.
    3. EBs (단계 1.3.1) 50 mL 원뿔 튜브를 수확 하 고 그들을 정착 1 분 RT에서 그들을 유지 하는 것. 그들은 원뿔 튜브의 하단에 정착, 상쾌한, 발음 및 10 µ M 바위 억제제와 KDM1의 6 ml에서 EBs resuspend 다는 것을 확인 하십시오. 유형 IV 콜라겐 코팅 100 mm 접시에는 EBs를 전송 합니다.
      참고: EB 첨부 파일 단계에서만 록 억제제를 추가 합니다.
    4. 0-8 일 사이 매체 매일 KDM1 3 µ M retinoic 산 (RA)와 25 ng/mL 각 BMP4와 EGF의 변경. EBs 5% CO2와 37 ° C에서 유지 합니다.
    5. 9-12 일 사이 변경 매체 매일 20 ng/mL EGF와 3 µ M RA, 25 ng/mL BMP4, KDM2.
    6. 13-30 일 사이 변경 매체 매일 KDM3 10 ng/mL BMP4와 20 ng/mL EGF.
  4. 섬유 아 세포에 CBMC iPSC의 차별화
    참고: CBMC Ipsc에서 구와 차별화의 체계에 대 한 그림 2A를 참조 하십시오.
    1. 문화 요리, 지하실 멤브레인 매트릭스를 사용 하 여 코트. 100 mm 접시 코트 5 mL를 준비 합니다.
      1. 지하실 막 매트릭스를 녹여 (최종 농도: 600 ng/mL) DMEM/F12 매체와 그것을 희석. 요리에 솔루션을 추가 하 고 30 분 Aspirate 사용 (건조 안) 하기 전에 코팅 소재에 대 한 37 ° C에서 품 어.
    2. 베스트 100 EBs iPSC 매체 또는 PBS를 피 펫을 사용 하 여 50 mL 원뿔 튜브를. RT EBs 정착 1 분 동안에 유지 합니다. 그들은 정착 원뿔 튜브의 하단에 확인 하십시오. 제거는 상쾌한.
    3. 10 µ M 바위 억제제와 FDM1의 6 mL에 1000 µ L 피 펫을 사용 하 여 EBs resuspend (매체)와 EBs 지하실 멤브레인 매트릭스 코팅 100 mm 접시에 전송 하 고 5% CO2와 37 ° C에서 품 어. 3 일 동안 매일은 FDM1를 새로 고칩니다.
      참고: EB 첨부 파일 단계에서만 록 억제제를 추가 합니다.
    4. 일 4와 6 사이 FDM1를 0.5 nM 뼈 morphogenetic 단백질 4 (BMP 4)을 추가 합니다.
    5. 7 일에 매체를 변경 FDM2 1 주 동안 매일.
    6. 14 일에 1 mM EDTA의 1 mL을 추가 하 고 2 분 2 분은 상쾌한 제거 하 고 resuspend FDM1의 5 mL에 셀 셀 FDM2 및 250 x g 에서 원심 분리기의 3 mL을 수확을 위해 5% CO2 와 37 ° C에서 품 어.
    7. hemocytometer를 사용 하 여 셀의 개수, 2 x 106 셀 FDM1 매체, resuspend 그리고 noncoated 접시를 셀을 전송. 5% CO2 와 37 ° C에서 세포를 유지 하 고 매일 매체를 변경.
    8. 코트 문화 요리를 사용 하 여 나에 게 콜라겐을 입력 합니다. 100 mm 접시 코트 5 mL를 준비 합니다. 희석 유형 I 교원 질 솔루션 (최종 농도: 50 µ g/mL) 0.02 N 초 산에. 요리에 솔루션을 추가 하 고 1 h. Aspirate 사용 (건조 안) 하기 전에 코팅 소재에 대 한 RT에서 품 어.
      참고: 격판덮개를 사용 하기 전에 설거지 3 산 제거에 PBS 가진 x.
    9. 21 일에 1 mM EDTA의 1 mL을 추가 하 고 2 분 2 분은 상쾌한 제거 하 고 resuspend FDM1의 5 mL에 셀 셀 FDM1 및 250 x g 에서 원심 분리기의 3 mL을 수확을 위해 5% CO2 와 37 ° C에서 품 어. 수 hemocytometer 및 전송 사용 하 여 셀 2 x 106 세포 종류에 내가 FDM1 매체와 콜라겐 코팅 100 mm 접시입니다. 5% CO2 와 37 ° C에서 세포를 유지 하 고 매일 매체를 변경.
    10. 28 일에 1 mM EDTA의 1 mL을 추가 하 고 2 분 2 분은 상쾌한 제거 하 고 resuspend FDM1의 5 mL에 셀 셀 FDM1 및 250 x g 에서 원심 분리기의 3 mL을 수확을 위해 5% CO2 와 37 ° C에서 품 어. hemocytometer를 사용 하 여 셀의 개수와 FDM1 매체와 noncoated 접시 2 x 106 셀을 전송. 셀 5% CO2 와 37 ° C에서 유지 하 고 매일 매체를 변경.
      참고: iPSC 파생 된 섬유 아 세포 증식 주된 fibroblast 세포 선 및 10 구절까지 통로 처럼. 이 연구에서 우리는 추가 분석을 위해 iPSC 파생 2 ~ 5 구절의 섬유 아 세포를 사용.

2. 차별화 된 셀 hiPSC 파생 응용

  1. 3D 피부 organoid의 세대
    1. 중화 유형 준비 나 얼음, 콜라겐 제조 업체의 권장 사항에 따라. 최종 농도 3 mg/mL 사용 하 여 유형 I 교원 질에 대 한 (재고 농도의 유형 I 교원 질은 3.47 mg/mL), 혼합물의 최종 볼륨 5 mL 확인. 10 x PBS의 볼륨 계산 (최종 볼륨/10 = 0.5 mL). 계산 볼륨의 유형 I 사용 될 콜라겐 (최종 콜라겐 농도 x 최종 볼륨 / 콜라겐 농도 주가 5 mL x 3 mg/mL = / 3.47 mg/mL = 4.32 mL). 계산 1 N NaOH의 볼륨 (사용 되는 콜라겐의 볼륨 0.023 mL = 0.1 mL x). DH2O의 볼륨 계산 (10 x PBS-1 N NaOH의 볼륨의 최종 볼륨-콜라겐의 볼륨-볼륨 5-4.32 mL-0.5 mL 0.1 mL = 0.08 mL =). 튜브의 내용을 혼합 하 고 사용할 준비가 될 때까지 얼음에 그것을 유지.
    2. 단계의 1.4.10 iPSC 파생 fibroblasts에 EDTA의 1 mL을 추가 하 고 2 분 분리 된 세포를 수확, hemocytometer를 사용 하 여 셀의 개수 및 새로운 15 mL 원뿔 튜브에 2 x 105 셀을 전송 5% CO2 와 37 ° C에서 품 어. 250 x g 2 분에 centrifuge 고는 상쾌한을 제거 합니다. Resuspend FDM1의 1.5 ml에서 iPSC 파생 된 섬유 아 세포의 세포와 무력화는 유형 나 콜라겐 솔루션 (1:1).
      참고: 부드럽게 거품을 피하기 위해 해결책 혼합.
    3. 막 삽입 6 잘 microplate에, 삽입, 혼합물을 전송 놓고 30 분 동안 RT에서 품 어.
      참고: 격판덮개를 이동 하지 마십시오.
    4. 겔 화를 확인 한 후 삽입 및 우물의 바닥에 3 mL의 상단 중간의 2 개 mL를 추가 합니다. 5-7 일는 겔 화 완료 될 때까지, 더 이상 계약에 대 한 섬유 아 세포와 콜라겐 5% CO2 와 37 ° C에서의 매트릭스를 품 어.
    5. 완전 한 겔 화 후 분리 (단계 1.3.6)에서 iPSC 파생 keratinocytes EDTA를 사용 하 여. EDTA의 1 mL을 추가 하 고 2 분 분리 된 세포를 수확, hemocytometer를 사용 하 여 계산 하 고 새로운 15 mL 원뿔 튜브에 1 x 106 셀을 전송 5% CO2 와 37 ° C에서 품 어. 2 분 동안 250 x g 에서 원심 분리기.
    6. 상쾌한을 제거 하 고 낮은 칼슘 상피 매체 1 (EP1)의 50-100 µ L에 1 x 106 셀 resuspend.
    7. 행렬에서 모든 매체를 발음 (단계 2.1.5 참조) 및 1 x 106 세포 각 구와 레이어에 iPSC 파생 keratinocytes의 씨앗. 5% CO2 30 분 동안 37 ° C에서 접시를 품 어.
      참고: 접시를 이동 하지 마십시오 그리고 keratinocyte의 첨부 파일에 대 한 모든 매체를 추가 하지 마십시오.
    8. 삽입의 상단을 우물의 바닥에 EP1의 3 mL EP1의 2 개 mL를 추가 합니다.
    9. 2 일 후 막 삽입 격판덮개에서 모든 매체를 발음 하 고 2 일 동안 정상적인 칼슘 EP2 매체를 변경 합니다.
    10. 2 일 후, 모든 매체를 발음 하 고는 공기 액체 인터페이스 생성 하 하단에만 cornification 매체의 3 mL를 추가 합니다.
    11. 3D 피부 organoid 5% CO2 와 37 ° C에서 최대 14 일 동안 유지 하 고 매일 매체를 변경. 3D 피부 organoid 삽입, 가장자리를 절단 하 여 수확 하 고 그것을 사용 하 여 얼룩 및 피부 이식의 추가 연구에 대 한.
  2. 피부 이식
    1. 끄 덕/scid 쥐 (남성, 6 주 이전)에 흡입 마 취를 수행, 표준, 제도 승인 된 방법을 사용 하 여. 피부 이식, 각 마우스의 등 쪽 피부 모피를 면도.
    2. 마우스의 피부, 곡선된가 위를 사용 하 여 집게와 1 cm x 2 cm 섹션을 제거 합니다.
    3. CBMC iPSC 파생 3D 피부 organoid를 결함 사이트와 실크 봉합 넥타이 위에 드레싱 메서드를 사용 하 여 봉합에 놓습니다.
    4. 2 주 동안 생쥐를 관찰 하 고 조직학 분석을 위해 그들을 희생. 얼룩 프로토콜은 이전 연구16에 확인 했다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

피부는 표 피와 진 피, 대부분의 경우, 구성 됩니다. Keratinocytes는 주요 세포 유형의 표 피, 고 섬유 아 세포는 진 피의 주요 셀 형식. Keratinocyte 차별화의 체계는 그림 1에 표시 됩니다. CBMC iPCSc vitronectin 코팅 접시 (그림 1B)에 유지 되었다. 이 연구에서 우리가 EB 형성을 사용 하 여 섬유 아 세포와 keratinocytes CBMC Ipsc 분화. EBs는 교수형을 사용 하 여 생성 메서드 keratinocytes 및 섬유 아 세포 (그림 1C)의 균일 하 고 제어 차별화를 드롭. EBs 4 콜라겐 코팅 판 keratinocyte 차별화에 대 한 입력에 연결 된 그리고 매체 매일 변경 되었습니다. CBMC Ipsc RA, BMP4, EGF와 치료 했다. CBMC Ipsc keratinocytes를 분화 되었다. 차별화, 동안 CBMC iPSC 파생 keratinocytes의 형태 (보충 그림 1) 시간이 지남에 변경.

CBMC iPSC 파생 keratinocytes가 있다 형태학 기본 keratinocytes (그림 1D)와 비슷합니다. 만능 마커의 OCT4 유전자 발현 downregulated CBMC iPSC 파생 keratinocytes에서 했다. 뇌관 순서는 표 1에 나와 있습니다. Keratinocyte 마커 Np63, KRT5, 및 KRT14의 식 CBMC iPSC 파생 keratinocytes (그림 1F)에 증가 되었다. CBMC iPSC 파생 keratinocytes immunohistochemistry (그림 1E)에 의해 Np63와 KRT14의 식에 의해 확인 되었다. 이러한 결과 CBMC iPSC 파생 keratinocytes 기본 keratinocytes의 특성을가지고 확인.

구와 차별화의 구조는 그림 2A에 표시 됩니다. 우리는 또한 CBMC-Ipsc vitronectin 코팅 접시에 유지 하 고 EB 형성 구와 차별화 (그림 2B, C)에 대 한 사용. 우리는 지하실 멤브레인 매트릭스 코팅 접시에 EBs를 연결 하 고 매일 매체를 변경. 결과 셀을 noncoated 전송 하 고 유형 I 교원 질 코팅 판. CBMC Ipsc는 섬유 아 세포로 분화 되었다. 차별화, 동안 CBMC iPSC 파생 된 섬유 아 세포의 형태학 (보충 그림 2) 시간이 지남에 변경.

CBMC iPSC 파생 fibroblasts 있다 형태학 기본 섬유 아 세포 (그림 2D)와 비슷합니다. 만능 줄기 세포 표식 OCT4 표현의 downregulated CBMC iPSC 파생 fibroblasts에 했다. 섬유 마커 COL1A1, COL1A2, COL3A1, 및 CD44 upregulated CBMC iPSC 파생 된 섬유 아 세포 (그림 2F)에서 했다. 뇌관 순서는 표 1에 나와 있습니다. 또한, CBMC iPSC 파생 fibroblasts immunohistochemistry (그림 2E) vimentin 및 fibronectin의 식에 의해 확인 되었다. 이 결과 제안 CBMC iPSC 파생 fibroblasts 기본 섬유 아 세포와 비슷합니다.

3D 피부 organoid CBMC iPSC 파생 keratinocytes 섬유 아 세포를 사용 하 여 생성 되었습니다. 3D 피부 organoid의 형성의 구조는 그림 3A에 표시 됩니다. 3D 피부 organoid 막 삽입 격판덮개에 생성 되었습니다. CBMC iPSC 파생 fibroblasts 했다 3D 문화에 대 한 층 화 유형 나 교원 질과 CBMC iPSC 파생 keratinocytes 입혔다. CBMC iPSC 파생 keratinocytes 시드 후 매체는 2 일 동안 정상 칼슘 농도에 변경 되었습니다. 2 일 후, 높은 칼슘 농도 매체는 공기 액체 인터페이스 문화 형성에 대 한 낮은 챔버에만 추가 되었습니다. 공기 액체 인터페이스 문화 성숙 및 층 리는 keratinocytes의 유도. 3D 피부 organoid의 두께 3D 문화 동안 증가 되었다. 이러한 결과 hematoxylin와 오신 (H & E) 얼룩 (그림 3C) 3D 피부 organoid iPSC 파생 keratinocytes 및 섬유 아 세포에서 생성 된 확인.

CBMC iPSC 파생 3D 피부 organoid 사용 하 여, 3D 피부 organoid 쥐를 접목 하 여 인간 답게 마우스 모델 (그림 3B) 생성 되었습니다. 1 cm x 2 cm 결함 유도 되었다, 그리고 넥타이 조치 방법은 이식에 사용 되었다. 2 주 후, 이식된 피부 마우스, 효율적으로 투입 했다 그리고 우리 H & E와 immunocytochemical 분석 (그림 3D) 하 여 이것을 확인 했다. Keratinocyte 성숙과 loricrin와 KRT14의 표 피 분화 마커 CBMC iPSC 파생 3D 피부 organoids (그림 3E)에서 표현 되었다. CBMC iPSC 파생 3D 피부 organoids 기능적으로 분화 했다, 마우스에 효율적으로 융합 하 고 쥐 피부 결점을 효과적으로 치료.

Figure 1
그림 1 : CBMC Ipsc의 Keratinocyte 차별화. CBMC Ipsc에서 keratinocyte 차별화의 (A) 체계. (BC)는 CBMC-Ipsc (패널 B) 및 iPSC 파생 EBs (패널 C)의 형태. CBMC iPSC 파생 keratinocytes의의 (D) 형태로 (E) Np63 (적색) 및 KRT14 (녹색), (파란색) 얼룩 DAPI 함께 Immunocytochemical 분석. 스케일 바 = 100 μ m. (F) 만능 마커 및 keratinocyte 마커 iPSC 파생 keratinocytes (iPSC-Ks)의 유전자 발현. 그래프 5 개의 독립적인 샘플의 SEM와 뜻을 보여줍니다. 그룹 간의 차이 학생의 t를 사용 하 여 통계적 의미에 대 한 조사 됐다-테스트. T-테스트 비패라메트릭 양적 데이터 집합 및 단측 p분석에 적용 되었다-값 계산 (*p < 0.05 * *p < 0.01, * * *p < 0.001 통계적 의미를 표시). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : CBMC Ipsc의 구와 차별화. CBMC Ipsc에서 구와 차별화의 (A) 체계. (BC)는 CBMC-Ipsc (패널 B) 및 iPSC 파생 EBs (패널 C)의 형태. CBMC iPSC 파생 된 섬유 아 세포의의 (D) 형태로 (E) vimentin (적색) 및 fibronectin (빨간색), DAPI 얼룩 (파란색)와 함께 Immunocytochemical 분석. 스케일 바 = 100 μ m. (F) 만능 마커 및 iPSC 파생 섬유 (iPSC-Fs)의 섬유 마커 유전자 발현. 그래프 5 개의 독립적인 샘플의 SEM와 뜻을 보여줍니다. 그룹 간의 차이 학생의 t를 사용 하 여 통계적 의미에 대 한 조사 됐다-테스트. T-테스트 비패라메트릭 양적 데이터 집합 및 단측 p분석에 적용 되었다-값 계산 (*p < 0.05 * *p < 0.01, * * *p < 0.001 통계적 의미를 표시). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : CBMC iPSC 파생 피부 organoid 및 인간 답게 된 마우스 모델의 생성. (A)는 iPSC 파생 피부 organoid (iSO) 생성 프로세스의 회로도. (B) 이식 마우스에 iSO의 프로세스. (C) 생체 외에서 iSO의 조직학 분석. (D) vivo에서 이식된 iSO의 조직학 분석. (E-H) Loricrin와 KRT14의 Immunocytochemical 분석입니다. 컨트롤 (패널 E), 이식된 iSO (패널 F, loricrin), 쥐 피부 (부정적인 컨트롤, 패널 G), 이식된 iSO (패널 H, KRT14)을 조롱. 스케일 바 = 200 μ m. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Supplementary Figure 1
보충 그림 1: iPSC 파생 keratinocytes의 형태. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Supplementary Figure 2
보충 그림 2: iPSC 파생 된 섬유 아 세포의 형태학. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

대상 이름 방향 뇌관 순서 (5'-3') 크기 (기본적인 쌍) Refseq_ID
OCT4 앞으로
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 앞으로
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 앞으로
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 앞으로
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 앞으로
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 앞으로
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 앞으로
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 앞으로
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 앞으로
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 앞으로
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin 앞으로
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH 앞으로
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

표 1: 정량 실시간 중 합 효소 연쇄 반응에 사용 되는 뇌관의 시퀀스입니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

인간의 Ipsc 맞춤된 재생 의료17에 대 한 새로운 대안 제안 되어 있다. 맞춤된 Ipsc 환자 파생 질병 모델링, 약물 검사, 및 자가 이식18,19사용할 수 있는 환자 특성을 반영 합니다. 환자 파생 Ipsc의 사용 또한 1 차 셀, 적절 한 셀 숫자 및 면역 반응5,,1719의 부족에 관한 문제를 극복할 수 있다. 그러나, 맞춤된 Ipsc의 경제적으로 실현 가능한 시간, 비용, 및 노동 제한 되지 않습니다. HLA homozygous CBMC 파생 Ipsc는 새로운 가능성으로 떠오르고 있다. HLA homozygous Ipsc 경제적으로 귀중 한 될 수 있으며 환자8,11,,1213의 많은에 적용할 수 있습니다. 또한, CBMCs의 HLA 타이핑 함으로써 그들 연구와 이식에 대 한 사용 하기 쉬운 세포 은행 보관 중 발생 합니다. Cardiomyocytes, hepatocytes, 그리고 chondrocytes CBMC Ipsc를 차별화 하는 프로토콜 되었습니다16,20,21,,2223을 보고.

표 피 및 진 레이어는 피부 구성 요소. 표 피 keratinocytes 이루어져 있고 진 피 섬유 아 세포의 구성 됩니다. 그래서, 우리 분화 CBMC Ipsc keratinocytes와 섬유 아 세포, 각각. 차별화, 제복, 잘 제어 및 최적화 된 EBs 교수형에 의해 생성 된 방법15,24드롭. 유형 IV 교원 질 지하실 막의 주요 구성 요소입니다. Keratinocyte 차별화, EBs IV 콜라겐 코팅 요리 입력에 붙어 있었다. CBMC iPSC 파생 keratinocytes 조약돌 모양의 형태 (그림 1D) 했다. Keratinocyte 마커 Np63 및 KRT14는 iPSC-Ks (그림 1E, F)에 표현 되었다. 그 결과 라스와 BMP4 유도 keratinocyte 마커의 upregulation 확인. 또한, CBMC Ipsc keratinocytes 기본 keratinocytes 비슷합니다으로 분화 되었다.

구와 차별화, EBs는 지하실 멤브레인 매트릭스 코팅 판에 연결 된 및 차별화 된 셀 직렬로 했다 noncoated에 passaged 및 유형 I 교원 질 코팅 판. 직렬 하위 지정 구와 차별화를 유도 했다. 섬유 아 세포는 세포 외 기질 (ECM) 마이그레이션 및 접착 기능을 제작. 섬유 아 세포는 또한 풍부한 콜라겐 구성 요소25를 생산. CBMC iPSC 파생 된 섬유 아 세포, 섬유 아 세포 표면 마커 CD44 증가 되었다. 콜라겐의 표현 upregulated iPSC-Fs (그림 2F)에서 했다. Fibronectin과 vimentin 식 iPSC-Fs (그림 2E)에 증가 되었다.

차별화 된 keratinocytes 및 섬유 아 세포를 사용 하 여, CBMC iPSC 파생 피부 organoids (그림 3A)를 생성 했습니다. 우리는 CBMC iPSC 파생 피부 organoids의 층 화 층 유도 높은 칼슘 매체와 공기-액체 인터페이스 문화를 사용 합니다. 칼슘의 고 농도 공기 액체 인터페이스 다층된 지층26,,2728를 개발 하는 데 사용 되었다 vivo에서 그리고 생체 외에서, keratinocyte 성숙에 대 한 필요 했다. 우리는 진짜 피부 및 조직학 분석 피부 층 화 되었다 보여주었다 (그림 3C) 모방을이 방법을 사용. 상처 치유 능력을 확인, 우리 이식 iSO 쥐 피부에 넥타이 위에 드레싱 방법 (그림 3D)을 사용 하 여. 이식, 후 피부 organoids 효율적으로 투입 했다 하 고 적절 하 게 쥐 피부를 치료. KRT14는 epithelia 편평 하 고 nonsquamous stratifying의 기초 층에 표현 했다. Loricrin은 말기에 발견 지층 corneum의 주요 구성 요소 분화 상피 세포29,30keratinized. Loricrin의 표 피 분화 마커 이식된 피부에 표현 했다. KRT14 및 loricrin의 식 확인 피부 organoid 완전히 성숙 했다 차별화 immunohistochemical 얼룩 (그림 3E)에 의해 입증 되었다.

이 연구에서 우리는 CBMC Ipsc keratinocytes 및 섬유 아 세포, 인간의 피부의 주요 세포 유형으로 차별화 하는 프로토콜을 개발 했다. 우리는 섬유 아 세포와 keratinocytes CBMC iPSC 파생 보여 고기 비슷한 1 차 셀 라인을 확인 했다. 이러한 차별화 된 셀을 사용 하 여, 우리는 3 차원 피부 organoid를 생성 하 고 넥타이 위에 드레싱 메서드를 사용 하 여 끄 덕/scid 쥐에 투입. 이 원래 기술은 블레어와 브라운에 의해 1929 년에 처음으로 설명 했다 그리고 일반적으로 피부 이식31,32사용 되었습니다. 이 메서드는 이동에서 이식 방해 하 고, 상처에 좋은 접착을 선호 고 따라서 조직 치유를 가속. 조직학 분석 확인 3D 피부 organoid 성공적으로 층 화 하 고 2 주 동안 성숙 된 인간 피부 표현 형 유사. 피부 이식 실리콘 거품 약 실33,34에 의해 수행 일반적으로 섬유 아 세포와 keratinocytes의 단일 셀을 사용 하 여. 이 시스템 이식 하기 쉽습니다 하지만 우리는 이식 후 이식 효율을 관찰에 대 한 더 많은 시간이 필요. 플라스틱 또는 실리콘 챔버 쥐의 피부에 대 한 장벽으로 작용 한다. 3D 피부 organoid 시스템 파생 Ipsc 플라스틱 또는 실리콘 챔버를 사용 하지 마십시오. 이 시스템에서 이식 된 효율적인; 그러나, 그것은 쥐의 자연 치유 과정을 차단 하기 어려웠다. 그래서, 쥐의 피부 이식 후 오랜 시간에 대 한 iSO의 많은 부분을 커버. 이것은 여기에 제시 된 향상 되어야 하는 방법의 일부입니다.

결론적으로, CBMC Ipsc는 피부 이식 술에 대 한 잠재적인 셀 소스입니다. 이러한 프로토콜, CBMC iPSC 파생 keratinocytes를 사용 하 여, 피부과, 약 및 화장품 심사 및 재생 의학 관련 연구에서 섬유 아 세포, 그리고 3D 피부 organoid을 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품은 건강, 복지 및 가족 업무, 한국 공화국 (H16C2177, H18C1178)에 대 한 한국 의료 기술 R & D 프로젝트, 정부에서 교부 금에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics