המרה של האדם המושרה Pluripotent תאי גזע (iPSCs) לתוך השדרה פונקציונלי והגולגולת נוירונים מוטוריים באמצעות שימוש בווקטורים הגולגולתית

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

פרוטוקול זה מאפשר המרה מהירה ויעילה של תאי גזע pluriפוטנטי לתוך נוירונים מוטוריים עם זהות בעמוד השדרה או הגולגולת, על ידי ביטוי חוץ רחמי של גורמי שעתוק מתוך וקטורים inducible,.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

אנו מתארים כאן שיטה להשגת נוירונים פונקציונלי והגולגולת מנוע הגולגולתית האדם בתאי גזע pluriפוטנטי (iPSCs). המרה ישירה לתוך תא מנוע מושגת על ידי ביטוי חוץ רחמי של מודולים חלופיים של גורמים שעתוק, כלומר Ngn2, Isl1 ו Lhx3 (אפס) או Ngn2, Isl1 ו Phox2a (ניפ). אפס ו ניפ לציין, בהתאמה, מנוע השדרה ואת הגולגולת זהות תא העצב. הפרוטוקול שלנו מתחיל עם הדור של הקווים iPSC שונה שבו אפס או ניפ משולבים באופן מובן בגנום באמצעות מעבר טרנספסון וקטור. ביטוי של הטרנסגנים נגרמת לאחר מכן על ידי דוקסיציקלין ומוביל, בתוך 5 ימים, כדי ההמרה של iPSCs לתוך MN ושלתי. ההבשלה הבאים, עבור 7 ימים, מוביל אוכלוסיות הומוגנית של MNs השדרה או הגולגולת. השיטה שלנו מחזיקה מספר יתרונות על פני פרוטוקולים קודמים: הוא מהיר מאוד ופשוט יותר; היא אינה דורשת זיהום נגיפי או בידוד MN נוסף; היא מאפשרת יצירת משנה שונים MN (השדרה הגולגולת) עם תואר מדהים של התבגרות, כפי שניתן להדגים על ידי היכולת אש רכבות של פוטנציאל פעולה. יתר על כן, מספר גדול של נוירונים מוטוריים ניתן להשיג ללא טיהור מאוכלוסיות מעורבות. מנוע השדרה הנגזר של iPSC, הגולגולת והגולגולתית ניתן להשתמש בדוגמנות מבחנה של טרשת Amyotrophic לרוחב ומחלות ניווניות אחרות של תא העצב המנוע. אוכלוסיות מוטוריות הומוגניות עשויות לייצג משאב חשוב עבור סוג תא הקרנות סמים ספציפיות.

Introduction

מוטוריים תא העצב (MN) ניוון משחק תפקיד סיבתי במחלות האדם כגון טרשת Amyotrophic לרוחב (ALS) ו ניוון שרירים השדרה (SMA). הקמת מערכות מודל לבניית תאים מחוץ לתחום, המתאימות למורכבות של האדם האנושי, היא צעד חשוב לקראת התפתחות גישות טיפוליות חדשות. המושרה בתאי גזע פלוריפוטנטי (iPSCs), אשר ניחן בתכונות בידול השושלת המדהימה pluripotent כבר נגזר ממספר מטופלים המושפעים על ידי מחלות תא מנוע1,2. קווי iPSC נוספים הנושאים מוטציות פתוגניים הקשורים מחלות MN נוצרו על ידי עריכת גנים, החל לשלוט "בריא" תאים גזע pluripotent3. קווים אלה מייצגים כלים שימושיים למידול מחלות חוץ גופית והקרנת סמים, בתנאי שהשיטות המתאימות לבידול iPSC לתוך MNs זמינים. הרציונל מאחורי הפיתוח של שיטה זו הוא לספק את הקהילה המדעית המעוניינים מחלות MN עם פרוטוקול בידול מהיר ויעיל ומעורר MNs פונקציונלי בוגרת. היתרון הראשון של שיטה זו הוא מסגרת ההוצאה להורג. עוד נקודה רלוונטית של חוזק באה מחיסול כל צעד טיהור. לבסוף, את הפרוטוקול ניתן להשתמש כדי ליצור שתי אוכלוסיות נפרדות של נוירונים מוטוריים.

האפשרות של יצירת תת סוגים שונים של MNs רלוונטי במיוחד עבור דוגמנות של מחלות MN. לא כל תת-הסוגים של MN פגיעים באותה מידה ב-ALS ו-SMA, והתחלתה של סימפטומים ביחידות מוטוריות שונות משפיעים מאוד על הפרוגנוזה. ב ALS, התפרצות השדרה עם סימפטומים החל בגפיים העליונים והתחתונים מוביל למוות בערך 3-5 שנים4. לעומת זאת, התפרצות בולבר, החל מניוון של MNs הגולגולת, יש פרוגנוזה הגרוע ביותר. יתר על כן, אחוז התפרצות בולבר הוא גבוה באופן משמעותי בחולים עם מוטציות ב-RNA-כריכת חלבונים פוס ו TDP-43 מאשר אנשים עם מוטציות SOD15. כמעט מכלול הפרוטוקולים החלופיים MN בידול מסתמך על הפעילות של חומצה retinoic (RA), אשר מעניקה אופי השדרה כדי להבדיל iPSCs6,7,8. זה מגביל את האפשרות של ללמוד גורמים פנימיים, אשר יכול להיות מגונן על מסוימים מסוימים MN9,10.

בקנה אחד עם עבודה קודמת בתאי גזע מעובריים של העכבר11, הצגנו לאחרונה כי בביטוי האנושי iPSCs רחמי של Ngn2, Isl1 ו LHX3 (אפס) מעורר זהות בעמוד השדרה, בעוד Ngn2 ו Isl1 פלוס PHOX2A (ניפ) לציין הגולגולת MNs12. יש לנו ולכן פיתח פרוטוקול יעיל, המוביל לייצור של MNs האדם ניחן בתכונות פונקציונלי ב 12 יום הסבב. מטרת שיטה זו היא להשיג, במסגרת זמן קצר, ללא צורך לטיהור (למשל, על ידי FACS), אוכלוסיות תאים מועשר מאוד עבור MNs עם זהות השדרה או הגולגולת.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. תחזוקת הiPSCs האנושית

  1. הכנת צלחות מצופות מטריקס
    1. הפשרת בקבוקון אחד של 5 מ ל (ראה טבלת חומרים) ב -4 ° c בלילה. מניות המטריצה המקוריות מגיעות לריכוזים שונים של מניות, ובהתאם לפקטור הדילול המצוין בגליון הנתונים, ספציפי למגרש הבודדים. חשוב לשמור על המבחנה וצינורות קרח קר כדי למנוע הגילינג מוקדמת של המטריצה. מטריצת מדבקות לתוך השפופרות. של ההקפאה המוקדמת על הקרח הקפאה ללא שימוש בהקפאה ב-20 ° c.
    2. מניחים אחד על הקרח על 2 h כדי להפשיר.
    3. לדלל את העליות של מטריקס עם 20 מ ל של הצטננות/F12 בצינור 50 mL.
    4. מערבבים היטב לוותר 1 מ ל של מטריצה מדולל לתוך 35 מ"מ מנות (כמויות שוות ערך לכל שטח של מנות אחרות).
    5. שמרו את הכלים המכילים מטריצה מדוללת עבור 1 h בטמפרטורת החדר כדי לאפשר ציפוי.
      הערה: ניתן לאחסן כלים האטומים עם parafilm ב-4 ° צ' עד שבועיים.
  2. הכנת פתרון המניה (20 מ ל) ו-1x עבודה באמצעות מגיב הדיסוציאציה של התאים העדינים (ראו טבלת חומרים).
    1. התמוססות אבקה ל 10 מ"ג/mL ב-PBS (Ca2 +/mg2 + חינם).
    2. מסנן לעקר דרך קרום מסנן יקרומטר 0.22.
    3. הכינו 20 מעלות (1 מ"ל לכל אחד) ואחסן ב-20 ° c.
    4. לפני השימוש, לדלל את אחד סדרת מחלקים ב PBS (Ca2 +/Mg2 + חינם) ל 1 מ"ג/mL (1x העבודה המאביטים).
      הערה: ניתן לאחסן 1x שבועות עבודה ב -4 ° צ' עד שבועיים.
  3. . מiPSCs אנושי
    1. לפני ההתחלה: אם הוא מאוחסן ב -4 ° c, לוחות מצופים חמים לפני מטריקס בחממה ב-37 ° c עבור 20-30 דקות. לחמם את החדר בטמפרטורה כמות האדם iPSC בינונית (ראה טבלת חומרים) הדרושים. לחמם מראש את Dמאמ/F12.
    2. . משוף תרבות בינונית
    3. לשטוף iPSCs עם PBS (Ca2 +/Mg2 + חינם).
    4. הוסף פתרון דיסוציאציה עדינה של 1x (0.5 mL למנה 35 מ"מ). דגירה ב 37 ° צ' עד הקצוות של המושבות להתחיל להתנתק מן הצלחת, בדרך כלל 3-5 דקות.
    5. לשים לב לפתרון הדיסוציאציה העדינה, להיזהר שלא לנתק מושבות iPSC.
    6. שטוף את התאים עם Dמאמ/F12 (2 מ ל עבור צלחת 35 מ"מ) ומשלחים להיות זהירים לא לנתק את התאים. . חזור על השלב הזה עוד פעם אחת
    7. הוסף בינונית iPSC אנושי (1 mL עבור צלחת 35 מ"מ).
    8. התנתק בעדינות את המושבות באמצעות מרים ניידים והעבר לשפופרת של 15 מ ל.
    9. בעדינות לשבור את הגושים תאים על ידי ליטוף למעלה ולמטה עם P1000 הצינורות או ה3-4 פעמים.
    10. מתיף את הסופרנטאנט מהפלטה.
    11. הזרע את התאים בנפח התרבות המתאים של מדיום iPSC אנושי. היחס המפוצל יכול להשתנות משורה לשורה, והוא כ-1:4-1:8. שנה את המדיום מדי יום.

2. יצירת שורות אפס ו-ניפ Inducible iPSC

  1. . זיהום תאים
    1. לשטוף את התאים עם PBS (Ca2 +/Mg2 + חינם).
    2. הוסף מגיב לדיסוציאציה של תא (ראה טבלת חומרים) (0.35 mL לצלחת 35 מ"מ) ו-דגירה ב 37 ° צ' עד שתאים בודדים מופרדים (5-10 דקות).
    3. בעדינות להשלים את ההפרדה התא על ידי ליטוף למעלה ולמטה עם P1000 הצינורות ו-3-4 פעמים.
    4. לאסוף בצינור 15 מ"ל ולהוסיף PBS (Ca2 +/Mg2 + חינם) עד 10 מ"ל. . תספור את התאים
    5. גלולה 106 תאים ולהשעות מחדש ב 100 μl של מאגר R (כלול בערכת אלקטרופורציה התא, ראה טבלת חומרים).
    6. הוסף דנ א פלמיד לצורך העברה: 4.5 μg של טרנספסבל וקטור (epB-Bsd-TT-0 או epB-Bsd-TT-ניפ 12) ו 0.5 μg של המשלוח העביר את המשלוחב-13.
    7. Transfect עם מערכת אלקטרופורציה תא (ראה טבלת חומרים) לפי הוראות היצרן וכמתואר בעבר3 עם הפרמטרים הבאים: 1,200 V מתח, 30 ms רוחב, 1 פעימה. זרע את התאים בינונית iPSC אנושי בתוספת עם 10 μM Y-27632 (סלע מעכבי, ראה טבלת חומרים) ב 6 מ"מ מטריצה מצופה הצלחת.
  2. בחירה עם אנטיביוטיקה.
    1. יומיים לאחר החצייה, להוסיף 5 μg/mL בלאסיפידין למדיום התרבות.
    2. רוב התאים הבלתי-מזוהמים ימותו ב48. שמור את התאים בלאסיטות לפחות 7-10 ימים כדי לבחור את התאים שאינם משולבים הטרנסגנים בגנום.
    3. לשמור על תאים מזוהמים באופן מורכב כאוכלוסיה מעורבת, המורכבת מתאים עם מספר שונה של טרנסגנים ואתרי אינטגרציה שונים, או לבודד שיבוטים יחיד.
    4. להכין צלחת נוספת כדי לבדוק ביטוי אפקטיבי של טרנסגנים, על 1 μg/mL דוקסיציקלין אינדוקציה, על-ידי RT-PCR עם התחל-Ngn2 הספציפי ביותר עבור הראשון (קדימה: TATGCACCTCCCCATAG; הפוך: GAAGGGAGGAGGGCTCGACT), כפי שמתואר בעבר12.
    5. בשלב זה, להקפיא את המניות של הרומן אפס וניפ-iPSC קווים בהקפאה בינונית עבור האדם iPSCs (ראה לוח חומרים).

3. תא מנוע בידול

  1. הנתק את התאים באמצעות מגיב לדיסוציאציה של תא כמתואר (שלבים 2.1.1.-2.1.3.). לאסוף תאים בלתי מתאים בצינור 15 מ"ל ו לדלל עם 5 כרכים של Dמאמ/F12. גלולה את התאים ולהשעות מחדש בינונית iPSC אנושי בתוספת עם 10 מעכב הסלע μM. ספור את התאים והזרעים על מנות מצופות מטריקס בצפיפות של 62,500 תאים/cm2.
  2. יום לאחר מכן, להחליף את המדיום עם DMEM/F12, שיושלם עם 1x יציבה L-גלוטמין אנלוגי, 1x לא חיוני חומצה אמינית (NEAA) התרבות תא תוסף ו 0.5 x פניצילין/סטרפטומיצין, ומכיל 1 μg/mL דוקסיציקלין. זה נחשב כיום 0 של בידול. ביום 1, רענן את המדיום ו דוקסיציקלין.
  3. ביום 2, לשנות את המדיום כדי Neurobasal סיס/B27 בינונית (נוירובינונית מדיום שיושלם עם 1x B27, 1x יציבה L-גלוטמין אנלוגי, 1x NEAA ו-0.5 x פניצילין/סטרפטומיצין), המכיל 5 μM DAPT, 4 μM SU5402 ו-1 μg/mL דוקסיציקלין (ראה טבלת חומרים ). רענן את המדיום ו דוקסיציקלין כל יום עד יום 5.
  4. יום 5: תאים דיסוציאציה עם מגיב לדיסוציאציה של תא (ראו טבלת חומרים).
    1. לשטוף את התאים עם PBS (Ca2 +/Mg2 + חינם).
    2. הוסף את מגיב הדיסוציאציה של תא (0.35 mL עבור צלחת 35 מ"מ) ו-דגירה ב 37 ° צ' עד מפריד התא כולו מפרידה ממנה. שים לב שתאים בודדים לא יופרדו במהלך הדגירה.
    3. הוסף 1 מ ל של DMEM/F12 ולאסוף את התאים בצינור 15 מ ל.
    4. בעדינות להשלים את ההפרדה התא על ידי ליטוף למעלה ולמטה עם P1000 הצינורות ו-10-15 פעמים.
    5. להוסיף 4 מ ל של Dמאמ/F12 ולספור את התאים.
    6. בשלב זה, הקפאת מנוע תא העצב ושלתי בתא הקפאת בינונית (ראה טבלת חומרים), על פי הוראות היצרן.
    7. גלולה את התאים ולהשעות מחדש בינונית עצבית (Neurobasal סיס/B27 בינוני בתוספת 20 ng/mL BDNF, 10 ng/mL GDNF ו 200 ng/mL-חומצה אסקורבית, ראה לוח חומריםs) שיושלם עם 10 ΜM סלע מעכב.
    8. הזרע את התאים על האורשים/למינציה-או לחילופין על תמיכה מצופי מטריקס בצפיפות של 100,000 תאים/cm2. השתמש ב-μ-שקופית פלסטיק תומך עם שמיכות פולימר (ראה טבלת חומרים) לניתוח חיסוני.
  5. ביום 6, לשנות את המדיום עם המדיום העצבי הטרי נטול מעכבי סלע. בימים הקרובים, תרענן. חצי מהמדיום כל 3 ימים יש לשנות את מבנה התרבות בזהירות רבה כדי למנוע ניתוק מפני השטח.

4. ניתוח חיסוני

  1. . קיבוע תאים לשטוף את התאים עם PBS (עם Ca2 +/Mg2 +) ו דגירה עבור 15 דקות ב 4% פאראפורמלדהיד ב-PBS (עם ca2 +/Mg2 +) בטמפרטורת החדר.
    זהירות: פאראפורמלדהיד הוא רעיל וחשוד לגרום לסרטן. הימנע ממגע עם העור והעיניים וטפל מתחת למכסה כימי.
  2. החדירות עם PBS (עם Ca2 +/Mg2 +) המכיל 0.1% טריטון X-100 עבור 5 דקות בטמפרטורת החדר.
  3. דגירה עבור 30 דקות בטמפרטורת החדר בפתרון חסימת נוגדנים (ABS: 3% BSA ב-PBS עם Ca2 +/Mg2 +).
  4. דגירה עבור 1 h בטמפרטורת החדר עם נוגדנים העיקרי ABS: anti-TUJ1 (1:1000; ארנב) ו anti-Oct4 (1:200; עכבר) או נגד צ'אט (אנטי כולין Acetyltransferase; 1:150; עז). ראה טבלת חומרים.
  5. מודטה עבור 45 דקות בטמפרטורת החדר עם החמור המתאים נוגדן משני בתוך ABS: נגד עכבר אלקסה Fluor 647 (1:250), אנטי ארנבת אלקסה Fluor 594 (1:250) ונגד עז אלקסה Fluor 488 (1:250). ראה טבלת חומרים.
  6. דגירה ב 0.4 μg/mL DAPI עבור 5 דקות בטמפרטורת החדר לתייג גרעינים.
  7. הר את התאים עם הרכבה בינונית (ראה טבלת חומרים) לדימות במיקרוסקופ פלואורסצנטית.

5. אפיון פונקציונלי באמצעות טלאי-הקלטות קלאמפ

  1. הכינו את הפתרון החיצוני (נס) כדלקמן: 140 מ"מ, 2.8 מ"מ KCl, 2 מ"מ בגודל 2mm, 2 מ"מMgCl2, 10 מ"מ hepes, ו 10 מ"מ גלוקוז. הגדר את האוסמגליות בין 290-300 mΩ. כוונן את ה-pH ל 7.3 באמצעות 1N NaOH ואחסן את הפתרון ב-4 ° c.
  2. הכינו את הפתרון הפנימי: 140 mM K-גלוקונאט, 2 מ"מ הייגל, 5 מ מ באפטה, 2 מ"מ MgCl2, 10 מ"מ hepes, 2 מ ג MG-ATP, 0.3 mm NA-gtp. להתאים את ה-pH ל 7.3 עם קו 1M ו לבדוק את האוסמלקיים מוגדר בסביבות 290 mΩ. הקפאת הפתרון ב-20 ° c בעלי מענה קטן.
  3. לפני הפעלת הניסויים, לחמם מראש את הפתרון NES באמבט מים על 28-30 ° c.
  4. משוך מיקרורטט בורוסיליקט (מזהה 0.86 מ"מ; OD 1.5 mm) נושאת התנגדות טיפ: 5-6 MΩ ולמלא עם פתרון תאיים לפני ההרכבה לתוך המחזיק פיפטה.
    הערה: זכור את חוטי כסף כלוריד של אלקטרודות ההקלטה התייחסות אלקטרודה אקונומיקה לפחות 30 דקות כדי ליצור שכבה אחידה של AgCl על משטח התיל.
  5. העבירו את צלחת פטרי בתא ההקלטה והרשו לחדר עם פתרון NES בשעה 1-2 mL/min. תנו לזרימה לעבור דרך מחמם מוטבע שנקבע בטמפרטורה של 30 ° c כדי לשמור על הפתרון חם.
  6. חדר הקלטה אלקטרולוגי. מתחת למיקרוסקופ זקוף הקלט זרמי ממברנה באמצעות מגבר מהדק התיקון והשגת נתונים באמצעות תוכנה מתאימה.
  7. פתח את תוכנת בקרת המגבר, והגדר את רווח האות בערך 1 ואת מסנן בסל ב-10 kHz. ודא שמסנן בסל נמוך פי 2.5 מתדירות הדגימה.
  8. הגדר את הפרוטוקולים הניסיוניים עבור מלחציים מתח וניסויים מלחציים נוכחיים בתוכנת ההקלטה.
  9. בהגדרת הפרוטוקול, שנתות מצב גירוי האפיזודי ולהגדיר את תדירות הדגימה ב 25 kHz. לאחר מכן, לעבור אל הכרטיסיה צורת גל ולהקליד את המתח או הצעד הנוכחי משרעת ואורך כמו הפעל.
  10. עבור זרמי הנתרן מגודרת, להשתמש 15 שלבי מתח (50 ms משך כל אחד) מ-100 mV כדי + 40 mV (10 mV הגדל). הפעל את הפרוטוקול לאחר הטלת תא שתוקנה הפוטנציאל המחזיק של-60 mV דרך המגבר. באופן דומה, זרמים מגודרת מתח האשלגן מעורר באמצעות צעדי מתח (250 ms משך כל אחד) מ-30 mV כדי + 50 mV (10 mV תוספת) מחזיק את התא המוקלט ל-40 mV.
  11. עבור חקירת תכונות הירי של הגולגולת iPSC-נגזר MNs השדרה, תאים מלחציים, במצב הנוכחי-קלאמפ, על פוטנציאל הממברנה של-70 mV ולהשתמש 4 פולסים הנוכחי (1 משך כל אחד) של משרעת הגוברת (מ + 20 pA כדי + 80 pA; 20 pA תוספת).
  12. לרכוש עבור כל זרם מופעל מתח, פעילות ירי מעורר ושלושה מאפיינים פסיביים כמו קיבול תא שלם (Cm), עמידות קרום התא (Rm) והפוטנציאל ממברנה מנחה (RMP).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

תיאור סכמטי של שיטת הבידול מוצג באיור 1. האדם iPSCs (WT I קו3) היו מזוהמים עם Epb-BSD-TT-אפס או Epb-BSD-TT-ניפ, הפקת, על בחירת בלטות, יציבה ושורות תא inducible12, להלן המכונה ipsc-אפס ו ipsc-ניפ, בהתאמה. תאים ההבחנה התאפיין בביטוי של סמן הפלאואון OCT4 ו-TUJ1 סמן הפאן-עצבי. ניתוח חיסוני הראה ביטוי אחיד של OCT4 בכל התאים ביום 0, בהעדר TUJ1 חיוביות (איור 2א). ביום 3, הבחנו ירידה חזקה במספר התאים OCT4-חיוביים, שיקוף על-ידי ביטוי של TUJ1 בקבוצת משנה של הבחנה iPSCs (איור 2ב). ביום 5, לא נצפתה ביטוי של OCT4 באוכלוסיה, שגילתה ביטוי עקבי של TUJ1 ורכשה מורפולוגיה עצבית (איור 2ג). ושלתי תא העצב המוטוריים היו אז הפגיז ומצופה מחדש להבשלה נוספת. לאחר 7 ימים (12 ימים מאז היום 0), תאים המבוטא בצורה אחידה TUJ1 ומסמן בוגרת תא העצב מנוע צ'אט (איור 3). תוצאות דומות הושגו עם שני קווי iPSC נוספים מסחריים (ראו טבלת חומרים), באמצעות אותה תרבות ובידול התנאים (הנספח המשלים S1 ו איור המשלים S2). בדומה המושרה אפס נוירונים מוטוריים של העכבר ESCs11, האדם iPSCs המושרה עם אפס ו ניפ הביע רמות נמוכות של מקדמי תמלול של hox והוא יכול להיות בדוגמת לאורך הציר rostro caudal עם חומצה retinoic (משלימיםהדמות S3 ).

תוצאות אלה הושגו כאשר 62,500 תאים/cm2 שופרה בתחילת בידול והמושרה עם 1 מיקרומטר μm ביום 0. זה הביא את הריכוז האופטימלי של דוקסיציקלין להשיג אינדוקציה מקסימלית של הטרנסגנים ללא רעילות ברורה עבור התאים (המשלים איור S4A). עם הסרת דוקסיציקלין ביום 5, ביטוי של הטרנסגנים הושתק (המשלים איור S4B). כמו כן בוצעו ניסויים בפיילוט כדי לבסס את הצפיפות האופטימלית של התאים בשלב זה של הפרוטוקול. שמנו לב שמשתנה פרמטר זה בניסויים בידול מקבילי סיפק תוצאות שונות. עם צפיפות ראשונית הוריד ל31,250 תאים/cm2, בידול היה נורמלי כנראה, כפי שוערך על ידי התבוננות מורפולוגיה התא. עם זאת, הבחנו בהתנגדות לדיסוציאציה ביום 5 (סעיף 3.4) והכדאיות הנמוכה בשלב ההבשלה הבאה. לעומת זאת, כאשר הצפיפות הראשונית של התאים הועלה ל 125,000 תאים/cm2, הבחנו בידול לא יעיל, כפי שמוערך על ידי חוסר רכישה של המבנה האופייני של תא העצב, כמו. זה הביא לאוכלוסייה מעורבת המכילה רק חלק קטן של MNs, אשר צריך טיהור נוסף (למשל, על ידי FACS). לפיכך הקמנו כי הצפיפות האופטימלית להשגת אוכלוסייה טהורה של תאים עצביים, מסוגל לשרוד בתרבות עבור יותר מחודשיים, הוא 62,500 תאים/cm2.

לאחר מכן העריכו את ההבשלה תפקודית של הנוירונים iPSC אפס נגזר המנוע השדרה על ידי אפיון מאפיינים אלקטרופיסיולוגיים שלהם (איור 4), כפי שדווח בעבר על מנוע הגולגולת של IPSC ניפ-נגזר12. הקלטות קלאמפ לתיקון, במתח ומהדק הנוכחי, בוצעו ביום 7 של MNs התבגרות של הפרוטוקול (ראה איור 1; זמן כולל של בידול: 12 ימים) (איור 4א). בשלב זה, הנוירונים iPSC הנגזרים מנוע הראה ממברנה מעט נמוך הפוטנציאל מונח בזמן (-30 ± 2 mV; n = 24) ו הקיבולת תא דומה ערך (+ 25 ± 2 pF; n = 25) בהשוואה דיווח בעבר iPSC ניפ-נגזר MNs12. אז, כדי לאפיין עמוק יותר את מידת ההבשלה של תאים הבדיל, חקרנו את יכולתם לעורר זרמים נתרן ואשלגן כאשר מגורה עם סדרה של פולסים מתח. בניסויים אלה, הנוירונים הנגזרים בהצלחה את זרמי הנתרן תלויי המתח (איור 4ב), וזרמי האשלגן תלויי המתח (איור 4ג), והגיעו משרעת השיא כאשר מהודק ב פוטנציאל ממברנה ליד-20 mV ו + 50 mV, בהתאמה. הפוטנציאל לשיווי משקל עבור Na+ ו-K+, מחושב באמצעות משוואת nernst (www.physiologyweb.com/calculators/nernst_potential_calculator.html) עם פתרונות החילוץ בעבר ו תאיים, היו + 110 mV ו-102 mV בהתאמה. בנוסף, 80% של iPSC אפס נגזר MNs מהודק ב-מודאליות הנוכחי היו מסוגלים להפעיל רכבות ספייק כאשר הוזרק עם הדופק הנוכחי של + 60 pA או יותר (איור 4ד). הנוכחי המינימלי הנדרש כדי לעורר ירי חוזרים ביותר מ 50% של תאים מוקלטים היה + 40 pA (15 מתוך 18 תאים; איור 4 E). סף ספייק היה-37.6 ± 0.8 mV ותדירות ירי ממוצעת ב + 40 pA הייתה אודות 7.9 ± 2.2 Hz (n = 18; איור 4 F).

בסך הכל, נתונים אלה מצביעים על כך, בדומה ל-iPSC ניפ-נגזר הגולגולת MNs12, IPSC-אפס נגזר השדרה MNs יש מאפיינים פונקציונליים אופייני של נוירונים בוגרים.

Figure 1
איור 1 : תא מוטורי בידול הפרוטוקול. האיור מציג ייצוג סכמטי של פרוטוקול הבידול, החל מדור קווי ה-iPSC היציבים עם הוקטורים של החבר לנקודת הזמן של הניתוח הפונקציונלי המדווח בטקסט. תמונות הניגודיות של השלב המייצג של התאים בשלבים שונים של הפרוטוקול מוצגות. קנה מידה של סרגלים = 50 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2 : ניתוח חיסוני מייצג של תאים מבדילים. תאים iPSC-אפס ו-iPSC-ניפ נותחו על-ידי כתמים חיסוניים עבור הביטוי של סמן הפלדה OCT4 (סגול) ו הפאן-עצבי סמן TUJ1 (אדום) ביום 0 (א), יום 3 (ב) וביום 5 (ג). גרעינים היו מוכתמים נגד DAPI. תמונות קונפוקלית וקד נרכשו במיקרוסקופ לייזר קונפוקלית מיקרוסקופ מיקוד (ראה טבלה של חומרים) באמצעות מטרה 0.75 20x NA עם זום 2x, 1024 x 1024 פיקסל, מצויד עם 405 ננומטר, 473 nm, 559 nm ו-635 לייזרים nm. הגדרת מסנן עבור DAPI, אלקסה Fluor 594 ו אלקסה Fluor 647 שימשו. קנה מידה של סרגלים = 50 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3 : ניתוח חיסוני הנציג של מנוע מנועי iPSC נגזר. התאים iPSC-אפס ו iPSC-ניפ נותחו על ידי כתמים חיסוניים עבור הביטוי של הפאן-נוירוונאליות סמן TUJ1 (אדום) ואת תא העצב מנוע סמן צ ' אט (כולין acetyltransferase; ירוק) ביום 12. גרעינים היו מוכתמים נגד DAPI. תמונות confocal וקד נרכשו כפי שמתואר באיור 2 המקרא. קנה מידה של סרגלים = 50 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4 : ניתוח פונקציונלי של נוירונים מנוע השדרה ואת הגולגולת. (A) שדה בהיר תמונה של מהדק טלאי תא שלם על מנוע השדרה הנגזר IPSC אפס. (ב) עקומת ה-I/V של הנציג עבור Na+ נוכחי נרשם ב-Ipsc אפס נגזר MNs בתגובה לסדרה של צעדי מתח הגוברת (n = 26; החזקת פוטנציאל שווה ל-60 mV). (ג) עקומת I/V של הנציג K+ הוקלט ב-Ipsc אפס נגזר MNs בתגובה לסדרה של צעדי מתח הגוברת (n = 23; החזקת פוטנציאל שווה ל-40 mV). (ד) הסימן המייצג של רכבת של פוטנציאל פעולה עורר בתגובה לזריקה הנוכחית לאורך 1 של + 60 pA. (ה) היסטוגרמה המייצגת את אחוז ה-IPSC אפס נגזר MNs מעורר פוטנציאל הפעולה בכל פעימה נוכחית (n = 18). (ו) היסטוגרמה המציגה את תדר הירי המעורר בכל פעימה נוכחית (n = 18). הקלטה אלקטרופיסיולוגית. בוצעה תחת מיקרוסקופ זקוף מערכת ההקלטה של זרמי הקרום מסומנת בטבלת החומרים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Supplementary Figure 1
איור משלים S1: בידול MN באמצעות אפיזומhiPSCs. (א) ברייטפילד תמונות של הבחנה אפיזומלית-אפס (משמאל) ואפיזומלי-ניפ (מימין) בנקודות הזמן המסומנות. קנה מידה של סרגלים = 50 μm. (ב) ניתוח ביטוי של הסמנים המצוינים בהבחנה התהיפנוזות אפיזומלית-אפס (למעלה) ובתאים אפיזומטיים-ניפ (למטה) על ידי רביעיית בזמן אמת-PCR. עבור כל סמן, נקודת הזמן עם הביטוי הגבוה ביותר שימש כמדגם מכייל. השימוש התחל עבור ISL1 הם ספציפיים עבור הגן האנדוסוגני. (ג) חיסוני הפאן-עצבי TUJ1 (אדום) ו הגולגולת MN סמן PHOX2B (ירוק) ב הבדיל (יום 6) אפיזומתית-אפס (משמאל) ו אפיזומלי-ניפ (מימין) תאים. גרעינים מוכתמים נגד DAPI. סרגל קנה מידה עבור כל החלוניות: 50 μm. (ד) ניתוח הביטוי של HB9 ו-PHOX2B בהבחנה אפיזומלית-אפס (למעלה) ואפיזומטיים-ניפ (למטה) תאים על ידי רביעיית בזמן אמת-PCR. יום 0 שימש כדגימת הכייל. הפעולות התחל ושיטות ה-PCR מדווחות ב-De סאנטיס ואח ', 201812. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Supplementary Figure 2
דמות משלימה S2: MN בידול באמצעות DS2U iPSCs. (א) ברייטפילד תמונות של הבחנה DS2U-אפס (משמאל) ו-DS2U-ניפ (מימין) בנקודות הזמן המסומנות. קנה מידה של סרגלים = 50 μm. (ב) ניתוח הביטוי של הסמנים המצוינים בהבחנה DS2U-0 (למעלה) ובתאים DS2U-ניפ (למטה) על-ידי רביעיית בזמן אמת-PCR. עבור כל סמן, נקודת הזמן עם הביטוי הגבוה ביותר שימש כמדגם מכייל. השימוש התחל עבור ISL1 הם ספציפיים עבור הגן האנדוסוגני. (ג) חיסוני הפאן-עצבי TUJ1 (אדום) ו הגולגולת MN סמן PHOX2B (ירוק) בבדיל (יום 6) DS2U-אפס (שמאל) ו DS2U-ניפ (מימין) תאים. גרעינים מוכתמים נגד DAPI. קנה מידה של סרגלים = 50 μm. (ד) אנליזה של הביטוי של HB9 ו-PHOX2B בהבחנה DS2U-אפס (למעלה) וDS2U-ניפ (למטה) בתאים של רביעיית בזמן אמת-PCR. יום 0 שימש כדגימת הכייל. הפעולות התחל ושיטות ה-PCR מדווחות ב-De סאנטיס ואח ', 201812. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Supplementary Figure 3
הספרה S3: HOX ביטוי גנים. (א) ניתוח של הביטוי של ארבעה גנים hox שונים (Hox A2, Hox B1, Hox A4, Hox B5) לאחר 5 ימים של הבידול של ipsc-אפס ו ipsc-אפס + RA תאים על ידי רביעיית בזמן אמת-PCR. IPSC-0 ביום 0 שימש כמדגם מכייל. (ב) ניתוח הביטוי של ארבעה גנים hox שונים (Hox A2, Hox B1, Hox A4, Hox B5) לאחר 5 ימים של הבידול של ipsc-ניפ ו IPSC-ניפ + RA תאים על ידי רביעיית בזמן אמת-PCR. IPSC-ניפ ביום 0 שימש את המדגם מכייל. (ג) הצמדים המולקולארית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Supplementary Figure 4
איור משלים S4: ניתוח השראה דוקסיציקלין. (א) ניתוח בזמן אמת רביעיית-PCR של הביטוי של אקסוגני Ngn2 ב-IPSC-אפס (למעלה) ו ipsc-ניפ (למטה) תאים מטופל או תרבותי עבור 24 h בנוכחות דוקסיציקלין בריכוז שונים (0.5 μm, 1.0 μm, 2.0 μm). Ngn2 היה מנותח עם מפרט מיוחד עבור גן העכבר האקסוגני. קו iPSC הורים, נטול מבנים אפס ו ניפ, נכלל בניתוח כפקד. ביטוי הטרנסגנים באיסק-אפס ו-iPSC-ניפ הneglectable בהעדר דוקסיציקלין. iPSC-אפס ו-iPSC-ניפ ביום 0 שימשו כדגימות מכייל. (ב) ניתוח בזמן אמת של רביעיית-PCR של הביטוי של אקסוגני Ngn2 בהבחנה IPSC-אפס (שמאל) ו IPSC-ניפ (ימין) תאים בנקודות הזמן המצוין של הפרוטוקול. Ngn2 היה מנותח עם מפרט מיוחד עבור גן העכבר האקסוגני. iPSC-אפס ו-iPSC-ניפ ביום 0 שימשו כדגימות מכייל. הפעולות התחל ושיטות ה-PCR מדווחות ב-De סאנטיס ואח ', 201812. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

פרוטוקול זה מאפשר להמיר ביעילות את iPSCs אנושי לתוך מנוע השדרה ואת הגולגולת נוירונים בזכות הביטוי החוץ רחמי של השושלת הספציפיים שעתוק גורמים. הטרנסגנים האלה הם inducible על ידי דוקסיציקלין ו משולבים באופן מובן בגנום הודות לטרנספבאק המבוסס על מוקטור. באוכלוסיה מעורבת, עותק אחד או כמה של וקטור השני יהיה משולב באופן אקראי לתוך הגנום של תאים בודדים, הגדלת הסיכון של שינויים ביושר הגנום. יתר על כן, מבחר פרוגרסיבי של השיבוטים iPSC עשוי להתרחש לאורך זמן, עם השלכות אפשריות על בידול ועל ניתוח השוואתי של מחלות ושורות תא שליטה. בסך הכל, iPSC-נגזר MNs שהתקבלו עם פרוטוקול זה יהיה בלתי מתאים לרפואה רגנרטיבית. עם זאת, השיטה שלנו יכול להיות שימושי במיוחד עבור מידול מחלת העצב מנוע מבחנה. נקודות מרכזיות של כוח מיוצגים על ידי תנאי תרבות פשוטה מאוד, מהירות של המרת MN, את הרמה הגבוהה של התבגרות של iPSC-נגזר MNs ואת האפשרות להשיג הן השדרה והן MNs הגולגולת, כפי שהוצג בעבר על ידי ניתוח ביטוי של גנים ספציפיים לסמן12. החוסן של הפרוטוקול מוכח על ידי התוכתו. עד כה, החלתי בהצלחה פרוטוקול זה יותר 30 פעמים עבור דור השדרה ו/או הגולגולת MN, הערכת את התוצאות על ידי סמן ו/או ניתוחים פונקציונליים. הצלחנו לשמר בהצלחה תרביות נוירונים מוטוריים עד חודשיים ללא ירידה ניכרת של יכולת הקיום. יתר על כן, לאחר העברת שורה iPSC באופן בלתי נשכח הושג, כל ניסוי יכול להיות נכתבו על ידי דוקסיציקלין השראה ללא צורך בזיהום חדש. גם וקטורים ויראליות אינם נדרשים. תוצאות הנציג שהוצגו כאן הושגו על ידי electroporating iPSCs עם מערכת אלקטרופורציה התא המצוין בטבלה של חומרים. עם זאת, שיטות אלקטרופורציה אחרות עשויות לייצג אפשרויות חלופיות. לעומת זאת, בניסיון שלנו, מערכות העברה שמבוססות על ליפופה אינן אפשרות טובה לתאי גזע בעלי עוצמה מרבית12. אוכלוסיות תאים שהתקבלו בסוף התהליך מורכבים כמעט באופן בלעדי של MNs, הימנעות הצורך טיהור נוסף (למשל, על ידי FACS). כפי שראינו קודם לכן12, הפרוטוקול מאפשר להשיג 90% TUJ1-חיוביים תאים, אשר 95% שבו גם PHOX2B חיובי בתרבויות ניפ-נגזרות.

אנו יכולים לקנא בכמה נקודות קריטיות שחייבות להילקח בחשבון באופן מדויק. ראשית, איכות האוכלוסיה הראשונית של iPSCs היא חיונית כדי להבטיח המרה אחידה ועקבית לתוך MNs. תרבויות המכילות חלקיק משמעותי של בידול (יותר מ 5-10%) יש להימנע. יש לנו להגדיר את הפרוטוקול באמצעות מדיום iPSC אנושי המתואר בטבלה של חומרים כמדיום תחזוקה עבור מובחן iPSCs. מדיה מוגדרת מסחרית אחרת עשויה לייצג אפשרויות חלופיות חוקיות, למרות שלא התייחסו לנקודה זו בעבודה הנוכחית. מאחר שקומפוזיציה במדיה עשויה להשפיע על שיעור ההתפשטות של אוכלוסיית התאים המתחילים, הסתגלות הפרוטוקול למדיית תחזוקה אחרת עשויה לדרוש אופטימיזציה של הדחיסות הראשונית ביום 0. לאחר החצייה, חשוב לשמור על תאים תחת בחירה אנטיביוטית עבור לפחות 2 שבועות כדי להשיג קווי תאים יציבים. זה עשוי להיות מתאים ליישומים מסוימים לגזור קווי שבטים לאחר שילוב התבאק, על מנת להשיג אוכלוסיה הומוגנית יותר במונחים של רמות של ביטוי טרנזגנטי ושליטה טובה יותר של אתרי אינטגרציה. צפיפות התאים ביום 0, זמן התוספת של דוקסיציקלין למדיום, הוא פרמטר מכריע. כפי שהוזכר בסעיף תוצאות הנציג, אנו מעריכים צפיפות תא מיטבית כדי להבטיח שגיאה בלתי מנוצחת. אנחנו לא יכולים להוציא את זה לקוי של קווי גזע אחרים שעלולים לדרוש צפיפות ראשונית שונה, שאמורה להיקבע באופן אמפירי בניסויים בפיילוט, כאשר קצב השכפול יכול להשתנות בצורה משמעותית בין שורות בודדות. מתג בינוני כדי Neurobasal סיס/B27 חייב להתרחש לאחר 48 h מאז מ השראה (סעיף 3.3): בידול עשוי לגרום איטי יותר יעיל פחות אם התאים אינם מוחזקים עבור 2 ימים שלמים במדיום Dמאמ/F12. יש לבצע את דיסוציאציה ביום 5 מבלי להלחיץ את התאים המבדילים. הזמן של דגירה עם מגיב הדיסוציאציה התא (שלב 3.4) עשוי להיות שונה מאצווה כדי אצווה ויש להעריך בזהירות בניסויים פיילוט. לאחר הדגירה עם מגיב הדיסוציאציה הנייד, כל מונאולייר התא מתנתק מלוחית. לאחר מכן, יש לנתק אותה בזהירות מהליטוף, כמתואר בסעיף 3.4, לשמר את שלמות התאים ולהימנע ממתח מכני, שיכול להיות בעל השפעה שלילית על תחזוקת תרבות התא מעבר ל-D5. לבסוף, שמנו לב כי לאחר ציפוי מחדש MNs לדבוק טוב יותר בתרבות הרקמה פלסטיק מאשר זכוכית. שמיכות פולימריות להבטחת הדבקות התא אופטימלית ותכונות אופטיות מתאימות הן אפשרות טובה עבור יישומים מבוססי מיקרוסקופ.

השיטה שלנו מייצגת "תכנות" ישיר של תאים בעלי עוצמה לתוך גורל mn, והוא אינו מסכם את צעדי הביניים שדרכם התאים העובריים רוכשים זהות של mn במהלך פיתוח vivo, כגון מפרט ראשוני לעור ו לאורך הצירים הדורגהים והרוחלי-קאואל. לכן, זה לא יהיה מתאים לדגמן האדם מפרט MN בחוץ למחקר, למשל, מנגנונים מולקולריים בבסיס בידול. מצד שני, הפרוטוקול שלנו מאפשר לייצר כמות ניכרת של MNs השדרה או הגולגולת ללא צורך בטיהור נוסף. לקיחת גם בהתחשב במידה של התבגרות השיגה, זה מייצג כלי שימושי ללמוד את הבסיס המולקולרי של מחלות ניווניות של תא העצב המנוע. מספר עקבי של קווי iPSC עם מוטציות פתוגניים ב מנוע תא עצב הקשורות גנים הופק על ידי הקהילה המדעית בשנים האחרונות. אוספים של MN "ניתן לתכנות" קווי iPSC יכול להיות ולכן נוצר בקלות על ידי שילוב יציב של מודולים אפס ו ניפ בקווים אלה iPSC המוטציות. אנו יכולים לקנא, כיישום עתידי אפשרי של השיטה, האפיון של הדטרמיניזם האוטונומי התאי המקנים רגישות שונה לתתי-סוגים נפרדים של MN, על ידי השוואת זה לצד הגולגולת והשדרה MNs שהתקבלו מ iPSCs עם אותו רקע גנטי. יתר על כן, המרה אפקטיבית של iPSCs לתוך MNs בתנאי תרבות פשוטה כי צריך מניפולציה מינימלית (כלומר, ללא מעבר דרך הגופים embryoid) וזה יכול בקלות מדרגי, עשוי להקל מאוד אוטומטית תרופה בתפוקה גבוהה הקרנת גישות למחלות תא מנוע. במידול חוץ גופית של מחלות נוירוניווניות התפרצות מבוגר יכול להיות מאתגר בשל הטבע כמו foetal של הנוירונים הנגזר של iPSC14. אסטרטגיות קודמות שנוצרו כדי להאיץ את ההזדקנות של MNs נגזר על ידי הבידול קונבנציונאלי של iPSCs, כגון progerin overexpression יטוי15, עשוי להיות משולב עם השיטה שלנו כדי להשיג מודלים מחלה טובה יותר.

השיטה המתוארת כאן, בהתבסס על הביטוי הinducible של גורמי התמלול שבתיווך על-ידי וקטור התבאק, ניתן להחיל על סוגי תאים אחרים המושרה. בעבר הצגנו כי תאים שריר השלד ניתן לקבל מן iPSCs האדם על ידי ביטוי של BAF60c ו Myod16. באופן דומה, אנו יכולים לדמיין את האפשרות להאריך את השיטה סוגי תאים אחרים של העניין, כולל סוגים אחרים של הנוירוונאליות ו astrocytes, על ידי הביטוי הביטוי של קבוצות המתאימות של גורמי תכנות17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף

Acknowledgments

המחברים רוצים להודות למתקן ההדמיה במרכז לחיים ננו מדע, המכון הפוליטכני איטלקית די Tecnologia, לתמיכה וייעוץ טכני. אנו אסירי תודה לחברי המרכז לחיים ננו מדע לדיון מועיל. עבודה זו נתמכת באופן חלקי על ידי מענק AriSLA (מענק הטייס 2016 "StressFUS") כדי AR.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics