Génération de peau 3D Organoïde de dérivés du sang de cordon induite par les cellules souches pluripotentes

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous vous proposons un protocole qui montre comment différencier des fibroblastes et des kératinocytes de dérivés de cellules souches pluripotentes induites et générer un organoïde peau 3D, à l’aide de ces kératinocytes et des fibroblastes. Ce protocole comporte une étape supplémentaire de la génération d’un modèle de souris humanisées. La technique présentée ici permettra d’améliorer la recherche dermatologique.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La peau est l’organe du plus grand et a de nombreuses fonctions. La peau agit comme une barrière physique et protecteur du corps et régule les fonctions corporelles. Biomimetics est l’imitation des modèles, systèmes et éléments de la nature dans le but de résoudre des problèmes complexes de l’homme1. Peau biomimetics est un outil utile pour la recherche sur les maladies in vitro et in vivo en médecine régénérative. Les cellules souches humaines pluripotentes induites (CISP) ont la particularité de la prolifération illimitée et la capacité de différenciation à trois couches de germe. CISP humaine est générés à partir des divers éléments primaires, telles que les cellules sanguines, les kératinocytes, fibroblastes, etc.. Parmi eux, les cellules mononucléaires de sang de cordon (CBMCs) ont émergé comme une source de cellules alternative du point de vue de la médecine régénérative allogénique. CBMCs sont utiles en médecine régénérative parce que human leucocyte antigen (HLA) tapant est essentielle à la cellule système bancaire. Nous fournissons une méthode pour la différenciation des CBMC-CISP en kératinocytes et des fibroblastes et génération d’une peau 3D organoïde. Fibroblastes et des kératinocytes CBMC iPSC-dérivés ont des caractéristiques semblables à une ligne de cellules primaires. Les organoids de peau 3D sont générés en superposant une couche épidermique sur une couche dermique. Par la transplantation de cette organoïde peau 3D, un modèle de souris humanisées est généré. Cette étude montre qu’un organoïde 3D peau humaine d’iPSC dérivé peut être un outil nouveau, alternatif pour la recherche dermatologique in vitro et in vivo.

Introduction

La peau recouvre la surface extérieur du corps et protège les organes internes. La peau a des fonctions diverses, y compris la protection contre les agents pathogènes, d’absorber et de stocker de l’eau, régulation de température du corps et excréter l’organisme des déchets2. Greffes de peau peuvent être classés selon la source de la peau ; greffes à l’aide de la peau d’un autre donneur sont appelés des allogreffes et greffes à l’aide de la peau du patient sont des autogreffes. Bien qu’une autogreffe est privilégiée dans le traitement en raison de ses risques de rejet faible, biopsies de la peau sont difficiles à effectuer sur des patients atteints de lésions graves ou un nombre insuffisant de cellules de la peau. Chez les patients atteints de graves brûlures, trois fois le nombre de cellules de peau est nécessaire pour couvrir de grandes surfaces. La disponibilité limitée des cellules de la peau du corps du patient se traduit dans les situations où les transplantations allogéniques sont nécessaire. Une allogreffe est utilisée temporairement jusqu'à ce que la greffe autologue est possible puisqu’il est généralement rejeté par le système immunitaire de l’hôte après environ 1 semaine3. Pour surmonter le rejet par le système immunitaire du patient, greffes doivent provenir d’une source avec la même identité immunitaire comme le patient4.

CISP humaine est une source émergente de cellules des cellules souches thérapie5. CISP humaine est générés à partir des cellules somatiques, à l’aide de facteurs de reprogrammation comme OCT4, SOX2, Klf4 et c-Myc,6. À l’aide de CISP humaine permet de surmonter les enjeux éthiques et immunologiques des cellules souches embryonnaires (CSE)7,8. CISP humaine ont pluripotence et peut se différencier en trois couches de germe9. La présence de HLA, un facteur critique dans la médecine régénérative, détermine la réponse immunitaire et la possibilité de rejet10. L’utilisation de dérivés de patient CISP résout les problèmes de rejet de la limitation et le système immunitaire cellulaire-source. CBMCs ont également émergé comme une source de cellule de rechange pour la médecine régénérative,11. Obligatoire HLA typage, qui survient au cours d’opérations bancaires CBMC, peut facilement être utilisé pour la recherche et de la transplantation. En outre, homozygote de type HLA CISP peut largement applicable à divers patients12. Une banque de CBMC-iPSC est un roman et une stratégie efficace pour la thérapie cellulaire et médecine régénératrice allogénique12,13,14. Dans cette étude, nous utiliser CBMC-CISP, se différencient en kératinocytes et des fibroblastes et générer des couches stratifiées de peau 3D. Les résultats de cette étude suggèrent qu’un organoïde CBMC iPSC-dérivé de peau 3D est un nouvel outil de recherche dermatologique in vitro et in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les procédures impliquant des animaux ont été réalisés conformément à la loi sur la protection des animaux du laboratoire, le Guide pour le soin et l’utilisation des animaux de laboratoire, et les lignes directrices et des politiques pour l’expérimentation de rongeur fourni par l’animalier institutionnel et Use Committee (IACUC) de l’école de médecine de l’Université catholique de Corée. Le protocole de l’étude a été approuvé par la Commission de révision institutionnelle de l’Université catholique de Corée (CCEM-2018-0191-01). L’IACUC et le département de laboratoire animaux (DOLA) de l’Université catholique de Corée, Songeui Campus accrédités par le laboratoire de Corée Excellence Animal de la Korea Food and Drug Administration en 2017 et acquis de liaison pour l’évaluation et Accréditation d’accréditation International Laboratory Animal Care International (AAALAC) en 2018.

1. peau la différenciation cellulaire des cellules souches pluripotentes induites

  1. Moyenne préparation
    NOTE : Stocker tous les moyen à 4 ° C dans l’obscurité pendant 3 mois. Filtrer tous les moyens en utilisant un système de filtre de 0,22 μm polyéthersulfone avant de l’utiliser pour la stérilisation. Tous les moyen n’était disponible dans un volume total de 500 mL.
    1. Préparer KDM1 (moyen de différenciation des kératinocytes 1). Moyenne (DMEM de l’aigle de la modification de mix Dulbecco) / F12 moyen (3:1) avec 2 % sérum fœtal (SVF), 0,3 mmol/L d’acide L-ascorbique, 5 μg/mL d’insuline et 24 adénine µg/mL.
    2. Préparer KDM2 (moyen de différenciation des kératinocytes 2). Mix définis sans sérum moyen des kératinocytes (voir la Table des matières) avec 0,3 mmol/l d’acide L-ascorbique, 5 μg/mL d’insuline et adénine de 10 μg/mL.
      Remarque : Des kératinocytes défini un milieu sans sérum est optimisé pour soutenir la croissance et l’expansion des kératinocytes.
    3. Préparer KDM3 (moyen de différenciation des kératinocytes 3). Mix défini un milieu sans sérum kératinocytes et kératinocytes milieu sans sérum (1:1) voir la Table des matières pour plus de détails.
      Remarque : Un milieu sans sérum kératinocytes est optimisé pour la croissance et l’entretien des kératinocytes.
    4. Préparer FDM1 (moyen de différenciation fibroblastique 1). Mix DMEM/F12 moyen (3:1) avec 5 % FBS, 5 μg/mL d’insuline, adénine 0,18 mM et 10 ng/mL facteur de croissance épidermique (EGF).
    5. Préparer FDM2 (moyen de différenciation fibroblastique 2). Mix DMEM/F12 moyen (1:1) avec 5 % SVF et 1 % acides aminés non essentiels.
    6. Préparer l’EP1 (épithélial moyen 1). Mix DMEM/F12 (3:1) avec 4 mM de L-glutamine, 40 adénine μM, 10 la transferrine μg/mL, 10 μg/mL d’insuline et 0,1 % FBS.
    7. Préparer EP2 (épithélial moyen 2). Mélanger EP1 et chlorure de calcium de 1,8 mM.
    8. Préparer EP3 (épithélial medium 3, moyen de kératinisation). F12 mix moyen avec 4 mM de L-glutamine, 40 μM adénine, 10 transferrine μg/mL, 10 μg/mL d’insuline, 2 % FBS et chlorure de calcium de 1,8 mM.
  2. Génération de corps embryonnaire
    1. Générer des CBMC-CISP en utilisant le protocole indiqué dans une précédente étude12.
    2. Manteau pétri, à l’aide de la vitronectine. Préparation de 5 mL pour recouvrir un plat de 100 mm.
      1. Décongeler et remettre en suspension dans 50 μl de la vitronectine 0,5 mg/mL (concentration finale : 5 µg/mL) avec 5 mL de sérum physiologique tamponnée au phosphate (PBS). Ajouter la solution aux plats et incuber à température ambiante (RT) pendant 1 h. aspirer le produit avant utilisation (pour ne pas dessécher).
    3. Maintenir le CISP CBMC dérivé à la vitronectine enduit 100 mm plaque et modifier le milieu de l’iPSC (E8) tous les jours à 37 ° C, avec 10 % de CO2.
    4. Générer des organes embryonnaires (EBs) en utilisant le protocole indiqué dans la précédente étude15 (décrit brièvement comme suit). Développez CISP en changeant le support jusqu'à ce que les cellules ont atteint 80 % confluence. Au confluent de 80 %, enlevez le milieu et laver avec du PBS.
    5. Traiter les cellules avec 1 mL de l’acide éthylènediaminetétraacétique (EDTA) de 1 mM. Incuber à 37 ° C, avec 5 % de CO2 pendant 2 min et récolter les cellules à l’aide de 3 mL de milieu de E8. Centrifuger les cellules à 250 x g pendant 2 min.
    6. Aspirer le surnageant et appliquer 5 mL de milieu de E8 aux cellules. Compter les cellules à l’aide d’un hémocytomètre et 1 x 106 cellules de transfert dans un nouveau tube conique de 15 mL. Centrifuger les cellules à 250 x g pendant 2 min.
    7. Remettre en suspension les cellules transférés avec 2,5 mL de milieu de formation EB avec inhibiteur de kinase associée à Rho (ROCK) 10 μM. Déposez 1 x 104 cellules (25 µL/drop) sur un couvercle de plaque de culture noncoated à l’aide d’une pipette multicanaux de 10 à 100 μL. Formulaire 100 EBs de 1 x 106 cellules (1 x 104 cellules/1 EB). Retournez le plat et accrocher sur la goutte sur le couvercle.
      NOTE : Inhibiteur de la roche est nécessaire au cours de l’étape de pièces jointes dans le processus de maintenance et de la différenciation. Ajouter l’inhibiteur ROCK qu’au stade de l’agrégation de EB.
    8. Incuber les gouttelettes à 37 ° C, avec 5 % de CO2 pendant 1 nuit.
    9. Le lendemain, récolter les 100 EBs et utilisez-les pour la différenciation. Nettoyez le couvercle de plaque avec iPSC milieu (milieu de E8) ou PBS et récolter son contenu dans un tube conique de 50 mL. Maintenir l’EBs à ta pendant 1 min à eux s’installent. Aspirer le surnageant et remettre en suspension l’EBs avec E8 moyen les maintenir dans une boîte de pétri de 90 mm jusqu'à la différenciation.
  3. Différenciation des CBMC-CISP en kératinocytes
    Remarque : Pour un schéma de la différenciation des kératinocytes de CBMC-CISP, voir Figure 1A.
    1. Récolte du 100 EBs dans un tube conique de 50 mL avec support iPSC ou PBS. Maintenir à ta pendant 1 min à l’EBs s’installent. Veillez à ce qu’ils s’installent au fond du tube conique. Aspirer le surnageant et remettre en suspension l’EBs avec E8 moyen avec 1 protéine morphogénétique de l’OS ng/mL 4 (BMP4). Transférer l’EBs vers un 90 mm boîte de Pétri et maintenir à 37 ° C, avec 5 % de CO2 pendant 1 nuit.
    2. Enrober les récipients de culture, à l’aide de collagène de type IV. Préparer 5 mL de collagène de type IV pour enduire un plat de 100 mm.
      1. Décongeler et remettre en suspension le type de solution de collagène IV (concentration finale : 50 µg/mL) avec 0,05 N HCl. Ajoutez la solution aux plats et incuber à RT pendant 1 h. aspirer le produit avant utilisation (pour ne pas dessécher).
        Remarque : Avant d’utiliser les plaques, laver la vaisselle 3 x avec PBS pour éliminer n’importe quel acide.
    3. Récolter l’EBs (étape 1.3.1) dans un tube conique de 50 mL et de les entretenir à ta pendant 1 min à eux s’installent. S’assurer qu’ils s’installent au fond du tube conique, aspirer le surnageant et remettre en suspension l’EBs dans 6 mL de KDM1 avec inhibiteur de ROCK 10 µM. Transférer l’EBs dans le type IV collagène-enduit 100 mm plat.
      NOTE : Ajouter l’inhibiteur ROCK qu’à l’étape de fixation EB.
    4. Entre 0 – 8 jours, changer le support de tous les autres jours à KDM1 par l’acide rétinoïque 3 µM (RA) et 25 ng/mL chacune de BMP4 et EGF. Maintenir l’EBs à 37 ° C, avec 5 % de CO2.
    5. Entre les jours de 9 à 12, remplacez le milieu alternats KDM2 avec 3 µM RA, 25 ng/mL BMP4 et 20 ng/mL EGF.
    6. Entre les jours de 13 à 30, modifier le milieu tous les deux jours KDM3 avec 10 ng/mL BMP4 et 20 ng/mL EGF.
  4. Différenciation des CBMC-iPSC en fibroblastes
    Remarque : Pour un schéma de la différenciation des fibroblastes de CBMC-CISP, voir Figure 2A.
    1. Manteau pétri, à l’aide de la matrice de la membrane basale. Préparation de 5 mL pour recouvrir un plat de 100 mm.
      1. Décongeler la matrice de la membrane basale (concentration finale : 600 ng/mL) et le diluer avec milieu DMEM/F12. Ajoutez la solution aux plats et incuber à 37 ° C pendant 30 min. aspirer le produit avant utilisation (pour ne pas dessécher).
    2. Récolte du 100 EBs dans un tube conique de 50 mL avec une pipette avec la moyenne de l’iPSC ou PBS. Maintenir à ta pendant 1 min à l’EBs s’installent. S’assurer qu'ils s’installent au fond du tube conique. Retirez le surnageant.
    3. Remettre en suspension l’EBs à l’aide d’une pipette 1 000 de µL dans 6 mL de FDM1 avec inhibiteur de ROCK 10 µM. Transfert de l’EBs (avec support) dans un plat enduit de matrice de 100 mm à membrane basale et incuber à 37 ° C, avec 5 % de CO2. Actualiser le FDM1 tous les deux jours pendant 3 jours.
      Remarque : Ajouter seulement l’inhibiteur ROCK au stade de la fixation de EB.
    4. Ajouter 0,5 protéine morphogénétique de l’OS nM 4 (BMP 4) à la FDM1 entre 4 et 6 jours.
    5. Au jour 7, remplacez le milieu FDM2 tous les deux jours pendant 1 semaine.
    6. Au jour 14, ajouter 1 mL d’EDTA 1 mM et incuber à 37 ° C, avec 5 % de CO2 pendant 2 min. récolter les cellules avec 3 mL de FDM2 et centrifuger à 250 g pour 2 min. Retirez le surnageant et remettre en suspension les cellules dans 5 mL de FDM1.
    7. Compter les cellules à l’aide d’un hémocytomètre resuspendre 2 x 106 cellules avec support FDM1 et transférer les cellules dans le plat de noncoated. Maintenir les cellules à 37 ° C, avec 5 % de CO2 et changer le support de tous les autres jours.
    8. Pétri de manteau, à l’aide de collagène de type I. Préparation de 5 mL pour recouvrir un plat de 100 mm. Diluer la solution de collagène de type I (concentration finale : 50 µg/mL) dans l’acide acétique 0,02 N. Ajouter la solution aux plats et incuber à RT pendant 1 h. aspirer le produit avant utilisation (pour ne pas dessécher).
      Remarque : Avant d’utiliser les plaques, laver la vaisselle 3 x avec PBS pour enlever l’acide.
    9. Au jour 21, ajouter 1 mL d’EDTA 1 mM et incuber à 37 ° C, avec 5 % de CO2 pendant 2 min. récolter les cellules avec 3 mL de FDM1 et centrifuger à 250 g pour 2 min. Retirez le surnageant et remettre en suspension les cellules dans 5 mL de FDM1. Compter les cellules à l’aide d’un hémocytomètre et transfert 2 x 106 cellules au type j’ai plat enduit de collagène 100 mm avec support FDM1. Maintenir les cellules à 37 ° C, avec 5 % de CO2 et changer le support de tous les autres jours.
    10. Le 28e jour, ajouter 1 mL d’EDTA 1 mM et incuber à 37 ° C, avec 5 % de CO2 pendant 2 min. récolter les cellules avec 3 mL de FDM1 et centrifuger à 250 g pour 2 min. Retirez le surnageant et remettre en suspension les cellules dans 5 mL de FDM1. Compter les cellules à l’aide d’un hémocytomètre et 2 x 106 cellules de transfert dans un plat de noncoated avec le FDM1 moyen. Maintenir les cellules à 37 ° C, avec 5 % de CO2 et changer le support de tous les autres jours.
      NOTE : dérivés iPSC fibroblastes prolifèrent comme une lignée de cellules de fibroblaste primaire et le passage jusqu'à 10 passages. Dans cette étude, nous avons utilisé des fibroblastes iPSC-dérivé de deux à cinq passages pour une analyse ultérieure.

2. demande des cellules différenciées dérivées hiPSC

  1. Génération de peau 3D organoïde
    1. Préparer neutralisée type j’ai collagène sur la glace, suite aux recommandations du fabricant. Comme la concentration finale, utilisez 3 mg/mL de collagène de type I (stock concentration de type j’ai collagène est 3,47 mg/mL) et assurez-vous que le volume final du mélange est de 5 mL. Calculer le volume de 10 x PBS (volume final/10 = 0,5 mL). Calculer le volume de collagène pour servir de type I (volume final x concentration finale de collagène / concentration de collagène de stock = 5 mL x 3 mg / mL / 3,47 mg / mL = 4,32 mL). Calculer le volume de NaOH N 1 (volume de collagène à utiliser x 0,023 mL = 0,1 mL). Calculer le volume de dH2O (volume final - volume de collagène - volume de 10 x PBS - volume de NaOH N 1 = 5 et 4,32 mL-0,5 mL à 0,1 mL = 0,08 mL). Mélanger le contenu du tube et le maintenir sur la glace jusqu'à utilisation.
    2. Ajouter 1 mL d’EDTA dans les fibroblastes iPSC-dérivé de l’étape 1.4.10 et incuber à 37 ° C, avec 5 % de CO2 pendant 2 min. récolter les cellules individuelles, compter les cellules à l’aide d’un hémocytomètre et 2 x 105 cellules de transfert dans un nouveau tube conique de 15 mL. Centrifuger à 250 x g pendant 2 min et retirez le surnageant. Remettre en suspension les cellules des fibroblastes dérivés iPSC dans 1,5 mL de FDM1 et neutralisé le type j’ai solution de collagène (1:1).
      NOTE : Mélanger la solution doucement pour éviter les bulles.
    3. Placer l’insertion de la membrane sur une microplaque de 6 puits, transvaser le mélange dans l’insert et incuber 30 min à RT.
      Remarque : Ne pas déplacer les plaques.
    4. Après avoir confirmé la gélification, ajouter 2 mL de milieu vers le haut de l’insert et 3 mL jusqu’au fond du puits. Incuber la matrice de fibroblastes et de collagène à 37 ° C, avec 5 % de CO2 pendant 5 à 7 jours, jusqu'à ce que la gélification est complète et non plus de contrats.
    5. Après la congélation complète, détacher les kératinocytes iPSC-dérivé (de l’étape 1.3.6) sur EDTA. Ajouter 1 mL d’EDTA et incuber à 37 ° C, avec 5 % de CO2 pendant 2 min. récolter les cellules individuelles, les compter à l’aide d’un hémocytomètre et 1 x 106 cellules de transfert dans un nouveau tube conique de 15 mL. Centrifuger à 250 x g pendant 2 min.
    6. Retirez le surnageant et remettre en suspension de 1 x 106 cellules pour 50-100 µL de milieu épithéliales de faible teneur en calcium 1 (EP1).
    7. Aspirer toutes les moyennes dans la matrice (voir étape 2.1.5) et 1 x 106 cellules de kératinocytes iPSC dérivé sur chaque couche de fibroblastes de graines. Incuber les plaques à 37 ° C, avec 5 % de CO2 pendant 30 min.
      Remarque : Ne pas déplacer la plaque et n’ajoutez pas de n’importe quel support pour la fixation de kératinocytes.
    8. Ajouter 2 mL de EP1 à la partie supérieure de l’insert et 3 mL de EP1 jusqu’au fond du puits.
    9. Après 2 jours, aspirer tous les moyen de la plaque d’insert membrane et changer le milieu au calcium normal EP2 durant 2 jours.
    10. Après 2 jours, aspirer tous les moyen et ajouter 3 mL de milieu kératinisation seulement vers le bas pour générer une interface air-liquide.
    11. Maintenir la peau 3D organoïde jusqu'à 14 jours à 37 ° C, avec 5 % de CO2 et changer le support de tous les autres jours. Récolter l’organoïde peau 3D en coupant le bord de l’insert et utilisez-le pour un complément d’étude de la souillure et de la greffe de peau.
  2. Greffe de peau
    1. Réaliser l’anesthésie par inhalation sur souris NOD/scid (mâles, 6 semaines), à l’aide d’une méthode standard, approuvée sur le plan institutionnel. Pour greffe de peau, raser la fourrure de la peau du dos de la souris.
    2. Supprimer une section de 1 cm sur 2 cm de peau de la souris, à l’aide de ciseaux courbes avec une pince.
    3. Placez l’organoïde CBMC iPSC-dérivé de peau 3D sur le site de défaut et la suture utilisant une méthode de pansement sur cravate soie suturer.
    4. Observer les souris pendant 2 semaines et les sacrifier pour faire une analyse histologique. Le protocole de coloration a été vérifié dans précédentes études16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La peau est composée, pour l’essentiel, de l’épiderme et le derme. Les kératinocytes sont le type de cellule principale de l’épiderme, et fibroblastes sont le type de cellule principale du derme. Le schéma de la différenciation des kératinocytes est montré dans la Figure 1A. CBMC-iPCSc ont été maintenus dans un plat enduit de vitronectine (Figure 1B). Dans cette étude, nous avons différencié CBMC-CISP en kératinocytes et des fibroblastes, à l’aide de formation EB. Nous avons généré EBs à l’aide de la pendaison drop méthode pour s’assurer une uniforme et contrôlée la différenciation des kératinocytes et des fibroblastes (Figure 1C). EBs étaient attachés au type plaques d’enduit de collagène IV pour la différenciation des kératinocytes, et le milieu a été changé tous les jours. CBMC-CISP ont été traités avec RA, BMP4 et EGF. CBMC-CISP est différenciées aux kératinocytes. Au cours de la différenciation, la morphologie des kératinocytes CBMC iPSC-dérivés changé au fil du temps (supplémentaire Figure 1).

CBMC iPSC-dérivés des kératinocytes ont des morphologies similaires aux kératinocytes primaires (Figure 1D). L’expression du gène du marqueur pluripotentes OCT4 était diminuée dans les kératinocytes CBMC iPSC-dérivé. Séquences d’amorces sont indiquées dans le tableau 1. L’expression des marqueurs de la multiplication des kératinocytes Np63, KRT5 et KRT14 a augmenté dans les kératinocytes CBMC iPSC-dérivé (Figure 1F). Kératinocytes CBMC iPSC-dérivées ont été confirmés par l’expression de Np63 et KRT14 par immunohistochimie (Figure 1E). Ces résultats a confirmé que les kératinocytes CBMC iPSC-dérivés ont les caractéristiques des kératinocytes primaires.

Le schéma de la différenciation des fibroblastes est montré dans la Figure 2A. Nous également maintenu CBMC-CISP dans un plat enduit de vitronectine et utilisé la formation EB pour la différenciation des fibroblastes (Figure 2B, C). Nous avons attaché l’EBs aux plaques d’enduit de matrice de membrane basale et changé le milieu tous les deux jours. L’excroissance des cellules ont été transférés à noncoated et plaques d’enduit de collagène de type I. CBMC-CISP se différencient de fibroblastes. Au cours de la différenciation, la morphologie des fibroblastes dérivés CBMC-iPSC a évolué avec le temps (complémentaire Figure 2).

Fibroblastes CBMC iPSC-dérivés ont morphologies similaires aux fibroblastes primaires (Figure 2D). L’expression du marqueur de cellules souches pluripotentes OCT4 était diminuée dans les fibroblastes dérivés CBMC-iPSC. Marqueurs de fibroblaste de COL1A1, COL1A2, COL3A1 et CD44 étaient surexprimés dans les fibroblastes dérivés CBMC-iPSC (Figure 2F). Séquences d’amorces sont indiquées dans le tableau 1. En outre, CBMC iPSC-dérivés des fibroblastes ont été confirmés par l’expression de la vimentine et la fibronectine par immunohistochimie (Figure 2A). Ces résultats suggèrent que les fibroblastes CBMC iPSC-dérivés sont similaires aux fibroblastes primaires.

Nous avons généré un organoïde peau 3D utilisant le CBMC iPSC-dérivés des kératinocytes et des fibroblastes. Le régime de la formation de la peau 3D organoïde est montré dans la Figure 3A. Nous avons généré un organoïde peau 3D sur un plateau d’insertion de membrane. Pour la culture 3D, fibroblastes CBMC iPSC-dérivées ont été stratifiées avec type j’ai collagène et recouvert de kératinocytes CBMC iPSC-dérivé. Après l’ensemencement les kératinocytes CBMC iPSC-dérivé, le milieu a été changé à une concentration de calcium normal pendant 2 jours. Après 2 jours, un support de concentration élevée en calcium a été ajouté qu’à la chambre basse pour la formation de la culture de l’interface air-liquide. La culture de l’interface air-liquide induit la maturation et la stratification des kératinocytes. L’épaisseur de la peau 3D organoïde a augmenté au cours de la culture 3D. Ces résultats confirment que la peau 3D organoïde provenait de CPSI-dérivés des kératinocytes et des fibroblastes par l’hématoxyline et éosine (H & E) souillant (Figure 3C).

En utilisant la peau 3D dérivés CBMC-iPSC organoïde, nous avons généré un modèle de souris humanisées (Figure 3B) en greffant l’organoïde peau 3D à la souris. A induit un défaut de 1 cm x 2 cm, et la méthode de cravate-over a été utilisée pour la transplantation. Après 2 semaines, la peau greffée a été efficacement greffée à la souris, et nous l’a confirmé par H & E et immunocytochimiques analyse (Figure 3D). La maturation des kératinocytes et les marqueurs de différenciation épidermique de loricrin et KRT14 ont été exprimées dans la peau 3D CBMC iPSC-dérivé organoïdes (Figure 3E). Les organoïdes peau 3D CBMC iPSC-dérivés étaient différenciés sur le plan fonctionnel, efficacement greffés sur des souris et guéri efficacement les défauts de peau de souris.

Figure 1
Figure 1 : La différenciation des kératinocytes de CBMC-CISP. (A) schéma de la différenciation des kératinocytes de CBMC-CISP. (B et C) morphologie des CBMC-CISP (groupe B) et des dérivés iPSC EBs (groupe C). (D) la morphologie des kératinocytes CBMC iPSC-dérivé. (E) analyse Immunocytochimique de Np63 (rouge) et KRT14 (vert), ainsi que de DAPI (bleu) de la coloration. Les barres d’échelle = 100 μm. (F) expression génique du marqueur pluripotentes et marqueurs de kératinocytes de kératinocytes iPSC-dérivé (iPSC-Ks). Les graphiques montrent la moyenne avec SEM des cinq échantillons indépendants. Différences entre les groupes ont été examinés pour la signification statistique à l’aide de Student t-test. Le t-test a été appliqué pour analyser des ensembles de données quantitatives non paramétrique et l' unilatéral p-valeur a été calculée (*p < 0,05, **p < 0,01, ***p < 0,001 a indiqué signification statistique). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Différenciation des fibroblastes de CBMC-CISP. (A) schéma de différenciation de fibroblaste de CBMC-CISP. (B et C) morphologie des CBMC-CISP (groupe B) et des dérivés iPSC EBs (groupe C). (D) la morphologie des fibroblastes dérivés CBMC-iPSC. (E) analyse Immunocytochimique de vimentine (rouge) et la fibronectine (rouge), ainsi que de DAPI (bleu) de la coloration. Les barres d’échelle = 100 μm. (F) expression génique du marqueur pluripotentes et marqueurs de fibroblaste de fibroblastes dérivés iPSC (iPSC-Fs). Les graphiques montrent la moyenne avec SEM des cinq échantillons indépendants. Différences entre les groupes ont été examinés pour la signification statistique à l’aide de Student t-test. Le t-test a été appliqué pour analyser des ensembles de données quantitatives non paramétrique et l' unilatéral p-valeur a été calculée (*p < 0,05, **p < 0,01, ***p < 0,001 a indiqué signification statistique). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Génération de peau dérivés CBMC-iPSC organoïde et modèle de souris humanisées. (A) le diagramme schématique du processus de génération dérivés iPSC peau organoïde (iSO). Transplantation (B) de l’iSO à des souris. (C) l’analyse histologique de l’iSO in vitro. (D) l’analyse histologique de l’iSO transplanté in vivo. (E-H) Analyse Immunocytochimique de loricrin et KRT14. MOCK control (groupe E), iSO transplanté (panneau F, loricrin), peau de souris (témoin négatif, groupe G), iSO transplanté (panneau H, KRT14). Les barres d’échelle = 200 μm. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Supplementary Figure 1
Supplémentaire figure 1 : morphologie des kératinocytes dérivés iPSC. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Supplementary Figure 2
Supplémentaire figure 2 : morphologie des fibroblastes dérivés iPSC. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Nom de la cible Direction Séquence d’introduction (5' - 3') Taille (paires de bases) Refseq_ID
OCT4 Vers l’avant
Marche arrière
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Vers l’avant
Marche arrière
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Vers l’avant
Marche arrière
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Vers l’avant
Marche arrière
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Vers l’avant
Marche arrière
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Vers l’avant
Marche arrière
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Vers l’avant
Marche arrière
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Vers l’avant
Marche arrière
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Vers l’avant
Marche arrière
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Vers l’avant
Marche arrière
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentine Vers l’avant
Marche arrière
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Vers l’avant
Marche arrière
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tableau 1 : Les séquences des amorces utilisées pour PCR en temps réel quantitative.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

CISP humaine ont été suggérés comme une nouvelle alternative pour la médecine régénérative personnalisée17. CISP personnalisé dérivé de patient reflète les caractéristiques du patient qui peuvent être utilisés pour la modélisation de maladies, dépistage de drogue et autogreffe18,19. L’utilisation de dérivés de patient CISP peut aussi surmonter les problèmes relatifs aux éléments primaires, un manque d’un nombre adéquat de cellules et des réactions immunitaires5,17,19. Cependant, la génération de CISP personnalisé n’est pas économiquement faisable faute de temps, coût et des restrictions du travail. CISP de dérivés CBMC HLA-homozygotes est apparus comme une nouvelle possibilité. HLA-homozygote CISP peut être économiquement valable et peut être appliquée à un grand nombre de patients8,11,12,13. En outre, typage HLA de CBMCs se produit pendant le stockage de banque cellulaire, ce qui les rend facile à utiliser pour la recherche et de la transplantation. Protocoles de différencier CBMC-CISP dans les cardiomyocytes, les hépatocytes et les chondrocytes, ont été signalés à16,20,21,22,23.

Les couches épidermiques et dermiques sont des composants de la peau. L’épiderme est constitué de kératinocytes et le derme est constitué des fibroblastes. Ainsi, nous avons différencié CBMC-CISP en kératinocytes et des fibroblastes, respectivement. Pour la différenciation, en uniforme, bien contrôlée et optimisée EBs ont été générés par la pendaison drop méthode15,24. Collagène de type IV est une composante majeure de la membrane basale. Pour la différenciation des kératinocytes, EBs étaient attachés au type de vaisselle d’enduit de collagène IV. Kératinocytes CBMC iPSC-dérivés avaient une morphologie pavées (Figure 1D). Marqueurs de kératinocytes Np63 et KRT14 étaient exprimés en iPSC-Ks (Figure 1E, F). Ce résultat confirme que RA et BMP4 induite par la stimulation de l’expression des marqueurs des kératinocytes. En outre, CBMC-CISP ont été différenciées en kératinocytes semblables aux kératinocytes primaires.

Pour la différenciation des fibroblastes, EBs ont été rattachées à plaques à membrane de sous-sol enduit de matrice et les cellules différenciées sont en série repiquées sur noncoated et plaques d’enduit de collagène de type I. Une sous-culture de série a été induite pour spécifier la différenciation des fibroblastes. Fibroblastes produit une matrice extracellulaire (ECM) qui avait des fonctions d’adhésion et la migration. Les fibroblastes produisent également collagène abondant composants25. Dans les fibroblastes dérivés CBMC-iPSC, le marqueur de surface de fibroblastes CD44 a été augmenté. L’expression du collagène a augmenté en iPSC-Fs (Figure 2F). L’expression de la fibronectine et la vimentine est passée en iPSC-Fs (Figure 2E).

En utilisant le différenciée des kératinocytes et des fibroblastes, nous avons généré peau CBMC iPSC-dérivé organoïdes (Figure 3A). Nous avons utilisé une culture de l’interface air-liquide avec un milieu riche en calcium qui induit des couches stratifiées de peau CBMC iPSC-dérivés organoïdes. La concentration élevée de calcium était nécessaire à la maturation des kératinocytes in vivo et in vitro, tandis que l’interface air-liquide a servi à élaborer plusieurs couches de strates26,27,28. Nous avons utilisé cette méthode pour imiter l’analyse véritable peau et histologique ont montré que la peau a été stratifiée (Figure 3C). Pour confirmer la capacité de cicatrisation, nous avons transplanté l’iSO dans la peau de souris, en utilisant la méthode de la cravate au pansement (Figure 3D). Après la transplantation, les organoids de la peau ont été greffés efficacement et guérit la peau de souris adéquatement. KRT14 s’exprimait dans la couche basale de l’épithélium squameux et squameux de stratification. Loricrin est une composante principale de la couche cornée trouvée en terminale différenciées et kératinisées de cellules épithéliales29,30. Le marqueur de différenciation épidermique de loricrin a été exprimé en peau transplantée. L’expression de KRT14 et loricrin a confirmé que la peau organoïde était pleine maturité, et différenciation a été démontrée par immunohistochemical souillant (Figure 3E).

Dans cette étude, nous avons développé un protocole pour différencier CBMC-CISP dans les kératinocytes et les fibroblastes, les types de cellules principales de la peau humaine. Nous avons confirmé que le CBMC iPSC-dérivés des kératinocytes et des fibroblastes montrent des phénotypes semblables aux lignées cellulaires primaires. En utilisant ces cellules différenciées, on généré une peau 3D organoïde et il greffés sur des souris NOD/scid en utilisant la méthode de la cravate au pansement. Cette technique originale a été décrite en 1929 par Blair et Brown et a été couramment utilisée pour une greffe de peau31,32. Cette méthode empêche la prothèse de bouger, favorise une bonne adhérence à la plaie et donc accéléré une guérison. L’analyse histologique a confirmé que la peau 3D organoïde imité un phénotype de la peau humaine qui satisfait stratifiée et est arrivée à échéance de plus de 2 semaines. Une greffe de peau est généralement réalisée à l’aide de cellules individuelles des kératinocytes et des fibroblastes par silicium chambre à bulles33,34. Ce système est facile à la greffe, mais il fallait plus de temps pour observée à l’efficacité de la greffe après greffe. La chambre en plastique ou silicone fonctionne comme une barrière contre la peau de la souris. Le CISP système dérivé de peau 3D organoïde n’utilisez pas une chambre en plastique ou en silicone. Dans ce système, la transplantation a été efficace ; Cependant, il était difficile de bloquer le processus naturel de guérison de la souris. Ainsi, la peau de la souris couvert plusieurs parties de l’iSO pendant une longue période après la transplantation. Il s’agit d’une partie de la méthode présentée ici et qui doit être améliorée.

En conclusion, CBMC-CISP est une source potentielle de cellules pour les greffes de peau. À l’aide de ces protocoles, CBMC iPSC-dérivés des kératinocytes, fibroblastes et une peau 3D organoïde peuvent être utilisé dans les études liées à la dermatologie, médicaments et cosmétique dépistage et médecine régénératrice.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été soutenu par une subvention du Corée Healthcare Technology R & D Project, ministère de santé, de bien-être et d’affaires de la famille, République de Corée (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics