דור של תא צורב עור תלת-ממד של כבל דם-derived המושרה בתאי גזע Pluripotent

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

אנו מציעים פרוטוקול זה מראה כיצד להבדיל keratinocytes נגזר תאי גזע pluripotent המושרה ו fibroblasts וליצור תא צורב של העור תלת-ממד באמצעות אלה keratinocytes ו fibroblasts. פרוטוקול זה מכיל צעד נוסף של יצירת מודל humanized עכברים. הטכניקה המובאת כאן תשפר את המחקר דרמטולוגית.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

העור הוא האיבר הגדול ביותר בגוף, יש פונקציות רבות. העור משמש מחסום פיסי, מגן על הגוף, מווסת את התפקודים הגופניים. ביומימטיקה היא החיקוי של דגמים, מערכות ורכיבים של הטבע לצורך פתרון בעיות אנושיות מורכבות1. ביומימטיקה העור הוא כלי שימושי עבור רפואה רגנרטיבית ויוו ומחקר במחלה במבחנה. תאי גזע pluripotent המושרה אנושי (iPSCs) יש על מאפייני התפשטות ללא הגבלה את היכולת של בידול שלוש שכבות הנבט. IPSCs האנושי נוצרים מתאי ראשי שונים, כגון תאי דם, keratinocytes, fibroblasts ועוד. ביניהם, כבל תאי תאי דם (CBMCs) הופיעו כמקור חלופי תא מנקודת המבט של רפואה רגנרטיבית allogeneic. CBMCs הם שימושי רפואה רגנרטיבית כי הקלדת אנטיגן (הלע) לויקוציטים אנושיים חיוני לתא מערכת בנקאות. אנו מספקים שיטה את הבידול של CBMC-iPSCs לתוך keratinocytes ו fibroblasts ועל הדור של תא צורב העור תלת-ממד. Keratinocytes CBMC iPSC-נגזר fibroblasts יש מאפיינים דומים לקו התא הראשי. Organoids העור תלת-ממד נוצרות על-ידי השלכת של שיכבת אל שכבת הדרמיס. מאת משתילים תא צורב את העור תלת-ממד, נוצר מודל humanized עכברים. מחקר זה מראה כי תא צורב תלת-ממד עור האדם הנגזרות iPSC עשוי להיות כלי הרומן חלופי למחקר דרמטולוגית במבחנה, ויוו.

Introduction

העור המכסה את פני השטח החיצוני של הגוף ומגנה על האיברים הפנימיים. לעור יש פונקציות שונות, כולל הגנה מפני פתוגנים, קליטת ואחסון מים, לווסת את טמפרטורת הגוף, הגוף מפריש לבזבז2. שתלי העור יכולים להיות מסווגים בהתאם לסוג מקור העור; שתלי באמצעות העור עוד תורם מכונים allografts, שתלי העור של המטופל באמצעות autografts. למרות בשתל הטיפול המועדפת עקב סיכון נמוך הדחייה שלה, ביופסיות עור קשים לביצוע על חולים עם פצעים חמורים או מספר לא מספיק של תאי העור. בחולים עם כוויות חמורות, שלוש פעמים את מספר תאי העור נחוצים לכסות שטחים גדולים. המוגבל של תאי עור מגופו של החולה תוצאות במצבים איפה השתלת allogenous הכרחי. יודע משמש באופן זמני עד עצמיים השתלת יכול להתבצע מאז היא בדרך כלל נדחית על ידי המערכת החיסונית של המחשב המארח לאחר כ שבוע 13. כדי להתגבר על דחייה על ידי המערכת החיסונית של החולה, שתלי חייב לבוא ממקור עם זהות המערכת החיסונית אותו כמו החולה4.

IPSCs האנושי הם מקור המתעוררים של תאים עבור טיפול בתאי גזע5. IPSCs האנושי נוצרים תאים סומטיים, באמצעות גורמים התיכנות כגון OCT4, SOX2, Klf4 ו- c-Myc6. שימוש iPSCs האדם מתגבר על בעיות אתיות ו של תאי גזע עובריים (ESCs)7,8. IPSCs האנושי יש pluripotency, יכולים להתמיין שלוש שכבות הנבט9. הנוכחות של הלע, גורם קריטי רפואה רגנרטיבית, קובע את התגובה החיסונית ועל האפשרות של דחיית10. השימוש של החולה, נגזר iPSCs פותר הבעיות של התא-מקור דחייה הגבלה ואת המערכת החיסונית. CBMCs הופיעו גם כמקור תא חלופי עבור רפואה רגנרטיבית11. הלע חובה להקליד, אשר מתרחש במהלך CBMC בנקאות, יכול לשמש בקלות עבור מחקר והשתלות. IPSCs הלע-סוג נוסף, homozygous נרחב ניתן להחיל על מטופלים שונים12. בנק CBMC-iPSC הוא רומן, אסטרטגיה יעילה עבור טיפול בתאי ו רפואה רגנרטיבית allogenic12,13,14. במחקר זה, אנו משתמשים CBMC-iPSCs, הבדיל keratinocytes ו fibroblasts, וצור שכבות העור 3D מרובדת. תוצאות של מחקר זה מציע כי תא צורב CBMC iPSC-נגזר עור תלת-ממד הוא כלי הרומן למחקר דרמטולוגית במבחנה, ויוו.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

בכל ההליכים הכרוכים חיות בוצעו על פי חוק רווחת חיות מעבדה, המדריך הטיפול ואת השימוש של חיות מעבדה, וסיפק הנחיות ומדיניות לניסויים מכרסם אכפת חיה מוסדיים ו השתמש הוועד (IACUC) של בית הספר לרפואה של האוניברסיטה הקתולית של קוריאה. פרוטוקול המחקר אושרה על ידי ועדת הבדיקה המוסדי של האוניברסיטה הקתולית קוריאה (CUMC-2018-0191-01). את IACUC, את המחלקה של מעבדה חיות (מפתיעה אותנו) של האוניברסיטה הקתולית של קוריאה, Songeui קמפוס מוכר המתקן מעבדה חיה מצוינות קוריאה של מינהל התרופות והמזון קוריאה בשיתוף 2017, רכשה להערכת ו הסמכה של הסמכה מלאה הבינלאומי הבינלאומי אכפת לי חיית מעבדה (AAALAC) ב-2018.

1. עור תאית התמיינות של תאי גזע pluripotent המושרה

  1. הכנה בינונית
    הערה: לאחסן כל בינוני ב 4 ° C בסביבת כהה עד 3 חודשים. לסנן כל מדיום באמצעות מערכת סינון polyethersulfone 0.22 μm לפני השימוש עבור עיקור. כל מדיום היה זמין בהנפח הכולל של 500 מ"ל.
    1. הכנת KDM1 (תקין בידול בינוני 1). בינוני (DMEM ששינה הנשר של תערובת Dulbecco) / F12 בינונית (3:1) עם 2% סרום שור עוברית (FBS), חומצה אסקורבית L mmol/L 0.3, 5 μg/mL אינסולין 24 אדנין µg/mL.
    2. הכנת KDM2 (תקין בידול בינוני 2). מיקס מוגדר תקין ללא סרום בינונית (ראה את הטבלה של חומרים) עם חומצה אסקורבית L mmol/l 0.3, 5 μg/mL אינסולין ו אדנין μg/מ"ל.
      הערה: מוגדר תקין ללא סרום בינוני ממוטבת כדי לתמוך את הצמיחה ואת התפשטות keratinocytes.
    3. הכנת KDM3 (תקין בידול בינוני 3). מיקס מוגדר תקין ללא סרום בינוני ולראות תקין ללא סרום בינוני (1:1) את הטבלה של חומרים לפרטים.
      הערה: תקין ללא סרום בינוני ממוטב את הצמיחה ואת התחזוקה של keratinocytes.
    4. הכנת FDM1 (פיברובלסט בידול בינוני 1). מיקס DMEM/F12 בינונית (3:1) עם 5% FBS 5 μg/mL אינסולין, 0.18 מ מ אדנין, גורם הגדילה באפידרמיס (EGF) 10 ng/mL.
    5. הכנת FDM2 (פיברובלסט בידול בינוני 2). מיקס DMEM/F12 בינוני (1:1) עם 5% FBS ו- 1% לא חיוניות חומצות אמינו.
    6. להכין EP1 (אפיתל בינוני 1). מיקס DMEM/F12 (3:1) עם 4 מ מגלוטמין, 40 μM אדנין, 10 transferrin μg/mL, אינסולין μg/מ"ל ו 0.1% FBS.
    7. הכנת EP2 (אפיתל בינוני 2). מערבבים EP1 ו- 1.8 מ מ סידן כלורי.
    8. להכין EP3 (אפיתל בינוני 3, התקרנות בינוני). בינוני F12 לערבב עם 4 מ מגלוטמין, אדנין μM 40, 10 transferrin μg/mL, אינסולין μg/מ"ל, 2% FBS ו- 1.8 מ"מ סידן כלורי.
  2. הגוף עובריים דור
    1. צור משתמש בפרוטוקול שמוצג עם המחקר הקודם12CBMC-iPSCs.
    2. המעיל תרבות מנות, באמצעות vitronectin. להכין 5 מ"ל עד מעיל מנה 100 מ מ.
      1. להפשיר, resuspend 50 μL של 0.5 מ"ג/מ"ל vitronectin (ריכוז הסופי: µg 5/mL) עם 5 מ ל תמיסת סטרילית באגירה פוספט (PBS). הוסף את הפתרון לשטוף הכלים, דגירה בטמפרטורת החדר (RT) עבור ה 1 לשאוב חומר הציפוי לפני השימוש (לא להתייבש).
    3. לשמור iPSCs CBMC, נגזר מצופים vitronectin 100 מ"מ צלחת ולשנות את המדיום iPSC (E8) מדי יום ב 37 ° C עם 10% CO2.
    4. ליצור גופים עובריים (EBs) משתמש בפרוטוקול שמוצג המחקר הקודם15 (יפורט בקצרה כדלקמן). הרחב iPSCs על-ידי שינוי המדיום עד התאים הגיעו למפגש 80%. 80% הנהרות, להסיר את המדיום, לשטוף עם PBS.
    5. פנקו את התאים עם 1 מ"ל של 1 מ מ ethylenediaminetetraacetic חומצה (EDTA). דגירה ב 37 ° C עם 5% CO2 למשך 2 דקות ולקצור את התאים באמצעות 3 מ"ל של מדיום E8. Centrifuge התאים ב x 250 g למשך 2 דקות.
    6. וארוקן את תגובת שיקוע ולהחיל 5 מיליליטר E8 בינוני על התאים. לספור את התאים באמצעות hemocytometer ולהעביר עונה 1 פרק 106 תאים צינור חרוטי 15 מ"ל. Centrifuge התאים ב x 250 g למשך 2 דקות.
    7. Resuspend תאים שהועברו עם 2.5 מ ל EB היווצרות בינוני עם מעכבי קינאז הקשורים רו (רוק) μM 10. ירידה עונה 1 פרק 104 תאים (µL 25/טיפה) על צלחת תרבות noncoated מכסה בעזרת פיפטה רב-ערוצי μL 10 – 100. טופס 100 EBs מתאי6 עונה 1 פרק 10 (1 x 104 תאים/1 EB). . תהפוך את המנה, לשמור המכסה ה-droplet.
      הערה: רוק מעכב נדרש במהלך השלב מצורף בתהליך תחזוקה ובידול. הוסף את המדכא רוק רק בשלב צבירת EB.
    8. דגירה את טיפות ב 37 ° C עם 5% CO2 עבור יום אחד.
    9. למחרת, לקצור את 100 EBs להשתמש בהם עבור בידול. לשטוף את המכסה של צלחת עם iPSC בינונית (E8 בינוני) או PBS ולקצור את תוכנו אל צינור חרוטי 50 מ. לשמור את EBs-RT עבור 1 דקות כדי להרגיע אותם. וארוקן את תגובת שיקוע, resuspend את EBs E8 בינונית- ולתחזק אותם ב- 90 מ מ פטרי עד הבידול.
  3. הבידול של CBMC-iPSCs לתוך keratinocytes
    הערה: עבור ערכה של בידול תקין של CBMC-iPSCs, ראה איור 1א'.
    1. EBs קציר ה-100 ל צינור חרוטי 50 מ עם iPSC בינוני או PBS. שתשמור על RT במשך 1 דקה להתיישב את EBs. ודא כי הם מיישבים בתחתית הצינורית חרוט. וארוקן את תגובת שיקוע, resuspend את EBs E8 בינונית עם 1 ng/mL עצם morphogenetic חלבון 4 (BMP4). להעביר את EBs 90 מ מ פטרי ולתחזק אותם ב 37 ° C עם 5% CO2 עבור יום אחד.
    2. מעיל מנות תרבות, באמצעות קולגן סוג IV. להכין 5 מ של סוג הקולגן הרביעי כדי המעיל מנה 100 מ מ.
      1. להפשיר, resuspend הסוג הרביעי קולגן פתרון (הריכוז הסופי: µg 50/mL) עם 0.05 HCl N. להוסיף את הפתרון הכלים, תקופת דגירה-RT של ח' 1 וארוקן את חומר הציפוי לפני השימוש (לא להתייבש).
        שים לב: לפני השימוש הלוחות, לרחוץ כלים 3 x עם PBS כדי להסיר כל חומצה.
    3. לקצור את EBs (שלב 1.3.1) לרכבת התחתית חרוט 50 מ ל ולתחזק אותם ב RT עבור 1 דקות כדי להרגיע אותם. ודא כי הם ליישב בחלק התחתון של צינור חרוטי, וארוקן את תגובת שיקוע, resuspend את EBs ב 6 מ של KDM1 עם 10 מיקרומטר רוק מעכב. להעביר את EBs המנה מצופים קולגן 100 מ מ מסוג IV.
      הערה: להוסיף את המדכא רוק רק בשלב מצורף EB.
    4. בין 0-8 ימים, לשנות את המדיום בכל יום נוספים כדי KDM1 עם חומצה retinoic מיקרומטר (RA) 3 25 ng/mL כל של BMP4 ו EGF. לשמור את EBs ב 37 ° C עם 5% CO2.
    5. בין ימים 9 – 12, לשנות את המדיום בכל יום KDM2 עם 3 µM RA, 25 ננוגרם למ"ל BMP4 20 ng/mL EGF.
    6. בין ימים 13 – 30, לשנות את המדיום בכל יום KDM3 עם 10 ננוגרם למ"ל BMP4 ו 20 ng/mL EGF.
  4. הבידול של CBMC-iPSC לתוך fibroblasts
    הערה: עבור ערכה של בידול פיברובלסט מ- CBMC-iPSCs, ראה איור 2א.
    1. המעיל תרבות מנות, באמצעות מטריצת קרום המרתף. להכין 5 מ"ל עד מעיל מנה 100 מ מ.
      1. הפשרת קרום המרתף מטריקס (הריכוז הסופי: 600 ng/mL) ו לדלל אותו עם DMEM/F12 בינוני. הוסף את הפתרון לשטוף הכלים, דגירה ב 37 מעלות צלזיוס במשך 30 דקות לשאוב חומר הציפוי לפני השימוש (לא להתייבש).
    2. EBs קציר ה-100 ל צינור חרוטי 50 מ ל באמצעות פיפטה עם iPSC בינוני או PBS. שתשמור על RT במשך 1 דקה להתיישב את EBs. ודא שהם מיישבים בתחתית הצינורית חרוט. הסר את תגובת שיקוע.
    3. Resuspend את EBs באמצעות פיפטה µL 1,000 ב- 6 מ של FDM1 עם 10 מיקרומטר רוק מעכב. להעביר את EBs (עם בינוני) תבשיל מצופים מטריצה 100 מ מ קרום המרתף, דגירה ב 37 ° C עם 5% CO2. לרענן את FDM1 בכל יום אחר במשך 3 ימים.
      הערה: להוסיף רק את המדכא רוק בשלב מצורף EB.
    4. להוסיף 0.5 ננומטר עצם morphogenetic חלבון 4 (BMP 4) FDM1 בין ימים 4 ו- 6.
    5. יום 7, לשנות המדיום FDM2 בכל יום אחר במשך שבוע.
    6. יום 14, להוסיף 1 מ"ל של 1 מ מ EDTA, דגירה ב 37 ° C עם 5% CO2 עבור 2 דק לקצור את התאים עם 3 מ"ל של FDM2, צנטריפוגה ב 250 x g 2 דק. להסיר את תגובת שיקוע, resuspend את התאים ב 5 מ של FDM1.
    7. לספור את התאים באמצעות hemocytometer, resuspend 2 x 10 תאים6 FDM1 בינונית, ולהעביר את התאים noncoated למנה. לשמור על התאים ב 37 ° C עם 5% CO2 ולשנות את המדיום בכל יום אחר.
    8. המעיל תרבות מנות, באמצעות שימוש מסוג קולגן. להכין 5 מ"ל עד מעיל מנה 100 מ מ. לדלל מסוג קולגן פתרון (הריכוז הסופי: µg 50/מ"ל) ב- 0.02 נקודות חומצה אצטית N. הוסף את הפתרון לשטוף הכלים, תקופת דגירה-RT של ח' 1 לשאוב חומר הציפוי לפני השימוש (לא להתייבש).
      שים לב: לפני השימוש הלוחות, לרחוץ כלים 3 x עם PBS להסיר את החומצה.
    9. ביום 21, להוסיף 1 מ"ל של 1 מ מ EDTA, דגירה ב 37 ° C עם 5% CO2 עבור 2 דק לקצור את התאים עם 3 מ"ל של FDM1, צנטריפוגה ב 250 x g 2 דק. להסיר את תגובת שיקוע, resuspend את התאים ב 5 מ של FDM1. ספירת התאים באמצעות העברת hemocytometer 2 x 106 תאים לסוג אני מאכל מצופה קולגן 100 מ מ FDM1 בינונית. לשמור על התאים ב 37 ° C עם 5% CO2 ולשנות את המדיום בכל יום אחר.
    10. ביום 28, להוסיף 1 מ"ל של 1 מ מ EDTA, דגירה ב 37 ° C עם 5% CO2 עבור 2 דק לקצור את התאים עם 3 מ"ל של FDM1, צנטריפוגה ב 250 x g 2 דק. להסיר את תגובת שיקוע, resuspend את התאים ב 5 מ של FDM1. לספור את התאים באמצעות hemocytometer ולהעביר 2 x 106 תאים תבשיל noncoated FDM1 בינונית. לשמור על התא ב 37 ° C עם 5% CO2 ולשנות את המדיום בכל יום אחר.
      הערה: iPSC נגזר fibroblasts להתרבות כמו שורת התאים פיברובלסט העיקרי מעבר עד 10 קטעים. במחקר זה, השתמשנו iPSC נגזר fibroblasts של שניים עד חמישה מעברים עבור ניתוח נוסף.

2. יישום נגזר hiPSC תאים

  1. דור של העור 3D תא צורב
    1. להכין סוג ינוטרלו אני קולגן בקרח, בעקבות ההמלצות של היצרן. כמו ריכוז סופי, להשתמש 3 מ"ג/מ"ל עבור סוג הקולגן (ריכוז מניות מסוג קולגן הוא 3.47 מ"ג/מ"ל), ודא שאמצעי האחסון הסופי של התערובת 5 מ ל. חישוב הנפח של 10 x PBS (נפח סופי/10 = 0.5 מ"ל). חישוב הנפח של מסוג קולגן כדי לשמש (נפח סופי x ריכוז קולגן הסופי / מלאי הקולגן ריכוז = 5 מ ל x 3 מ"ג / מ"ל / 3.47 מ"ג / מ"ל = 4.32 מ"ל). חישוב הנפח של 1 N NaOH (נפח של קולגן כדי לשמש x 0.023 מ"ל = 0.1 מ"ל). חישוב הנפח של dH2O (נפח סופי - נפח של קולגן - נפח של 10 x PBS - נפח של 1 N NaOH = 5 מ ל- mL 4.32-0.5 מ ל- 0.1 מ"ל = 0.08 mL). לערבב את תכולת השפופרת ולשמור אותו בקרח עד מוכן לשימוש.
    2. להוסיף 1 מ"ל של EDTA iPSC נגזר fibroblasts מהשלב 1.4.10, דגירה ב 37 ° C עם 5% CO2 עבור 2 דק לקצור את התאים מנותקת, לספור את התאים באמצעות hemocytometer ו 2 x 105 תאים להעביר צינור חרוטי 15 מ"ל. צנטריפוגה ב x 250 g למשך 2 דקות ולהסיר את תגובת שיקוע. Resuspend התאים iPSC נגזר fibroblasts ב- 1.5 מ של FDM1, שהמשרד את הסוג אני קולגן פתרון (1:1).
      הערה: מערבבים את הפתרון בעדינות כדי להימנע בועות.
    3. למקם את תותב ממברנה microplate 6-ובכן, להעביר את התערובת הכנס, דגירה-RT למשך 30 דקות.
      שים לב: אל תזיז את הצלחות.
    4. לאחר שאישרת את gelation, להוסיף 2 מ"ל של מדיום העליון של הוספה ו- 3 מ"ל בתחתית הבאר. תקופת דגירה המטריצה של fibroblasts וקולגן ב 37 ° C עם 5% CO2 של 5-7 ימים, עד gelation השלמת, עוד חוזים.
    5. לאחר gelation השלם, לנתק את keratinocytes נגזר iPSC (מתוך שלב 1.3.6) באמצעות EDTA. להוסיף 1 מ"ל של EDTA, דגירה ב 37 ° C עם 5% CO2 כי 2 דק לקצור את התאים מנותקת, לספור אותם באמצעות hemocytometer להעביר עונה 1 פרק 106 תאים צינור חרוטי 15 מ"ל. צנטריפוגה ב 250 x g למשך 2 דקות.
    6. הסר את תגובת שיקוע, resuspend עונה 1 פרק 106 תאים ב- 50-100 µL של סידן נמוכה בינונית האפיתל 1 (EP1).
    7. האחות בינוני כל המטריצה (ראה שלב 2.1.5) ואת הזרעים עונה 1 פרק 106 תאים של keratinocytes iPSC, נגזר על כל שכבה פיברובלסט. דגירה את הצלחת ב 37 ° C עם 5% CO2 למשך 30 דקות.
      שים לב: אל תזיז את הצלחת, אל תוסיף בכל מדיום עבור ההחזקה של תקין.
    8. להוסיף 2 מיליליטר EP1 העליון של הקדמי של 3 מ"ל של EP1 בתחתית הבאר.
    9. לאחר יומיים, תשאף בינוני כל בצלחת הוספה ממברנה ושנה המדיום נורמלי סידן EP2 במשך יומיים.
    10. לאחר יומיים, תשאף בינוני כל ולהוסיף 3 מ"ל של המדיום התקרנות רק לתחתית כדי ליצור ממשק אוויר נוזלי.
    11. לשמור על תא צורב את העור 3D עד 14 ימים ב 37 ° C עם 5% CO2 ולשנות את המדיום בכל יום אחר. הקציר תא צורב את העור תלת-ממדי על ידי חיתוך קצה תותב, ולהשתמש בו מחקר נוסף של צביעת ואת השתלת עור.
  2. השתלת עור
    1. לבצע אינהלציה הרדמה על הנד/scid עכברים (זכר, בן 6 שבועות), באמצעות שיטה סטנדרטית, שאושר כמוסד. על השתלים, לגלח את הפרווה של העור הגבי של העכבר בכל.
    2. להסיר מקטע 1 ס"מ x 2 ס"מ של העור של העכבר, באמצעות מספריים מעוגלים עם מלקחיים.
    3. מקם את תא צורב CBMC iPSC-נגזר העור 3D פגם באתר ועל התפר באמצעות שיטה העניבה מעל רוטב עם התפרים משי.
    4. להתבונן העכברים 2 שבועות, להקריב אותם לבדיקה היסטולוגית. פרוטוקול מכתימים אומתה מחקרים קודמים16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

העור מורכב, ברוב המקרים, ושל האפידרמיס הדרמיס. Keratinocytes הן סוג התא העיקרי של האפידרמיס, fibroblasts הם סוג התא העיקרי של הדרמיס. התכנית של בידול תקין מוצג איור 1א'. CBMC-iPCSc היו מתוחזקים מאכל מצופה vitronectin (איור 1B). במחקר זה, אנחנו הבדיל CBMC-iPSCs לתוך keratinocytes ו fibroblasts באמצעות מערך EB. יצרנו EBs באמצעות התליה בשיטת כדי להבטיח של אחיד ומבוקר התמיינות keratinocytes ו fibroblasts (איור 1C). EBs צורפו לכתב הרביעי קולגן מצופה לוחות עבור בידול תקין, המדיום השתנה מדי יום. CBMC-iPSCs טופלו רה, BMP4 ו EGF. CBMC-iPSCs היו הבדיל כדי keratinocytes. במהלך הבידול, המורפולוגיה של keratinocytes CBMC iPSC-נגזר השתנה במרוצת הזמן (משלים איור 1).

CBMC-iPSC-derived keratinocytes יש מורפולוגיות הדומה keratinocytes הראשי (איור 1D). בביטוי הגן של סמן pluripotent OCT4 היה downregulated ב CBMC-iPSC-derived keratinocytes. פריימר רצפים מוצגים בטבלה 1. הביטוי של תקין סמנים Np63, KRT5, KRT14 היה גדל ב- CBMC-iPSC-derived keratinocytes (איור 1F). CBMC-iPSC-derived keratinocytes שאושרו על-ידי הביטוי של Np63 ו- KRT14 על ידי אימונוהיסטוכימיה (איור 1E). תוצאות אלה אישר שיש CBMC iPSC-נגזר keratinocytes מאפייני keratinocytes העיקרי.

התכנית של בידול פיברובלסט מוצג באיור 2א. אנו גם שמר על CBMC-iPSCs בקערה מצופים vitronectin, המשמש EB היווצרות בידול פיברובלסט (איור 2ב, ג). אנחנו המצורפת את EBs קרום המרתף מצופים מטריצה צלחות ושינתה המדיום בכל יום אחר. תוצר התאים הועברו ל noncoated, מסוג צלחות מצופה קולגן. CBMC-iPSCs היו הבדיל כדי fibroblasts. במהלך הבידול, המורפולוגיה של CBMC iPSC-נגזר fibroblasts השתנה במרוצת הזמן (משלים איור 2).

CBMC iPSC-נגזר fibroblasts יש מורפולוגיות הדומה העיקרי fibroblasts (איור 2D). הביטוי של סמן תא גזע pluripotent OCT4 היה downregulated ב CBMC iPSC-נגזר fibroblasts. פיברובלסט סמנים של COL1A1, COL1A2, COL3A1, CD44 היו upregulated ב CBMC iPSC-נגזר fibroblasts (איור 2F). פריימר רצפים מוצגים בטבלה 1. כמו כן, CBMC iPSC-נגזר fibroblasts שאושרו על-ידי הביטוי של vimentin ו- fibronectin מאת אימונוהיסטוכימיה (איור 2E). תוצאות אלו מראים כי CBMC iPSC-נגזר fibroblasts דומים כדי fibroblasts העיקרי.

אנחנו שנוצר תא צורב של העור תלת-ממד באמצעות keratinocytes CBMC iPSC-נגזר fibroblasts. התכנית של היווצרות תא צורב העור תלת-ממדית מוצג באיור 3א. אנחנו שנוצר של תא עור תלת-ממד צורב על צלחת הוספה ממברנה. עבור התרבות תלת-ממד, היו CBMC iPSC-נגזר fibroblasts מרובדת עם סוג אני קולגן וצפות עם keratinocytes CBMC iPSC-נגזר. לאחר זריעה keratinocytes את CBMC iPSC-נגזר, המדיום שונה ריכוז סידן רגילה במשך יומיים. לאחר יומיים, מדיום ריכוז סידן גבוהה נוספה רק לתא התחתון היווצרות תרבות ממשק אוויר נוזלי. תרבות ממשק אוויר נוזלי המושרה ההבשלה של ריבוד של keratinocytes. העובי של תא צורב העור תלת-ממד היה גדל במהלך תרבות תלת-ממד. תוצאות אלה אישר כי תא צורב העור תלת-ממד נוצר מן keratinocytes iPSC נגזר fibroblasts על ידי hematoxylin אאוזין (H & E) צביעת (איור 3ג').

באמצעות תא צורב את CBMC iPSC-נגזר עור תלת-ממד, יצרנו מודל עכברים humanized (איור 3ב) על ידי הרכבה תא צורב את העור תלת-ממד כדי העכברים. הסחרור הושפע פגם 1 ס"מ x 2 ס"מ, השיטה עניבה-over שימש השתלת. לאחר 2 שבועות, העור המושתלים היה הורכבה ביעילות על העכברים, וידאנו את זה על ידי ניתוח H & E ו- immunocytochemical (איור 3ד'). ההבשלה תקין וסמנים בידול באפידרמיס של loricrin ו KRT14 היו ביטוי של organoids CBMC-iPSC-derived עור תלת-ממד (איור 3E). Organoids CBMC iPSC-נגזר עור תלת-ממד היו הבדיל פונקציונלית, הושתל ביעילות על עכברים, ביעילות לרפא פגמים בעור עכברים.

Figure 1
איור 1 : תקין הבידול של CBMC-iPSCs. (א) ערכה של בידול תקין של CBMC-iPSCs. (B ו- C) מורפולוגיה של CBMC-iPSCs (לוח ב'), EBs נגזר iPSC (לוח C). מורפולוגיה (D) של keratinocytes CBMC iPSC-נגזר. (E) ניתוח Immunocytochemical של Np63 (אדום), KRT14 (ירוק), יחד עם דאפי מכתים (כחול). פסי בקנה מידה = 100 μm. (F) ביטוי גנים של סמן pluripotent, תקין סמנים של keratinocytes נגזר iPSC (iPSC-Ks). הגרפים מציגים את הממוצע עם SEM של חמש דוגמאות עצמאית. הבדלים בין קבוצות נבחנו מובהקות סטטיסטית באמצעות הסטודנט t-מבחן. ה- t-מבחן הוחלה לנתח datasets כמותית nonparametric, והאות pהחד-זנבית-ערך מחושב (*p < 0.05, * *p < 0.01, * * *p < 0.001 המצוין מובהקות סטטיסטית). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : פיברובלסט הבידול של CBMC-iPSCs. (א) ערכה של פיברובלסט בידול של CBMC-iPSCs. (B ו- C) מורפולוגיה של CBMC-iPSCs (לוח ב'), EBs נגזר iPSC (לוח C). מורפולוגיה של CBMC iPSC-נגזר fibroblasts (D). (E) ניתוח Immunocytochemical של vimentin (אדום) ו- fibronectin (אדום), יחד עם דאפי מכתים (כחול). פסי בקנה מידה = 100 μm. (F) ביטוי גנים של סמן pluripotent, פיברובלסט סמנים של פיברובלסט נגזר iPSC (iPSC-Fs). הגרפים מציגים את הממוצע עם SEM של חמש דוגמאות עצמאית. הבדלים בין קבוצות נבחנו מובהקות סטטיסטית באמצעות הסטודנט t-מבחן. ה- t-מבחן הוחלה לנתח datasets כמותית nonparametric, והאות pהחד-זנבית-ערך מחושב (*p < 0.05, * *p < 0.01, * * *p < 0.001 המצוין מובהקות סטטיסטית). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : דור של העור CBMC iPSC-נגזר תא צורב ומודל עכברים humanized. (א) תרשים סכמטי של תהליך דור העור נגזר iPSC תא צורב (iSO). (B) השתלת תהליך של iSO לתוך עכברים. (ג) אנליזה היסטולוגית של iSO במבחנה. (ד) ניתוח היסטולוגית של iSO המושתלים ויוו. (E-H) ניתוח Immunocytochemical של loricrin ו- KRT14. ללעוג שליטה (לוח אלקטרוני), המושתלים iSO (החלונית ' נ, loricrin), העור עכברים (שליטה שלילי, לוח G), המושתלים iSO (לוח H, KRT14). פסי בקנה מידה = 200 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Supplementary Figure 1
משלים איור 1: מורפולוגיה של keratinocytes נגזר iPSC. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Supplementary Figure 2
משלים איור 2: מורפולוגיה של iPSC נגזר fibroblasts. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

שם היעד כיוון רצף פריימר (5' - 3') גודל (בסיסי זוגות) Refseq_ID
OCT4 קדימה
הפוך
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 קדימה
הפוך
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 קדימה
הפוך
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 קדימה
הפוך
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 קדימה
הפוך
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 קדימה
הפוך
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 קדימה
הפוך
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 קדימה
הפוך
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 קדימה
הפוך
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 קדימה
הפוך
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin קדימה
הפוך
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH קדימה
הפוך
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

טבלה 1: רצפים של תחל המשמש תגובת שרשרת של פולימראז בזמן אמת כמותית.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

IPSCs האנושי שהוצעו אלטרנטיבה חדשה עבור רפואה רגנרטיבית אישית17. החולה נגזר iPSCs אישית משקפים את מאפייני המטופל יכול לשמש עבור מידול המחלה, והתרופות הקרנה עצמיים השתלת18,19. השימוש iPSCs נגזר החולה יכול גם להתגבר על בעיות לגבי ראשי תאים, חוסר מספרי הטלפון הנייד נאותה, החיסון תגובות5,17,19. עם זאת, הדור של iPSCs אישית אינה כלכלית עקב זמן, עלות, מגבלות העבודה. הלע-homozygous iPSCs CBMC, נגזר הופיעו כאפשרות חדש. IPSCs הלע-homozygous יכול להיות בעל ערך מבחינה כלכלית, ניתן להחיל על מספר גדול של חולים8,11,12,13. יתר על כן, הלע הקלדה של CBMCs מתרחשת במהלך אחסון הבנק התא, ובכך הפיכתם קל לשימוש עבור מחקר והשתלות. פרוטוקולים להבדיל CBMC-iPSCs לתוך cardiomyocytes hepatocytes, chondrocytes היה דיווח על16,20,21,22,23.

באפידרמיס ואת עורי השכבות הם מרכיבים של העור. האפידרמיס כולל keratinocytes ומורכבת הדרמיס fibroblasts. אז, אנחנו הבדיל CBMC-iPSCs לתוך keratinocytes ו fibroblasts, בהתאמה. עבור הבידול, EBs במדים ומבוקרות היטב, אופטימיזציה נוצרו ע י התליה זרוק שיטת15,24. הסוג הרביעי קולגן הוא מרכיב עיקרי של קרום המרתף. עבור בידול תקין, EBs צורפו לכתב הרביעי מצופים קולגן מנות. CBMC-iPSC-derived keratinocytes היה עם ריצוף דמוי מורפולוגיה (איור 1D). סמני תקין Np63 ו- KRT14 היו ביטוי iPSC-Ks (איור 1E, F). תוצאה זו אישר כי רא ו BMP4 המושרה קולטנים של upregulation סמני תקין. יתר על כן, CBMC-iPSCs היו הבדיל לתוך keratinocytes הדומה keratinocytes העיקרי.

עבור פיברובלסט בידול, EBs צורפו ללוחות קרום המרתף מצופים מטריצה, התאים הבדיל היו באופן סדרתי passaged אל noncoated, מסוג צלחות מצופה קולגן. שתרבות טורי היה המושרה כדי לציין פיברובלסט בידול. Fibroblasts הפיק של מטריצה חוץ-תאית (ECM) שהיה פונקציות ההעברה והצמדות. Fibroblasts גם לייצר קולגן שפע רכיבים25. ב- CBMC iPSC-נגזר fibroblasts, סמן משטח פיברובלסט CD44 היה גדל. הביטוי של הקולגן היה upregulated ב iPSC-Fs (איור 2F). הביטוי של fibronectin, vimentin היה גדל ב- iPSC-Fs (איור 2E).

שימוש keratinocytes הבדיל ו fibroblasts, יצרנו העור CBMC iPSC-נגזר organoids (איור 3א). השתמשנו תרבות אוויר נוזלי ממשק עם אמצעי סידן גבוהה המושרה מרובדת שכבות של עור CBMC iPSC-נגזר organoids. הריכוז הגבוה של סידן היה צורך ההבשלה תקין ויוו, במבחנה, בעוד הממשק אוויר נוזלי שימש לפתח רבדים מרובה שכבות26,27,28. השתמשנו בשיטה זו כדי לחקות עור אמיתי, היסטולוגית וניתוח הראה כי העור היה מרובדת (איור 3ג'). כדי לוודא את יכולת ריפוי פצע, אנחנו מושתלים iSO לתוך העור עכברים, שימוש בשיטת ההלבשה עניבה-over (איור 3ד'). לאחר ההשתלה, organoids העור ביעילות היו הושתל, ריפא את העור עכברים במידה מספקת. KRT14 היה ביטוי לשכבת הבסיס של stratifying epithelia קשקשיים ו nonsquamous. Loricrin הוא מרכיב העיקרי של השכבה הקרנית שנמצאו סופני הבדיל keratinized בתאי אפיתל29,30. דה מרקר התמיינות באפידרמיס של loricrin היה ביטוי בעור המושתלים. הביטוי של KRT14 ו- loricrin אישר כי תא צורב העור היה לבגרות מלאה, בידול הודגם על-ידי immunohistochemical מכתים (איור 3E).

במחקר זה, פיתחנו פרוטוקול להבדיל CBMC-iPSCs לתוך keratinocytes ו fibroblasts, סוגי התאים העיקריים של העור האנושי. אנחנו אישר כי CBMC iPSC-נגזר keratinocytes ו fibroblasts הראו פנוטיפים דומה לקווי התא הראשי. באמצעות תאים אלה, אנו הנוצר תא צורב של העור תלת-ממד, הושתל זה אל תוך הנהון/scid עכברים בשיטת ההלבשה עניבה-over. בטכניקה מקורית זו תוארה לראשונה בשנת 1929 על ידי בלייר וחום, כבר בשימוש נפוץ עבור השתלת עור31,32. שיטה זו מנעה השתל עובר, העדיף של הדבקה טובה על הפצע, ובכך האצת ריפוי רקמות. ניתוח היסטולוגית אישר כי תא צורב העור 3D חיקה הפנוטיפ העור האנושי בהצלחה מרובדת, התבגר מעל 2 שבועות. השתלת עור בדרך כלל מתבצעת באמצעות תאים בודדים keratinocytes ו fibroblasts על ידי סיליקון-תא בועות-33,-34. מערכת זו קל להשתיל אבל שהיינו צריכים יותר זמן עבור שנצפו השתלת יעילות לאחר השתל. תא פלסטיק או סיליקון מתפקד כמחסום מפני העור של העכברים. IPSCs מערכת-derived תא צורב העור 3D אל תשתמש תא פלסטיק או סיליקון. במערכת זו, השתלת היה יעיל; עם זאת, זה היה קשה לחסום את תהליך הריפוי הטבעי של עכברים. אז, העור של העכברים מכוסה חלקים רבים של iSO במשך זמן רב לאחר ההשתלה. זה חלק של השיטה המוצגת כאן חייב להשתפר.

לסיכום, CBMC-iPSCs הם מקור תא פוטנציאלי עבור שתלי העור. שימוש פרוטוקולים אלה, CBMC iPSC-נגזר keratinocytes, fibroblasts ולאחר תא צורב של העור 3D יכול לשמש במחקרים הקשורים דרמטולוגיה, סמים, הקרנה קוסמטיים של רפואה רגנרטיבית.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי מענק של קוריאה בריאות טכנולוגיית R & D הפרוייקט, משרד הבריאות, הרווחה, ענייני משפחה, הרפובליקה של קוריאה (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics