Generation av 3D hud Organoid från sladd blod-derived inducerade pluripotenta stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi föreslår ett protokoll som visar hur att skilja inducerade pluripotenta stamceller-derived keratinocyter och fibroblaster och generera en 3D hud organoid, använda dessa keratinocyter och fibroblaster. Detta protokoll innehåller ytterligare ett steg för att generera en humaniserade möss modell. Tekniken presenteras här kommer förbättra Dermatologisk forskning.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Huden är kroppens största organ och har många funktioner. Huden fungerar som en fysisk barriär och beskyddare av kroppen och reglerar kroppsliga funktioner. Biomimetik är imitation av de modeller, system och delar av naturen i syfte att lösa komplexa mänskliga problem1. Huden Biomimetik är ett användbart verktyg för in vitro-Sjukdomforskning och Invivo regenerativ medicin. Mänskliga inducerade pluripotenta stamceller (iPSCs) har kännetecken av obegränsad proliferation och differentiering förmåga att tre groddar lager. Mänskliga iPSCs genereras från olika primära celler, blodkroppar, keratinocyter, fibroblaster och mer. Bland dem, har mononukleära celler navelsträngsblod (CBMCs) kommit att bli en alternativ cell källa från perspektiv av allogena regenerativ medicin. CBMCs är användbara i regenerativ medicin eftersom humant leukocyt antigen (HLA) att skriva är nödvändigt till cellen banksystemet. Vi tillhandahåller en metod för differentiering av CBMC-iPSCs till keratinocyter och fibroblaster och för generering av en 3D hud organoid. CBMC-iPSC-härledda keratinocyter och fibroblaster har liknande egenskaper som en primär cell fodrar. De 3D hud organoids genereras genom att lägga till en epidermal lager på ett dermal lager. Genom omplantering denna 3D hud organoid, genereras en humaniserade möss modell. Denna studie visar att en 3D människohud som iPSC-derived organoid kan vara en roman, alternativa verktyg för Dermatologisk forskning in vitro- och in vivo.

Introduction

Huden täcker den yttersta ytan av kroppen och skyddar inre organ. Huden har olika funktioner, inklusive skydda mot patogener, absorbera och lagra vatten, reglera kroppstemperaturen och utsöndra kroppen avfall2. Hudtransplantation kan klassificeras beroende på källan som huden; ympkvistar använder hud från en annan givare kallas organtransplantationer och ympkvistar använder patientens egen huden är delad. Även om en autograft är den föredragna behandlingen på grund av dess låga avvisande risk, är hud biopsier svåra att utföra på patienter med svåra skador eller ett otillräckligt antal hudceller. Hos patienter med svåra brännskador är tre gånger antalet hudceller nödvändiga för att täcka stora områden. Den begränsade tillgången av hudceller från en patients kropp resulterar i situationer där allogenous transplantation är nödvändigt. En transplantatavstötning används tillfälligt tills autolog transplantation kan utföras eftersom det är oftast avvisas av värdens immunförsvar efter cirka 1 vecka3. För att övervinna förkastande av patientens immunförsvar, måste transplantat komma från en källa med samma immun identitet som den tålmodiga4.

Mänskliga iPSCs är en framväxande källa av celler för stamceller terapi5. Mänskliga iPSCs genereras från kroppsceller, använda omplanering faktorer såsom OCT4, SOX2, Klf4 och c-Myc6. Använder mänskliga iPSCs övervinner de etiska och immunologiska problem av embryonala stamceller (råden)7,8. Mänskliga iPSCs har pluripotency och kan differentieras till tre groddar lager9. Förekomst av HLA, en kritisk faktor inom regenerativ medicin, avgör immunsvaret och möjligheten till förkastande10. Användning av patientderiverade iPSCs löser problemen med cell-source begränsning och immunsystemet förkastande. CBMCs har också dykt upp som en alternativ cell källa för regenerativ medicin11. Obligatoriska HLA maskinskrivning, som uppstår under återstående bank, kan enkelt användas för forskning och transplantation. Ytterligare, homozygot HLA-typ iPSCs kan ofta gälla olika patienter12. En CBMC-iPSC bank är en ny och effektiv strategi för cellterapi och prövningar regenerativ medicin12,13,14. I denna studie, vi använder CBMC-iPSCs, differentierade keratinocyter och fibroblaster, och generera stratifierat 3D hudlagren. Resultaten från denna studie tyder på att en CBMC-iPSC-härledda 3D hud organoid är ett nytt verktyg för in vitro- och in vivo Dermatologisk forskning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla förfaranden som involverar djur utfördes enligt lagen om laboratorium djur välfärd, guiden för skötsel och användning av försöksdjur, och de riktlinjer och Policies för gnagare experiment som tillhandahålls av den institutionella Animal Care och Använd kommittén (IACUC) av School of Medicine vid katolska universitetet i Korea. Studieprotokollet godkändes av den institutionella Review Board av den katolska universitet i Korea (CUMC-2018-0191-01). IACUC och den avdelning av laboratorium djur (DOLA) Koreas katolska universitet, Songeui Campus ackrediterade den Korea Excellence djur laboratorium anläggningen i Korea Food and Drug Administration i 2017 och förvärvade föreningen för bedömning och Ackreditering av Laboratory Animal Care International (AAALAC) internationella full ackreditering 2018.

1. huden celldifferentiering från inducerade pluripotenta stamceller

  1. Medelstora förberedelse
    Obs: Förvara alla medium vid 4 ° C i en mörk miljö för upp till 3 månader. Filtrera alla medium med ett 0,22 μm polyetersulfon filtersystem före användning för sterilisering. Alla medium var tillgänglig i en total volym på 500 mL.
    1. Förbereda KDM1 (keratinocyter differentiering medium 1). Mix Dulbeccos modifierade örnens Medium (DMEM) / F12 medium (3:1) med 2% fetalt bovint serum (FBS), 0,3 mmol/L L-askorbinsyra, 5 μg/mL insulin och 24 µg/mL adenin.
    2. Förbereda KDM2 (keratinocyter differentiering medium 2). Blanda definieras keratinocyter serumfritt medium (se Tabell för material) med 0,3 mmol/l L-askorbinsyra, 5 μg/mL insulin och 10 μg/mL adenin.
      Obs: Definierade keratinocyter serumfritt medium är optimerad för att stödja tillväxt och expansion av keratinocyter.
    3. Förbereda KDM3 (keratinocyter differentiering medium 3). Blanda definieras keratinocyter serumfritt medium och keratinocyter serumfritt medium (1:1) se Tabell av material för detaljer.
      Obs: Keratinocyter serumfritt medium är optimerad för tillväxt och underhåll av keratinocyter.
    4. Förbereda FDM1 (fibroblast differentiering medium 1). Blanda DMEM/F12 medium (3:1) med 5% FBS, 5 μg/mL insulin, 0,18 mM adenin och 10 ng/mL epidermal tillväxtfaktor (EGF).
    5. Förbereda FDM2 (fibroblast differentiering medium 2). Blanda DMEM/F12 medium (1:1) med 5% FBS och 1% onödiga aminosyror.
    6. Förbereda EP1 (epitelial medium 1). Blanda DMEM/F12 (3:1) med 4 mM L-glutamin, 40 μM adenin, 10 μg/mL transferrin, 10 μg/mL insulin och 0,1% FBS.
    7. Förbereda EP2 (epitelial medium 2). Blanda EP1 och 1,8 mM kalciumklorid.
    8. Förbereda EP3 (epitelial medium 3, cornification medium). Blanda F12 medium med 4 mM L-glutamin, 40 μM adenin, 10 μg/mL transferrin, 10 μg/mL insulin, 2% FBS och 1,8 mM kalciumklorid.
  2. Embryonala kroppen generation
    1. Generera CBMC-iPSCs använda protokollet visas i en tidigare studie12.
    2. Coat kultur rätter, med aktiebolaget trav & galopp. Förbereda 5 mL att belägga en 100 mm maträtt.
      1. Tina och resuspendera 50 μL 0,5 mg/mL aktiebolaget trav & galopp (slutlig koncentration: 5 µg/mL) med 5 mL steril fosfatbuffrad koksaltlösning (PBS). Lägg till lösningen till rätter och inkubera vid rumstemperatur (RT) för 1 h. aspirera beläggning materialet före användning (inte torkar ut).
    3. Upprätthålla de återstående-derived iPSCs till aktiebolaget trav & galopp-belagd 100 mm platta och ändra iPSC medium (E8) dagligen vid 37 ° C med 10% CO2.
    4. Generera embryonala organ (EBs) använda protokollet visas i en tidigare studie15 (beskrivs kortfattat följande). Expandera iPSCs genom att ändra medlet tills cellerna har nått 80% sammanflödet. På 80% confluence, ta bort mediet och tvätta med PBS.
    5. Behandla cellerna med 1 mL av 1 mM etylendiamintetraättiksyrans dinatriumsalt (EDTA). Inkubera vid 37 ° C med 5% CO2 i 2 min och skörda de celler som använder 3 mL E8 medium. Centrifugera cellerna vid 250 x g i 2 min.
    6. Aspirera supernatanten och applicera 5 mL E8 medium till cellerna. Räkna cellerna med hjälp av en hemocytometer och överföra 1 x 106 celler till en ny 15 mL koniska tub. Centrifugera cellerna vid 250 x g i 2 min.
    7. Att resuspendera överförda cellerna med 2,5 mL EB bildandet medium med 10 μM Rho-associerade (ROCK) tyrosinkinashämmare. Släpp 1 x 104 celler (25 µL/droppe) på en noncoated kultur plattan locket med hjälp av en flerkanalspipett för 10 – 100 μL. Form 100 EBs från 1 x 106 celler (1 x 104 celler/1 EB). Vänd skålen och hänga på droplet-programmet i locket.
      Obs: ROCK-hämmare behövs under fastsättning steg i processen underhåll och differentiering. Lägg till den ROCK-hämmaren först vid EB aggregering.
    8. Inkubera vid 37 ° C med 5% CO2 droppar i 1 dag.
    9. Nästa dag, skörda 100 EBs och använda dem för differentiering. Tvätta locket på tallrik med iPSC medium (E8 medium) eller PBS och skörda dess innehåll till en 50 mL konisk tub. Upprätthålla EBs på RT för 1 min att bosätta dem. Aspirera supernatanten och återsuspendera EBs med E8 medium behålla dem i en 90 mm petriskål tills differentiering.
  3. Differentiering av CBMC-iPSCs till keratinocyter
    Obs: För ett system av keratinocyter differentiering från CBMC-iPSCs, se figur 1.
    1. Skörden 100 EBs till en 50 mL konisk tub med iPSC medium eller PBS. Underhåll på RT för 1 min att bosätta sig på EBs. Kontrollera de lösa på botten av koniska röret. Aspirera supernatanten och återsuspendera EBs med E8 medium med 1 ng/mL benmorfogent protein 4 (BMP4). Överföra EBs till en 90 mm petriskål och behålla dem vid 37 ° C med 5% CO2 för 1 dag.
    2. Coat kultur rätter, med typ IV kollagen. Förbereda 5 mL av typ IV kollagen att belägga en 100 mm maträtt.
      1. Tina och resuspendera typ IV kollagen lösning (slutlig koncentration: 50 µg/mL) med 0,05 N HCl. Tillsätt lösningen till rätter och inkubera vid RT för 1 h. aspirera beläggning materialet före användning (inte torkar ut).
        Obs: Innan du använder plattorna, diska 3 x med PBS ta bort någon syra.
    3. Skörda EBs (steg 1.3.1) till en 50 mL konisk tub och bibehålla dem vid RT för 1 min att bosätta dem. Kontrollera de bosätta sig på botten av koniska röret, aspirera supernatanten och återsuspendera EBs i 6 mL KDM1 med 10 µM ROCK-hämmare. Överföra EBs till typ IV kollagen-belagd 100 mm skålen.
      Obs: Lägg till den ROCK-hämmaren först vid EB fastsättning.
    4. Dagar och 0 – 8 ändra medium varannan dag till KDM1 med 3 µM retinoinsyra (RA) och 25 ng/mL varje BMP4 och EGF. Upprätthålla EBs vid 37 ° C med 5% CO2.
    5. Mellan dagar 9 – 12, ändra medium varannan dag till KDM2 med 3 µM RA, 25 ng/mL BMP4 och 20 ng/mL EGF.
    6. Mellan dagar 13 – 30, ändra medium varannan dag till KDM3 med 10 ng/mL BMP4 och 20 ng/mL EGF.
  4. Differentiering av CBMC-iPSC in fibroblaster
    Anmärkning: För ett system av fibroblast differentiering från CBMC-iPSCs, se figur 2A.
    1. Coat kultur rätter, med basalmembranet matris. Förbereda 5 mL att belägga en 100 mm maträtt.
      1. Tina basalmembranet matrisen (slutliga koncentration: 600 ng/mL) och späd med DMEM/F12 medium. Lägg till lösningen till rätter och inkubera vid 37 ° C i 30 min. aspirera beläggning materialet före användning (inte torkar ut).
    2. Skörden 100 EBs till en 50 mL konisk tub med pipett med iPSC medium eller PBS. Underhåll på RT för 1 min att bosätta sig på EBs. Säkerställa de lösa på botten av koniska röret. Ta bort supernatanten.
    3. Återsuspendera EBs med 1000 µL pipett i 6 mL FDM1 med 10 µM ROCK-hämmare. Överföra EBs (med medium) till en basalmembranet matrix-belagd 100 mm maträtt och inkubera vid 37 ° C med 5% CO2. Uppdatera FDM1 varannan dag i 3 dagar.
      Obs: Endast lägga till den ROCK-hämmaren skede bilaga EB.
    4. Lägg till 0,5 nM benmorfogent protein 4 (BMP 4) i FDM1 mellan dag 4 och 6.
    5. Dag 7, ändra mediet till FDM2 varannan dag i 1 vecka.
    6. Dag 14, tillsätt 1 mL av 1 mM EDTA och inkubera vid 37 ° C med 5% CO2 för 2 min. skörda cellerna med 3 mL FDM2 och centrifugera vid 250 x g för 2 min. avlägsna supernatanten och återsuspendera cellerna i 5 mL av FDM1.
    7. Räknar de celler som använder en hemocytometer, omsuspendera 2 x 106 celler med FDM1 medium och överföra cellerna till noncoated skålen. Upprätthålla cellerna vid 37 ° C med 5% CO2 och ändra medium varannan dag.
    8. Coat kultur rätter, med typ I-kollagen. Förbereda 5 mL att belägga en 100 mm maträtt. Späd typ I kollagen lösning (slutlig koncentration: 50 µg/mL) i 0,02 N ättiksyra. Lägg till lösningen till rätter och inkubera vid RT för 1 h. aspirera beläggning materialet före användning (inte torkar ut).
      Obs: Innan du använder plattorna, diska 3 x med PBS ta bort syran.
    9. På dag 21, tillsätt 1 mL av 1 mM EDTA och inkubera vid 37 ° C med 5% CO2 för 2 min. skörda cellerna med 3 mL FDM1 och centrifugera vid 250 x g för 2 min. avlägsna supernatanten och återsuspendera cellerna i 5 mL av FDM1. Räkna cellerna med hjälp av en hemocytometer och överföring 2 x 106 celler till typ I kollagen-belagd 100 mm maträtt med FDM1 medium. Upprätthålla cellerna vid 37 ° C med 5% CO2 och ändra medium varannan dag.
    10. Dag 28, tillsätt 1 mL av 1 mM EDTA och inkubera vid 37 ° C med 5% CO2 för 2 min. skörda cellerna med 3 mL FDM1 och centrifugera vid 250 x g för 2 min. avlägsna supernatanten och återsuspendera cellerna i 5 mL av FDM1. Räknar de celler som använder en hemocytometer och överföra 2 x 106 celler till en noncoated maträtt med FDM1 medium. Upprätthålla cellen vid 37 ° C med 5% CO2 och ändra medium varannan dag.
      Obs: iPSC-derived fibroblaster föröka som en primär fibroblast cellinje och passage upp till 10 passager. I denna studie använde vi iPSC-derived fibroblaster av två till fem passager för vidare analys.

2. tillämpning av hiPSC-derived differentierade celler

  1. Generation av 3D hud organoid
    1. Förbereda neutraliserat typ I kollagen på isen, efter tillverkarens rekommendationer. Som slutlig koncentration, använda 3 mg/mL för typ I-kollagen (lager koncentration av typ I kollagen är 3.47 mg/mL), och kontrollera den slutliga volymen av blandningen är 5 mL. Beräkna volymen av 10 x PBS (slutlig volym/10 = 0,5 mL). Beräkna volymen av typ I-kollagen ska användas (slutlig volym x slutliga kollagen koncentration / aktiemarknaden kollagen koncentration = 5 mL x 3 mg / mL / 3.47 mg / mL = 4,32 mL). Beräkna volymen av 1 N NaOH (volym av kollagen användas x 0.023 mL = 0,1 mL). Beräkna volymen av dH2O (slutlig volym - volym av kollagen - volym 10 x PBS - volym 1 N NaOH = 5 mL - 4,32 mL-0,5 mL-0,1 mL = 0,08 mL). Blanda innehållet i röret och hålla det på is tills klar att använda.
    2. Tillsätt 1 mL av EDTA till iPSC-derived fibroblaster från steg 1.4.10 och inkubera vid 37 ° C med 5% CO2 för 2 min. skörda fristående cellerna, räkna cellerna med hjälp av en hemocytometer och överföra 2 x 105 celler till en ny 15 mL koniska tub. Centrifugera vid 250 x g i 2 min och avlägsna supernatanten. Omsuspendera cellerna i iPSC-derived fibroblaster i 1,5 mL FDM1 och neutraliseras typ I kollagen lösning (1:1).
      Obs: Blanda lösningen försiktigt för att undvika bubblor.
    3. Placera membran insatsen på en 6-väl mikroplattan, överför blandningen till infoga och inkubera vid RT i 30 min.
      Obs: Flytta inte plattorna.
    4. När du har bekräftat gelation, tillsätt 2 mL av medium till toppen av den infoga och 3 mL till botten av brunnen. Inkubera i matrisen av fibroblaster och kollagen vid 37 ° C med 5% CO2 i 5-7 dagar, tills gelation är klar och inte längre kontrakt.
    5. Efter den kompletta gelation, lossa den iPSC-derived keratinocyter (från steg 1.3.6) med EDTA. Tillsätt 1 mL av EDTA och inkubera vid 37 ° C med 5% CO2 för 2 min. skörda fristående cellerna, räkna dem med en hemocytometer och överföra 1 x 106 celler till en ny 15 mL koniska tub. Centrifugera vid 250 x g under 2 minuter.
    6. Avlägsna supernatanten och återsuspendera 1 x 106 celler i 50-100 µL av låg kalcium epitelial medium 1 (EP1).
    7. Aspirera alla medium i matrisen (se steg 2.1.5) och utsäde 1 x 106 celler av den iPSC-derived keratinocyter på varje fibroblast lager. Inkubera plattan vid 37 ° C med 5% CO2 för 30 min.
      Obs: Flytta inte plattan och Lägg inte till något medium för fastsättning av keratinocyter.
    8. Tillsätt 2 mL av EP1 till toppen av insatsen och 3 mL EP1 till botten av brunnen.
    9. Efter 2 dagar, aspirera alla medium i membran infoga plattan och ändra mediet till normal kalcium EP2 för 2 dagar.
    10. Efter 2 dagar, sug ut alla medium och 3 mL cornification mediet bara lägga till botten för att generera ett luft-vätska-gränssnitt.
    11. Upprätthålla den 3D hud organoid för upp till 14 dagar vid 37 ° C med 5% CO2 och ändra medium varannan dag. Skörda den 3D hud organoid genom att skära kanten av insatsen, och använda det för ytterligare en studie av färgning och hudtransplantation.
  2. Hudtransplantation
    1. Utföra inandning anestesi på nicka/scid möss (hane, 6 veckor gamla), med en standard, institutionellt godkänd metod. För hudtransplantation, raka päls av varje musens dorsala huden.
    2. Ta bort ett 1 x 2 cm avsnitt av musens hud, med böjd sax med pincett.
    3. Placera de återstående-iPSC-härledda 3D hud organoid på defekten och sutur med en slips-over dressingen metod med siden suturer.
    4. Observera möss i 2 veckor och offra dem för histologisk analys. Färgning protokollet verifierades i tidigare studier16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Huden består för det mesta, av epidermis och dermis. Keratinocyter är den huvudsakliga Celltypen i överhuden, och fibroblaster är den huvudsakliga celltypen av dermis. Ordningen av keratinocyter differentiering visas i figur 1A. CBMC-iPCSc bibehölls en aktiebolaget trav & galopp-belagd maträtt (figur 1B). I denna studie differentierat vi CBMC-iPSCs till keratinocyter och fibroblaster använder EB bildandet. Vi genererat EBs med hängande droppe metod för att säkerställa en enhetlig och kontrollerade differentiering av keratinocyter och fibroblaster (figur 1C). EBs fästes skriver IV kollagen-belagda plattor för keratinocyter differentiering och medlet var ändras dagligen. CBMC-iPSCs behandlades med RA, BMP4 och EGF. CBMC-iPSCs var åtskild till keratinocyter. Under differentieringen, av de återstående-iPSC-härledda keratinocyter morfologi förändrats över tid (kompletterande figur1).

CBMC-iPSC-härledda keratinocyter har morfologier liknar primära keratinocyter (figur 1D). Genuttrycket av pluripotenta marker OCT4 var nedreglerade i CBMC-iPSC-härledda keratinocyter. Primer sekvenser visas i tabell 1. Uttrycket av keratinocyter markörer Np63, KRT5 och KRT14 ökades i CBMC-iPSC-härledda keratinocyter (figur 1F). CBMC-iPSC-härledda keratinocyter bekräftades av uttryck för Np63 och KRT14 av immunohistokemi (figur 1E). Dessa resultat bekräftas att återstående-iPSC-härledda keratinocyter har egenskaper av primära keratinocyter.

Systematiken i fibroblast differentiering visas i figur 2A. Vi har också underhålls CBMC-iPSCs i en aktiebolaget trav & galopp-belagd maträtt och används EB bildandet för fibroblast differentiering (figur 2B, C). Vi kopplade EBs till basalmembranet matrix-belagda plattor och bytte medium varannan dag. Utväxt celler överfördes till noncoated och typ I-kollagen-belagda plattor. CBMC-iPSCs var åtskild till fibroblaster. Under differentieringen, av CBMC-iPSC-härledda fibroblaster morfologi förändrats över tid (kompletterande figur 2).

CBMC-iPSC-härledda fibroblaster har morfologier liknar primära fibroblaster (figur 2D). Uttrycket av pluripotenta stamceller markör OCT4 var nedreglerade i CBMC-iPSC-härledda fibroblaster. Fibroblast markörer för COL1A1, COL1A2, COL3A1 och CD44 var uppreglerad i CBMC-iPSC-härledda fibroblaster (figur 2F). Primer sekvenser visas i tabell 1. Också, CBMC-iPSC-härledda fibroblaster bekräftades av uttryck för vimentin och Fibronektin av immunohistokemi (figur 2E). Dessa resultat tyder på att CBMC-iPSC-härledda fibroblaster är liknar primära fibroblaster.

Genererade vi en 3D hud organoid använder CBMC-iPSC-härledda keratinocyter och fibroblaster. Systematiken i bildandet av den 3D hud organoid visas i figur 3A. Genererade vi en 3D hud organoid på en membran infoga tallrik. För 3D kulturen, var CBMC-iPSC-härledda fibroblaster stratifierade med typ I kollagen och överdrog med CBMC-iPSC-härledda keratinocyter. Efter sådd den återstående-iPSC-härledda keratinocyter, har på medellång ändrats till en normal kalciumkoncentration i 2 dagar. Efter 2 dagar lades en hög kalcium koncentration medium endast till den lägsta kammaren för bildandet av luft-vätska gränssnitt kultur. Luft-vätska gränssnitt kulturen inducerad mognad och stratifiering av keratinocyter. Tjockleken på den 3D hud organoid ökades under 3D kultur. Dessa resultat bekräftas att den 3D hud organoid genererades från iPSC-derived keratinocyter och fibroblaster av hematoxylin och eosin (H & E) färgning (figur 3C).

Använda de återstående-iPSC-härledda 3D hud organoid, genererade vi en humaniserade möss modell (figur 3B) genom ympning det 3D hud organoid till möss. 1 x 2 cm defekt förmåddes och tie-over metoden användes för transplantation. Efter 2 veckor, transplanterade huden var effektivt ympade till möss, och vi bekräftade detta med H & E och immunocytochemical analys (figur 3D). Keratinocyter mognad och epidermal differentiering markörerna för loricrin och KRT14 uttrycktes i de återstående-iPSC-härledda 3D hud organoids (figur 3E). De återstående-iPSC-härledda 3D hud organoids var funktionellt differentierade, ympade effektivt på möss och effektivt läkt möss hud defekter.

Figure 1
Figur 1 : Keratinocyter differentiering av CBMC-iPSCs. (A) systemet av keratinocyter differentiering från CBMC-iPSCs. (B och C) morfologi av återstående-iPSCs (panel B) och iPSC-derived EBs (panel C). (D) morfologi av den återstående-iPSC-härledda keratinocyter. (E) Immunocytochemical analys av Np63 (röd) och KRT14 (grön), tillsammans med DAPI färgning (blå). Skala barer = 100 μm. (F) genuttryck av pluripotenta markör och keratinocyter markörer för iPSC-derived keratinocyter (iPSC-Ks). Graferna visar genomsnittliga med SEM av fem oberoende prover. Skillnader mellan grupper undersöktes för statistisk signifikans med Student's t-test. T-test användes för att analysera icke-parametriska kvantitativa datamängder och det ensidiga p-värdet beräknades (*p < 0,05, **p < 0,01, ***p < 0,001 anges statistisk signifikans). Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Fibroblast differentiering av CBMC-iPSCs. (A) systemet av fibroblast differentiering från CBMC-iPSCs. (B och C) morfologi av återstående-iPSCs (panel B) och iPSC-derived EBs (panel C). (D) morfologi av återstående-iPSC-härledda fibroblaster. (E) Immunocytochemical analys av vimentin (röd) och Fibronektin (röd), tillsammans med DAPI färgning (blå). Skala barer = 100 μm. (F) genuttryck av pluripotenta markör och fibroblast markörer för iPSC-derived fibroblast (iPSC-Fs). Graferna visar genomsnittliga med SEM av fem oberoende prover. Skillnader mellan grupper undersöktes för statistisk signifikans med Student's t-test. T-test användes för att analysera icke-parametriska kvantitativa datamängder och det ensidiga p-värdet beräknades (*p < 0,05, **p < 0,01, ***p < 0,001 anges statistisk signifikans). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Generation CBMC-iPSC-härledda hud organoid och humaniserade möss modell. (A) Schematisk bild av genereringsprocessen iPSC-derived hud organoid (iSO). (B) Transplantation av iSO i möss. (C) histologisk analys av in vitro-iSO. (D) histologisk analys av transplanterade iSO Invivo. (EH) Immunocytochemical analys av loricrin och KRT14. HÅNA kontroll (panel E), transplanterade iSO (panel F, loricrin), möss hud (negativ kontroll, panelen G), transplanterade iSO (panelen H, KRT14). Skala barer = 200 μm. Klicka här för att se en större version av denna siffra.

Supplementary Figure 1
Kompletterande figur 1: morfologi av iPSC-derived keratinocyter. Klicka här för att se en större version av denna siffra.

Supplementary Figure 2
Kompletterande figur 2: morfologi av iPSC-derived fibroblaster. Klicka här för att se en större version av denna siffra.

Målets namn Riktning Primer sekvens (5' - 3') Storlek (baspar) Refseq_ID
OCT4 Framåt
Omvänd
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Framåt
Omvänd
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Framåt
Omvänd
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Framåt
Omvänd
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Framåt
Omvänd
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Framåt
Omvänd
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Framåt
Omvänd
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Framåt
Omvänd
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Framåt
Omvänd
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Framåt
Omvänd
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin Framåt
Omvänd
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Framåt
Omvänd
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabell 1: Sekvenser av primers används för kvantitativ realtids polymeras-kedjereaktion.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Mänskliga iPSCs har föreslagits som ett nytt alternativ för personlig regenerativ medicin17. Patientderiverade personlig iPSCs speglar patientens egenskaper som kan användas för sjukdom modellering, drogkontroll och autolog transplantation18,19. Användning av patientderiverade iPSCs kan också övervinna problemen när det gäller primära celler, en brist på adekvat cell nummer och immunreaktioner5,17,19. Generering av personliga iPSCs är dock inte ekonomiskt genomförbara på grund av tid, kostnad och arbete begränsningar. HLA-homozygot CBMC-derived iPSCs har dykt upp som en ny möjlighet. HLA-homozygot iPSCs kan vara ekonomiskt värdefull och kan tillämpas på ett stort antal patienter8,11,12,13. Dessutom inträffar HLA-typning av CBMCs under cell bank lagring, vilket gör dem enkla att använda för forskning och transplantation. Protokoll differentieras CBMC-iPSCs till hjärtmuskelcellerna, hepatocyter och kondrocyter har varit rapporterade16,20,21,22,23.

Epidermal och dermal lager är beståndsdelarna i huden. Överhuden består av keratinocyter och dermis består av fibroblaster. Så, vi differentierat CBMC-iPSCs till keratinocyter och fibroblaster, respektive. För differentiering, uniformerad, välkontrollerade och optimerad EBs genererades av hängande droppe metod15,24. Typ IV kollagen är en viktig komponent i basalmembranet. För keratinocyter differentiering fästes EBs skriver IV kollagen-belagd rätter. CBMC-iPSC-härledda keratinocyter hade en kullersten-liknande morfologi (figur 1D). Keratinocyter markörer Np63 och KRT14 uttrycktes i iPSC-Ks (figur 1E, F). Resultatet bekräftade att RA och BMP4 inducerad av uppreglering av keratinocyter markörer. Dessutom var CBMC-iPSCs differentieras efter keratinocyter liknar primära keratinocyter.

För fibroblast differentiering, EBs fästes till basalmembranet matrix-belagda plattor och differentierade cellerna var seriellt överförda på noncoated och typ I-kollagen-belagda plattor. En seriell subkultur förmåddes att ange fibroblast differentiering. Fibroblaster producerade en extracellulär matrix (ECM) som hade migration och vidhäftning funktioner. Fibroblaster producerar även rikligt kollagen komponenter25. I CBMC-iPSC-härledda fibroblaster ökades den fibroblast ytan markören CD44. Uttrycket av kollagen var uppreglerad i iPSC-Fs (figur 2F). Uttrycket av Fibronektin och vimentin ökades i iPSC-Fs (figur 2E).

Med hjälp av differentierade keratinocyter och fibroblaster, genererade vi CBMC-iPSC-härledda hud organoids (figur 3A). Vi använde en luft-vätska gränssnitt kultur med en hög-kalcium-medium som inducerad stratifierade lager av CBMC-iPSC-härledda hud organoids. Den höga koncentrationen av kalcium var nödvändigt för keratinocyter mognad in vivo och in vitro-, medan luft-vätska gränssnittet användes för att utveckla multilayered strata26,27,28. Vi använde denna metod för att efterlikna verkliga huden, samt histologiska analysen visade att huden stratifierades (figur 3C). För att bekräfta att sårläkning, transplanterade vi iSO in möss huden, tie-over dressingen metoden (figur 3D). Efter transplantation, de huden organoids var effektivt ympade och helade möss huden tillräckligt. KRT14 uttrycktes i de basala lagret av stratifiera skivepitelcancer och nonsquamous epitel. Loricrin är en huvudkomponent i hornlagret Funna i terminalt differentierade och keratiniserad epitelceller29,30. Den epidermala differentiering markören för loricrin uttrycktes i transplanterade huden. Uttryck för KRT14 och loricrin bekräftade att den huden organoid var fullt mogen och differentiering demonstrerades genom immunhistokemisk färgning (figur 3E).

I denna studie utvecklade vi ett protokoll för att skilja CBMC-iPSCs till keratinocyter och fibroblaster, de viktigaste celltyper av mänsklig hud. Vi bekräftade att de återstående-iPSC-härledda keratinocyter och fibroblaster visade fenotyper liknar primära cellinjer. Använder dessa differentierade celler, vi genereras en 3D hud organoid och ympade det i nicka/scid möss med metoden tie-over dressingen. Denna ursprungliga teknik beskrevs först 1929 av Blair och brun och vanligen har använts för hudtransplantation31,32. Denna metod förhindrade att transplantatet flyttar, gynnade en bra vidhäftning till såret, och således accelererade vävnad healing. Histologisk analys bekräftat att den 3D hud organoid härmade en mänsklig hud fenotyp som framgångsrikt skiktade och mognat under 2 veckor. Hudtransplantation görs generellt med enstaka celler av keratinocyter och fibroblaster av kisel bubbelkammare33,34. Detta system är lätt att ympa men vi behövde mer tid för observerade till transplantation effektivitet efter transplantat. Plast eller silikon kammaren fungerar som en barriär mot mösss hud. De 3D hud organoid system-derived iPSCs Använd inte en plast eller silikon kammare. I detta system var transplantation effektivt. Det var dock svårt att blockera den naturliga läkningsprocessen av möss. Så, mössens hud omfattas många delar av iSO för en lång tid efter transplantation. Detta är en del av metoden presenteras här som måste förbättras.

Sammanfattningsvis är CBMC-iPSCs en potentiell cell källa för transplantat. Använda dessa protokoll, CBMC-iPSC-härledda keratinocyter, kan fibroblaster, och en 3D hud organoid användas i studier relaterade till dermatologi, läkemedel och kosmetiska screening och regenerativ medicin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöds av ett bidrag från Korea hälso-och sjukvård teknik R & D projekt, ministeriet för hälsa, välfärd och familjefrågor, Sydkorea (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics