3B cilt Organoid kablosu kan kaynaklı nesil Pluripotent kök hücreler indüklenen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Biz İndüklenmiş pluripotent kök hücre kaynaklı lenfositi ve fibroblastlar ayırt etmek ve bir 3B cilt organoid oluşturmak gösterilmiştir bir protokol bu lenfositi ve fibroblastlar kullanarak öneriyoruz. Bu iletişim kuralı insanlaşmış fareler model oluşturma ek bir adım içerir. Burada sunulan teknik dermatolojik araştırma artıracaktır.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Deri vücudun en büyük organıdır ve birçok işlevi vardır. Deri bir fiziksel bariyer ve vücudun koruyucu görev yapan ve bedensel işlevleri düzenleyen. Biyomimetik imitasyon modelleri, sistemleri ve karmaşık insan sorunları1çözme amacıyla doğa unsurları olduğunu. Cilt Biyomimetik tüp bebek Hastalıkları Araştırma ve içinde vivo rejeneratif tıp için yararlı bir araçtır. İnsan İndüklenmiş pluripotent kök hücreler (iPSCs) sınırsız nükleer silahların yayılmasına karşı karakteristik ve üç germ katmanları ayırt etme yeteneği var. İnsan iPSCs kan hücreleri, keratinositler, fibroblastlar ve diğerleri gibi çeşitli Primer hücre oluşturulur. Bunlar arasında kordon kanı mononükleer hücre (CBMCs) allojenik rejeneratif tıp açısından bir alternatif hücre kaynağı olarak ortaya çıkmıştır. Bankacılık sistemi hücre insan lökosit antijeni (HLA) yazarak önemlidir çünkü CBMCs içinde rejeneratif tıp yararlıdır. Biz CBMC-iPSCs farklılaşma lenfositi ve fibroblast ve 3B cilt organoid nesil için bir yöntem sağlar. Lenfositi CBMC IPSC türetilmiş ve fibroblastlar bir birincil hücre satırı ile benzer özelliklere sahip. 3B cilt organoids epidermal bir katman bir dermal tabaka üzerine overlaying tarafından oluşturulur. Bu 3D cilt organoid dikim tarafından insanlaşmış fare modeli oluşturulur. Bu çalışmada bir 3D insan IPSC elde edilen deri organoid tüp bebek ve içinde vivo dermatolojik araştırma için roman, alternatif bir araç olabilir gösterir.

Introduction

Deri vücudun en dış yüzeyi kaplar ve iç organları korur. Cilt patojenlere karşı korumak, emici ve su depolama da dahil olmak üzere çeşitli işlevleri vardır, vücut ısısını düzenleyen ve vücut excreting2atık. Deri nakli cilt kaynağına bağlı olarak sınıflandırılabilir; deri başka bir donörden kullanarak greft allogrefler denir ve hastanın kendi cilt kullanarak greft autografts vardır. Bir otogrefti onun düşük ret riski nedeniyle tercih edilen tedavi olmasına rağmen cilt biyopsileri hastalarda şiddetli lezyonlar veya cilt hücrelerini yetersiz sayıda gerçekleştirmek zordur. Şiddetli yanık hastalarında, cilt hücrelerinin sayısının üç katı geniş alanları kapsayacak şekilde gereklidir. Bir hastanın vücudundan deri hücrelerinin sınırlı yer allogenous nakli gerekli olduğu durumlarda oluşur. Genellikle yaklaşık 1 hafta3sonra ana bilgisayarın bağışıklık sistemi tarafından reddedilir bu yana Otolog transplantasyon zamana bir homogreft geçici olarak kullanılır. Ret hastanın bağışıklık sistemi tarafından üstesinden gelmek için Greftler bir kaynak hasta4aynı bağışıklık kimlik ile gelmelidir.

İnsan iPSCs için kök hücre tedavisi5hücreleri gelişmekte olan bir kaynaktır. İnsan iPSCs somatik hücrelerden OCT4, SOX2, Klf4 ve c-Myc6gibi programlama faktörler kullanılarak oluşturulur. İnsan iPSCs kullanarak embriyonik kök hücreleri (ESCs)7,8etik ve immünolojik sorunları üstesinden gelir. İnsan iPSCs ve pluripotency var üç germ katmanları9içine ayırabilirsiniz. HLA, rejeneratif tıp, kritik bir faktör varlığı bağışıklık yanıtı ve ret10olasılığını belirler. Hasta kaynaklı iPSCs kullanımı hücre kaynaklı sınırlama ve bağışıklık sistemi ret sorunları da çözmektedir. CBMCs aynı zamanda rejeneratif tıp11için bir alternatif hücre kaynağı olarak ortaya çıkmıştır. CBMC bankacılık sırasında oluşan yazarak, zorunlu HLA kolayca araştırma ve nakli için kullanılabilir. Ayrıca, homozigoz HLA tipi iPSCs yaygın olarak çeşitli hastalar12' ye uygulayabilirsiniz. Bir roman ve hücre tedavisi ve allojenik rejeneratif tıp12,13,14için etkin strateji bir CBMC-IPSC bankadır. Bu çalışmada, CBMC-iPSCs, keratinositler ve fibroblastlar, ayrıştırılan kullanın ve tabakalı 3B cilt oluşturma. Bu çalışmada sonuçlarından bir 3B cilt CBMC IPSC türetilmiş organoid tüp bebek ve içinde vivo dermatolojik araştırma için bir roman araç olduğunu göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hayvanları içeren tüm yordamları laboratuvar hayvanları Sosyal Yardım Yasası, bakım ve laboratuvar hayvanlarının kullanım kılavuzu uygun olarak gerçekleştirilen ve kurallar ve ilkeler kemirgen deneme için sağlanan kurumsal hayvan bakım ve Kore Katolik Üniversitesi Tıp Okulu Komitesi (IACUC) kullanın. Çalışma Protokolü Katolik Üniversitesi Kore (CUMC-2018-0191-01) kurumsal inceleme Kurulu tarafından onaylanmıştır. IACUC ve bölümü, laboratuvar hayvanları (DOLA) Kore Katolik Üniversitesi, Songeui kampüs 2017 ve Edinsel Derneği değerlendirmesi için Kore mükemmellik hayvan laboratuvar tesiste Kore gıda ve İlaç İdaresi akredite ve Akreditasyon laboratuvar hayvan bakımı International (AAALAC) Uluslararası tam Akreditasyon 2018.

1. cilt hücre farklılaşması İndüklenmiş pluripotent kök hücrelerden

  1. Orta hazırlık
    Not: tüm Orta 4 ° C'de 3 aya kadar karanlık bir ortamda saklayın. Tüm Orta sterilizasyon için kullanmadan önce 0.22 mikron polyethersulfone filtre sistemi kullanarak filtre. Tüm Orta toplam hacmi 500 mL içinde kullanılabilir.
    1. KDM1 hazırlamak (keratinosit farklılaşma orta 1). Mix Dulbecco'nın modifiye kartal orta (DMEM) / % 2 fetal sığır serum (FBS), 0,3 mmol/L L-askorbik asit, 5 μg/mL insülin ve 24 µg/mL adenin ile F12 orta (3:1).
    2. KDM2 hazırlamak (keratinosit farklılaşma orta 2). Mix tanımlanan keratinosit serum-Alerjik orta ( Tablo reçetesigörmek) 0,3 mmol/l L-askorbik asit, 5 μg/mL insülin ve 10 μg/mL adenin ile.
      Not: Tanımlanmış keratinosit serum-Alerjik orta büyüme ve genişleme lenfositi desteklemek için optimize edilmiştir.
    3. KDM3 hazırlamak (keratinosit farklılaşma orta 3). Mix keratinosit serum-Alerjik orta tanımlanan ve keratinosit serum-Alerjik orta (1:1) Malzemeler tablo Ayrıntılar için bkz:.
      Not: Keratinosit serum-Alerjik orta büyüme ve lenfositi bakımı için optimize edilmiştir.
    4. FDM1 hazırlamak (fibroblast farklılaşma orta 1). %5 FBS, 5 μg/mL insülin, 0,18 mM adenin ve 10 ng/mL epidermal büyüme faktörü (EGF) ile Mix DMEM/F12 orta (3:1).
    5. FDM2 hazırlamak (fibroblast farklılaşma orta 2). %5 FBS ve % 1 gerekli olmayan amino asitler ile Mix DMEM/F12 orta (1:1).
    6. EP1 hazırlamak (epitel orta 1). Mix DMEM/F12 (3:1) 4 mM L-glutamin, 40 mikron adenin, 10 μg/mL transferrin, 10 μg/mL insülin ve % 0.1 ile FBS.
    7. EP2 hazırlamak (epitel orta 2). Mix EP1 ve 1.8 mM Kalsiyum klorür.
    8. EP3 hazırlamak (epitel orta 3, anormalligi orta). 4 mM L-glutamin, 40 mikron adenin, 10 μg/mL transferrin, 10 μg/mL insülin, %2 FBS ve 1.8 mM Kalsiyum klorür ile Mix F12 orta.
  2. Embriyonik gövde üretimi
    1. CBMC-iPSCs bir önceki çalışmada12' de gösterilen iletişim kuralını kullanarak oluşturun.
    2. Kat kültür yemekleri, vitronectin kullanarak. 100 mm çanak kat için 5 mL hazırlayın.
      1. Çözülme ve 0,5 mg/mL vitronectin 50 μL resuspend (son konsantrasyonu: 5 µg/mL) ile 5 mL steril fosfat tamponlu tuz (PBS). Yemekler için çözüm ekleyin ve 1 h. aspiratı kaplama malzemesi kullanmadan (kurumaya değil) için (RT) oda sıcaklığında kuluçkaya.
    3. Vitronectin kaplı 100 mm için CBMC elde edilen iPSCs plaka ve IPSC orta (E8) günlük % 10 CO237 ° C'de değiştirin korumak.
    4. Embriyonik organları (EBs) (kısaca aşağıda açıklanan) bir önceki çalışma15 ' te gösterilen iletişim kuralını kullanarak oluşturun. İPSCs hücreleri % 80 izdiham gelinceye orta değiştirerek genişletin. % 80 izdiham, orta kaldırmak ve PBS ile yıkayın.
    5. 1 mL 1 mM ethylenediaminetetraacetic asit (EDTA) hücrelerle tedavi. 37 ° c % 5 CO2 2 min için kuluçkaya ve E8 orta 3 mL kullanarak hücre hasat. 250 x g 2 min için de hücreleri santrifüj kapasitesi.
    6. Süpernatant Aspire edin ve 5 mL E8 orta de hücrelere uygulayın. Bir hemasitometre kullanarak hücreleri saymak ve 1 x 106 hücre yeni bir 15 mL konik tüp aktarın. 250 x g 2 min için de hücreleri santrifüj kapasitesi.
    7. EB oluşumu orta 10 mikron Rho ilişkili kinaz (ROCK) inhibitörü ile 2.5 mL transfer edilen hücrelerle resuspend. 1 x 104 hücreleri (25 µL/damla) 10-100 μL çok kanallı pipet kullanarak noncoated kültür plaka kapak bırak. 1 x 106 hücrelerden (1 x 104 hücreleri/1 EB) formu 100 EBs. Çanak üzerinde açmak ve damlacık üzerinde kapak için asmak.
      Not: ROCK önleyici bakım ve farklılaşma süreci içinde belgili tanımlık ek adım sırasında gereklidir. ROCK inhibitörü EB toplama aşamada sadece ekleyin.
    8. Damlacıkları %5 CO2 37 ° C'de 1 gün için kuluçkaya.
    9. Ertesi gün, 100 hasat EBs ve farklılaşma için kullanabilirsiniz. Plaka IPSC orta (E8 orta) veya PBS ile kapağı dışarı yıkama ve içeriğini bir 50 mL konik tüp için hasat. RT 1 dk. için onları sakinleştirmek için EBs korumak. Süpernatant Aspire edin, EBs E8 orta ile resuspend ve bir 90 mm Petri kabına farklılaşma kadar proje.
  3. CBMC-iPSCs farklılaşma keratinositler içine
    Not: CBMC-iPSCs dan keratinosit farklılaşma düzeni için şekil 1Abakın.
    1. Hasat 100 EBs IPSC orta veya PBS ile 50 mL konik tüp için. RT EBs yerleşmek için 1 dakika için korumak. Konik tüp alt kısmında yerleşmek emin olun. Süpernatant Aspire edin ve EBs E8 orta 1 ng/mL kemik morfogenetik protein 4 (BMP4) ile resuspend. EBs bir 90 mm Petri kabına aktarmak ve 1 gün için % 5 CO2 37 ° C'de proje.
    2. Kültür yemekleri, tip IV kollajen kullanılarak ceket. 5 mL türü IV kollajen 100 mm çanak kat için hazırlayın.
      1. Çözülme ve IV kollajen çözüm türü resuspend (son konsantrasyonu: 50 µg/mL) N HCl. çözüm yemekleri ekleyip RT için 1 h. kuluçkaya 0,05 ile kaplama malzemesi kullanmadan (kurumaya değil) Aspire edin.
        Not: tabakları kullanmadan önce 3 bulaşıkları yıkamak x herhangi bir asit kaldırmak için PBS ile.
    3. EBs (Adım 1.3.1) 50 mL konik tüp için hasat ve RT 1 dk. için onları sakinleştirmek için proje. Konik tüp alt kısmında yerleş, süpernatant Aspire edin, EBs KDM1 6 ml 10 µM ROCK inhibitörü ile resuspend emin olun. EBs türü IV 100 mm kolajen kaplı yemek için transfer.
      Not: ROCK inhibitörü EB eki aşamada sadece ekleyin.
    4. 0-8 gün arasında her gün KDM1 için 3 µM retinoik asit (RA) ile orta ve 25 ng/mL her BMP4 ve EGF değiştirin. EBs %5 CO237 ° C'de korumak.
    5. Arasındaki gün 9 – 12, orta KDM2 3 µM RA, 25 ng/mL BMP4 ve 20 ng/mL EGF için her gün değiştirin.
    6. 13-30 gün arasında orta her geçen gün KDM3 için 10 ng/mL BMP4 ve 20 ng/mL EGF ile değiştirin.
  4. CBMC-IPSC farklılaşma fibroblastlar içine
    Not: CBMC-iPSCs dan fibroblast farklılaşma düzeni için Şekil 2Abakın.
    1. Kat kültür yemekleri, membran matrisi kullanarak. 100 mm çanak kat için 5 mL hazırlayın.
      1. Membran matris çözülme (son konsantrasyonu: 600 ng/mL) ve DMEM/F12 orta ile sulandırmak. Yemekler için çözüm ekleyin ve 30 dk. aspiratı kaplama malzemesi kullanmadan (kurumaya değil) 37 ° C'de kuluçkaya.
    2. Hasat 100 EBs IPSC orta veya PBS ile bir pipet kullanarak bir 50 mL konik tüp için. RT EBs yerleşmek için 1 dakika için korumak. Konik tüp alt kısmında razı olun. Süpernatant kaldırın.
    3. FDM1 6 ml 10 µM ROCK inhibitörü ile 1.000 µL pipet kullanarak EBs resuspend. EBs (orta ile) bir membran 100 mm matris kaplı yemek için aktarmak ve % 5 CO237 ° C'de kuluçkaya. FDM1 3 gün boyunca her gün yenileyin.
      Not: Sadece EB eki aşamada ROCK inhibitörü ekleyin.
    4. FDM1 4-6 gün arasında 0.5 nM kemik morfogenetik protein 4 (BMP 4) ekleyin.
    5. Gün 7, orta FDM2 için 1 hafta boyunca her gün değiştirin.
    6. Gün 14, 1 mL 1 mM EDTA ekleyin ve %5 CO2 ile 37 ° C'de 2 dk. süpernatant kaldırmak ve 5 mL FDM1 de hücrelerde resuspend FDM2 ve santrifüj 250 x g , 3 mL hücrelerle 2 dk. hasat için kuluçkaya.
    7. Bir hemasitometre kullanarak hücreleri saymak, 2 x 106 hücreler ile FDM1 orta resuspend ve noncoated yemek için hücreleri aktarın. %5 CO2 37 ° C'de hücreleri korumak ve orta her gün değiştirin.
    8. Kat kültür yemekleri kullanarak, tip ı kollajen. 100 mm çanak kat için 5 mL hazırlayın. Seyreltik tip ı kollajen çözüm (son konsantrasyonu: 50 µg/mL) 0,02 N Asetik asit. Yemekler için çözüm ekleyin ve 1 h. aspiratı kaplama malzemesi kullanmadan (kurumaya değil) için RT kuluçkaya.
      Not: tabakları kullanmadan önce 3 bulaşıkları yıkamak x asit kaldırmak için PBS ile.
    9. Gün 21, 1 mL 1 mM EDTA ekleyin ve %5 CO2 ile 37 ° C'de 2 dk. süpernatant kaldırmak ve 5 mL FDM1 de hücrelerde resuspend FDM1 ve santrifüj 250 x g , 3 mL hücrelerle 2 dk. hasat için kuluçkaya. Bir hemasitometre ve transfer kullanarak hücreleri 2 x 106 hücreler türü için ben FDM1 orta ile 100 mm kolajen kaplı yemek sayısı. %5 CO2 37 ° C'de hücreleri korumak ve orta her gün değiştirin.
    10. Gün 28, 1 mL 1 mM EDTA ekleyin ve %5 CO2 ile 37 ° C'de 2 dk. süpernatant kaldırmak ve 5 mL FDM1 de hücrelerde resuspend FDM1 ve santrifüj 250 x g , 3 mL hücrelerle 2 dk. hasat için kuluçkaya. Bir hemasitometre kullanarak hücreleri saymak ve 2 x 106 hücreler ile FDM1 orta noncoated bir yemek için transfer. Hücre 37 ° C % 5 CO2 , korumak ve orta her gün değiştirin.
      Not: bir birincil fibroblast hücre kültürünü ve passage kadar 10 geçişleri gibi IPSC kaynaklı fibroblastlar çoğalırlar. Bu çalışmada, daha fazla çözümleme için IPSC kaynaklı fibroblastlar iki ile beş pasajlar kullandık.

2. uygulama farklılaşmış hücre hiPSC elde edilen

  1. 3B cilt organoid nesil
    1. Etkisiz türü hazırlamak ben üreticinin önerilerini takip kollajen buz üzerinde. 3 mg/mL nihai toplama kullanmak için tip ı kollajen (hisse senedi konsantrasyonu tip ı kollajen olduğunu 3,47 mg/mL) ve karışım son hacmi 5 mL olduğundan emin olun. 10 x PBS hacmi hesaplamak (son Cilt/10 = 0.5 mL). Ses düzeyini hesaplamak tip ı kollajen kullanılmak üzere (son kollajen konsantrasyonu x son hacim / stok kollajen konsantrasyonu 5 mL x 3 mg / mL = / 3,47 mg / mL = 4,32 mL). 1 N NaOH hacmi hesaplamak (Cilt kollajen kullanılmak üzere 0.023 mL = 0.1 mL x). DH2O hacmi hesaplamak (10 x PBS - birim 1 N NaOH hacmi son hacim - cilt kollajen - 5 mL - 4,32 mL-0.5 mL-0.1 mL = 0,08 mL =). Tüp içeriğini karıştırmak ve kullanıma hazır kadar buz üzerinde tutun.
    2. 1 mL EDTA IPSC kaynaklı fibroblastlar 1.4.10 adımından ekleyin ve %5 CO2 ile 37 ° C'de 2 dk. müstakil hücre hasat, bir hemasitometre kullanarak hücreleri saymak ve 2 x 105 hücreleri yeni bir 15 mL konik tüp nakletmek için kuluçkaya. Vasıl 250 x g 2 dk santrifüj kapasitesi ve süpernatant kaldırın. 1.5 ml FDM1 IPSC kaynaklı fibroblast hücreleri resuspend ve türü etkisiz hale ben kollajen çözümü (1:1).
      Not: çözüm yavaşça bubbles kaçınmak için karıştırın.
    3. Membran Ekle bir 6-şey Mikroplaka yerleştirin, karışım Ekle'nin üzerine aktarmak ve RT 30 min için kuluçkaya.
      Not: plakaları hareket ettirmeyin.
    4. Jelleşme onayladıktan sonra orta 2 mL Ekle ve Kuyunun dibine 3 mL ekleyin. Fibroblastlar ve kollajen %5 CO2 37 ° C'de matrisi için 5-7 gün jelleşme tamamlanana kadar ve artık sözleşmeleri kuluçkaya.
    5. Sonra tam jelleşme, IPSC kaynaklı keratinositler (Kimden adım 1.3.6) ayırmak EDTA kullanarak. 1 mL EDTA ekleyin ve %5 CO2 ile 37 ° C'de 2 dk. müstakil hücre hasat, bir hemasitometre kullanarak bunları saymak ve 1 x 106 hücre yeni bir 15 mL konik tüp nakletmek için kuluçkaya. Santrifüj 250 x g de 2 dk için.
    6. Süpernatant kaldırmak ve 50-100 µL düşük kalsiyum epitel orta 1 (EP1) 1 x 106 hücreler resuspend.
    7. Tüm Orta matris Aspire edin (bkz. Adım 2.1.5) ve 1 x 106 hücreler her fibroblast katman üzerine IPSC kaynaklı keratinositler, temel olarak belirler. Plaka %5 CO2 30 dk 37 ° C'de kuluçkaya.
      Not: plaka hareket etmez ve herhangi bir ortamda keratinosit ekin eklemeyin.
    8. Üst ekleme ve Kuyunun dibine EP1 3 mL EP1 2 mL ekleyin.
    9. 2 gün sonra tüm Orta membran Ekle plaka Aspire edin ve orta 2 gün boyunca normal kalsiyum EP2 değiştirin.
    10. 2 gün sonra tüm Orta Aspire edin ve anormalligi orta 3 mL hava-sıvı arabirim oluşturmak için sadece en altına ekleyin.
    11. 14 gün %5 CO2 ile 37 ° C'de için 3B cilt organoid korumak ve orta her gün değiştirin. 3B cilt organoid ucun kenar kesim tarafından hasat ve boyama ve deri grefti başka bir çalışma için kullanabilirsiniz.
  2. Deri grefti
    1. İnhalasyon anestezi NOD/scid fareler (erkek, 6 haftalık) üzerinde gerçekleştirmek, standart, kurumsal olarak onaylanmış bir yöntem kullanarak. Deri nakli için her fare dorsal deri kürk tıraş.
    2. Forseps ile eğri makas kullanırken fare Cilt 1 cm x 2 cm bölümünü kaldırın.
    3. 3B cilt CBMC IPSC elde edilen organoid bir kravat-over soyunma yöntemiyle ile ipek Dikiş dikiş ve kusur site üzerine yerleştirin.
    4. Fareler iki haftadır gözlemlemek ve histolojik analiz için onları kurban. Boyama Protokolü önceki çalışmalar16' doğrulandı.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cilt, çoğunlukla, epidermis ve dermis oluşmaktadır. Keratinositler ana hücre tipi epidermis, ve fibroblastlar dermis ana hücre türü vardır. Keratinosit farklılaşma düzeninin şekil 1içindeAgösterilir. CBMC-iPCSc vitronectin kaplı bir tabak (şekil 1B) muhafaza. Bu çalışmada, keratinositler ve EB oluşumu kullanarak fibroblastlar CBMC-iPSCs farklı. EBs asılı kullanarak oluşturulan damla lenfositi ve fibroblast (şekil 1C) düzgün ve kontrollü bir farklılaşma emin olmak için yöntem. EBs IV kollajen kaplı levhaları keratinosit farklılaşma için yazmak için bağlı ve orta günlük değiştirildi. CBMC-iPSCs RA, BMP4 ve EGF ile tedavi edildi. CBMC-iPSCs keratinositler için ayrıştırılan. Sırasında farklılaşma, CBMC IPSC türetilmiş lenfositi morfolojisi (ek şekil 1) Zaman içinde değişti.

Lenfositi CBMC IPSC türetilmiş türleri Morfoloji birincil keratinositler (şekil 1D) benzer var. Gen ifadesinin pluripotent işaretin OCT4 lenfositi CBMC IPSC türetilmiş downregulated yapıldı. Astar dizileri Tablo 1' de gösterilmiştir. Keratinosit işaretleri Np63, KRT5 ve KRT14 ifade CBMC IPSC türetilmiş keratinositler (şekil 1F) yükseltilmiştir. CBMC IPSC türetilmiş lenfositi Np63 ve KRT14 ifadesi immünhistokimya (şekil 1E) tarafından teyit edildi. Bu sonuçlar CBMC IPSC türetilmiş lenfositi birincil lenfositi özellikleri doğruladı.

Fibroblast farklılaşma düzeninin Şekil 2içindeAgösterilir. Biz de CBMC-iPSCs vitronectin kaplı bir tabak içinde muhafaza ve EB oluşumu fibroblast farklılaşma (Şekil 2B, C) için kullanılır. EBs membran matris kaplı plakalar için bağlı ve orta her geçen gün değişti. Akıbet hücreler için noncoated transfer edildi ve tip ı kollajen kaplı plakalar. CBMC-iPSCs fibroblastlar için ayrıştırılan. Sırasında farklılaşma, CBMC IPSC türetilmiş fibroblastlar morfolojisi (ek Şekil 2) Zaman içinde değişti.

Fibroblastlar CBMC IPSC türetilmiş türleri Morfoloji birincil fibroblastlar (Şekil 2D) benzer var. Pluripotent kök hücre işaretçisi OCT4 ifade downregulated CBMC IPSC türetilmiş fibroblastlar içinde yapıldı. COL1A1, COL1A2, COL3A1 ve CD44 fibroblast işaretleri CBMC IPSC türetilmiş fibroblastlar (Şekil 2F) içinde upregulated vardı. Astar dizileri Tablo 1' de gösterilmiştir. Ayrıca, CBMC IPSC türetilmiş fibroblastlar vimentin ve fibronektin ifade tarafından immünhistokimya (Şekil 2E) tarafından teyit edildi. Bu sonuçlar CBMC IPSC türetilmiş fibroblastlar için birincil fibroblastlar benzer olduğunu göstermektedir.

Bir 3B cilt organoid keratinositler CBMC IPSC türetilmiş ve fibroblastlar kullanarak oluşturulan. 3B cilt organoid oluşumu düzeninin şekil 3' teAgösterilir. Bir 3B cilt organoid bir membran Ekle plaka üzerinde oluşturulan. 3D kültür için CBMC IPSC türetilmiş fibroblastlar edildi tabakalı türü ile ben kolajen ve CBMC IPSC türetilmiş lenfositi ile overlaid. CBMC IPSC türetilmiş lenfositi tohum sonra orta 2 gün boyunca normal kalsiyum konsantrasyonu değiştirildi. 2 gün sonra yüksek kalsiyum konsantrasyonu orta sadece alt odası hava-sıvı arabirimi kültürü oluşumu için eklenmiştir. Hava-sıvı arayüzey kültür olgunlaşma ve stratifikasyon keratinositler, indüklenen. 3B cilt organoid kalınlığı sırasında 3D kültür yükseltilmiştir. Bu sonuçlar 3B cilt organoid keratinositler IPSC kaynaklı ve fibroblastlar Hematoksilen Eozin (H & E) (şekil 3C) boyama ile oluşturulduğunu doğruladı.

3B cilt CBMC IPSC türetilmiş organoid kullanarak, fareler için 3B cilt organoid aşılama tarafından insanlaşmış fare modeli (şekil 3B) oluşturulur. 1 cm x 2 cm kusur akımıdır ve kravat-over yöntemi ekimi için kullanıldı. 2 hafta sonra transplante cilt fareler için verimli aşılı ve bu H & E ve immunocytochemical analizi (şekil 3D) tarafından onaylandı. Keratinosit olgunlaşma ve loricrin ve KRT14 epidermal ayırt etme belirteçleri 3B cilt CBMC IPSC türetilmiş organoids (şekil 3E) ifade edildi. 3B cilt CBMC IPSC türetilmiş organoids işlevsel olarak farklılaşmış, verimli bir şekilde fareler aşılı ve etkili bir şekilde fareler cilt kusurları iyileşmiş.

Figure 1
Resim 1 : CBMC-iPSCs farklılaşma keratinosit. CBMC-iPSCs dan keratinosit farklılaşma(a)şeması. (B ve C) Morfoloji IPSC kaynaklı EBs (Masası C) ve CBMC-iPSCs (Masası B). CBMC IPSC türetilmiş keratinositler (D) morfolojisi. (E) Np63 (kırmızı) ve KRT14 (yeşil), DAPI (mavi) boyama ile birlikte Immunocytochemical analizi. Ölçek çubukları 100 mikron =. (F) gen ekspresyonu pluripotent marker ve keratinosit işaretleri IPSC kaynaklı keratinositler (IPSC-Ks). Grafikleri ortalama beş bağımsız örnek SEM ile göster. Gruplar arasındaki farklar istatistiksel anlamlılık için öğrencinin tkullanarak muayene-test. T-testi parametrik olmayan Nicel veri kümeleri ve tek kuyruklu pçözümlemek için uygulandığı-değeri hesaplanmıştır (*p < 0,05, **p < 0,01, ***p < 0,001 belirtilen istatistiksel anlamlılık). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : Fibroblast farklılaşma CBMC-iPSCs. CBMC-iPSCs dan fibroblast farklılaşma(a)şeması. (B ve C) Morfoloji IPSC kaynaklı EBs (Masası C) ve CBMC-iPSCs (Masası B). CBMC IPSC türetilmiş fibroblastlar morfolojisi (D). (E) vimentin (kırmızı) ve fibronektin (kırmızı), DAPI (mavi) boyama ile birlikte Immunocytochemical analizi. Ölçek çubukları 100 mikron =. (F) gen ekspresyonu pluripotent marker ve fibroblast işaretleri IPSC kaynaklı fibroblast (IPSC-Fs). Grafikleri ortalama beş bağımsız örnek SEM ile göster. Gruplar arasındaki farklar istatistiksel anlamlılık için öğrencinin tkullanarak muayene-test. T-testi parametrik olmayan Nicel veri kümeleri ve tek kuyruklu pçözümlemek için uygulandığı-değeri hesaplanmıştır (*p < 0,05, **p < 0,01, ***p < 0,001 belirtilen istatistiksel anlamlılık). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : Üretimi insanlaşmış fare modeli ve cilt CBMC IPSC türetilmiş organoid. (A)şematik diyagramı IPSC kaynaklı cilt organoid (ISO) oluşturma işlemi. (B) ekimi ISO fareler içine süreç. (C) tüp bebek ISO histolojik analizi. (D) transplante ISO içinde vivo histolojik analizi. (E-H) Loricrin ve KRT14 Immunocytochemical analizi. ALAY kontrolü (Masası E), transplante ISO (panel F, loricrin), fareler cilt (negatif kontrol, panel G), transplante ISO (panel H, KRT14). Ölçek Bar = 200 mikron. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Supplementary Figure 1
Ek şekil 1: IPSC kaynaklı lenfositi morfolojisi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Supplementary Figure 2
Ek Şekil 2: IPSC kaynaklı fibroblastlar morfolojisi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Hedef adı Yön Astar sıra (5' - 3') Boyutu (baz çifti) Refseq_ID
OCT4 İleri
Ters
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 İleri
Ters
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 İleri
Ters
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 İleri
Ters
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 İleri
Ters
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 İleri
Ters
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 İleri
Ters
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 İleri
Ters
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 İleri
Ters
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 İleri
Ters
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin İleri
Ters
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH İleri
Ters
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tablo 1: Nicel gerçek zamanlı Polimeraz zincir reaksiyonu için kullanılan astar dizisi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

İnsan iPSCs kişiselleştirilmiş rejeneratif tıp17için yeni bir alternatif olarak önerilmiştir. Kişiselleştirilmiş iPSCs hasta kaynaklı hastalık modelleme, uyuşturucu tarama ve Otolog transplantasyon18,19için kullanılabilir hasta özelliklerini yansıtır. Hasta kaynaklı iPSCs kullanımı da Primer hücre, yeterli hücre sayıları ve bağışıklık tepkileri5,17,19eksikliği ile ilgili sorunların üstesinden gelebilir. Ancak kişiselleştirilmiş iPSCs nesil zaman, maliyet ve emek kısıtlamalar nedeniyle ekonomik olarak mümkün değildir. HLA-homozigoz CBMC elde edilen iPSCs yeni bir olasılık olarak ortaya çıkmıştır. HLA-homozigoz iPSCs ekonomik olarak değerli olabilir ve çok sayıda hasta8,11,12,13uygulanabilir. Ayrıca, CBMCs HLA yazarak hücre banka depolama, böylece onları araştırma ve nakli için kullanımı kolay yapım sırasında oluşur. CBMC-iPSCs cardiomyocytes, hepatositlerin ve kondrosit ayırt etmek için protokolleri-si olmak be16,20,21,22,23bildirdi.

Epidermal ve dermal Katmanlar cildin bileşenleridir. Epidermis keratinositler oluşur ve dermisin fibroblastlar oluşur. Yani, biz CBMC-iPSCs keratinositler ve fibroblastlar, sırasıyla farklı. Farklılaşma için üniformalı, iyi kontrollü ve en iyi duruma getirilmiş EBs asılı tarafından üretilen yöntemi15,24bırak. Türü IV kollajen membran önemli bir bileşenidir. Keratinosit ayrıştırması için EBs IV kolajen kaplı yemekleri yazmaya bağlı. Lenfositi CBMC IPSC türetilmiş bir Arnavut kaldırımlı benzeri Morfoloji (şekil 1D) vardı. Keratinosit işaretleri Np63 ve KRT14 IPSC-Ks içinde (şekil 1E, F) ifade edildi. Bu sonucu keratinosit işaretleri upregulation indüklenen RA ve BMP4 doğruladı. Ayrıca, CBMC-iPSCs için birincil lenfositi benzer keratinositler içine ayırt.

Fibroblast ayrıştırması için EBs matris kaplı membran tabakaları bana bağlı ve farklılaştırılmış hücrelerin seri olarak vardı noncoated üzerine pasajlı ve tip ı kollajen kaplı plakalar. Seri bir alt kültür fibroblast farklılaşma belirtmek için akımıdır. Fibroblastlar geçiş ve yapışma işlevleri vardı bir hücre dışı Matriks (ECM) üretti. Fibroblastlar da bol miktarda kolajen bileşenleri25üretmek. CBMC IPSC türetilmiş fibroblastlar içinde fibroblast yüzey marker CD44 yükseltilmiştir. Ifade kollajen upregulated IPSC-Fs (Şekil 2F) içinde yapıldı. Fibronektin ve vimentin ifadesi IPSC-Fs (Şekil 2E) yükseltilmiştir.

Fibroblastlar ve farklılaştırılmış lenfositi kullanarak, biz CBMC IPSC türetilmiş cilt organoids (şekil 3A) oluşturulur. Tabakalı CBMC IPSC elde edilen deri organoids katmanların indüklenen yüksek kalsiyum orta ile bir hava-sıvı arayüzey kültür kullanılır. Hava-sıvı arayüzü çok katmanlı tabakaları26,27,28geliştirmek için kullanılan süre kalsiyum yüksek yoğunlukta keratinosit olgunlaşma içinde vivo ve in vitro gerekliydi. Biz deri tabakalı gösterdi gerçek deri ve histolojik analizi (şekil 3C) taklit etmek için bu yöntemi kullandık. Yara iyileşmesi olasılığını onaylamak, biz ISO fareler deri içine kravat-over soyunma (şekil 3D) yöntemiyle nakledilmektedir. Ekimi sonra cilt organoids verimli aşılı ve fareler cilt yeterince iyileşti. KRT14 nonsquamous ve Skuamöz epiteli stratifying Bazal tabaka içinde ifade edildi. Loricrin ana bileşeni olan ölümcül bulundu stratum korneum ayrıştırılan ve keratinize epitel hücreleri29,30. Loricrin epidermal farklılaşma marker transplante deride ifade edildi. KRT14 ve loricrin ifadesi cilt organoid tam olgun olduğunu ve farklılaşma (şekil 3E) Boyama immunohistokimyasal tarafından gösterilmiştir açıkladı.

Bu çalışmada, keratinositler, fibroblastlar, insan derisi ana hücre türlerini CBMC-iPSCs ayırt etmek için bir protokol geliştirdik. Biz lenfositi CBMC IPSC türetilmiş ve fibroblastlar fenotipleri birincil hücre hatlarına benzer gösterdi doğruladı. Bu farklılaşmış hücreler kullanarak, biz bir 3B cilt organoid oluşturulan ve kravat-over soyunma yöntemini kullanarak NOD/scid fareler aşılı. Bu orijinal teknik Blair ve Brown tarafından 1929 yılında ilk tarif ve deri nakli31,32için yaygın olarak kullanılmıştır. Bu yöntem greft hareket edebiliyordu, yara için iyi bir yapışma tercih ve böylece doku şifa hızlandırılmış. Histolojik analiz 3B cilt organoid başarıyla tabakalı ve 2 hafta içinde olgunlaştı bir insan derisi fenotip taklit doğruladı. Deri nakli genellikle lenfositi ve fibroblastlar tek hücreleri kullanılarak silikon kabarcık odası33,34tarafından gerçekleştirilir. Bu sistem gerek kolay ama sonra greft nakli verimliliği için gözlenen için daha fazla zamana ihtiyacımız. Plastik veya silikon odası fareler'ın cilt karşı bariyer görevi görür. 3B cilt organoid iPSCs sistem kaynaklı bir plastik veya silikon odası kullanmayın. Bu sistemde nakli verimli; Ancak, farelerin doğal iyileşme süreci engellemek zordu. Yani, fareler'ın deri nakli sonra uzun bir süre birçok yerinde ISO kaplı. Bu iyileştirilmesi gerektiği yöntemi burada sunulan bir parçasıdır.

Sonuç olarak, CBMC-iPSCs deri nakli için potansiyel bir hücre kaynağıdır. Bu iletişim kuralları, CBMC IPSC türetilmiş lenfositi kullanarak, fibroblastlar ve 3B cilt organoid Dermatoloji, ilaç ve kozmetik tarama ve rejeneratif tıp ile ilgili çalışmaları kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser sağlık, refah ve aile işleri, Kore Cumhuriyeti (H16C2177, H18C1178) için bir hibe Kore sağlık teknoloji R & D proje, Bakanlığı tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics