मानव प्रेरित Pluripotent स्टेम सेल (iPSCs) कार्यात्मक रीढ़ की हड्डी और कपालीय मोटर ंयूरॉंस में PiggyBac वैक्टर का उपयोग में परिवर्तन

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस प्रोटोकॉल एक रीढ़ की हड्डी या कपाल पहचान के साथ मोटर ंयूरॉंस में प्रेरित pluripotent स्टेम सेल के तेजी से और कुशल रूपांतरण की अनुमति देता है, inducible piggybac वैक्टर से प्रतिलेखन कारकों की अस्थानिक अभिव्यक्ति द्वारा ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

हम यहां मानव प्रेरित pluripotent स्टेम सेल (iPSCs) से कार्यात्मक रीढ़ की हड्डी और कपाल मोटर ंयूरॉंस प्राप्त करने के लिए एक विधि का वर्णन । मोटर न्यूरॉन में प्रत्यक्ष रूपांतरण प्रतिलेखन कारकों के वैकल्पिक मॉड्यूल, अर्थात् Ngn2, Isl1 और Lhx3 (शूंय) या Ngn2, Isl1 और Phox2a (एनआईपी) के अस्थानिक अभिव्यक्ति द्वारा प्राप्त की है । शून्य और चुटकी क्रमश: स्पाइनल और कपालीय मोटर न्यूरॉन पहचान निर्दिष्ट करें. हमारा प्रोटोकॉल संशोधित iPSC लाइनों के उत्पादन के साथ शुरू होता है जिसमें शून्य या चुटकी एक piggyBac ट्रांससन वेक्टर के माध्यम से जीनोम में stably एकीकृत कर रहे हैं । इसके बाद, 5 दिनों में, आईपीएससी को एमएन प्रजनकों में परिवतत करने के लिए ट्रांसजीन की अभिव्यक्ति को डॉक्क्साइलीन और लीड्स द्वारा प्रेरित किया जाता है । बाद में परिपक्वता, 7 दिनों के लिए, रीढ़ की हड्डी या कपालीय MNs की सजातीय आबादी की ओर जाता है । हमारे विधि पिछले प्रोटोकॉल पर कई लाभ रखती है: यह बहुत तेजी से और सरल है; यह वायरल संक्रमण या आगे एमएन अलगाव की आवश्यकता नहीं है; यह विभिन्न MN subpopulations या (रीढ़ की हड्डी और कपाल) एक उल्लेखनीय डिग्री के साथ पैदा करने की अनुमति देता है, के रूप में कार्रवाई की क्षमता की गाड़ियों को आग करने के लिए योग्यता का प्रदर्शन. इसके अलावा, मिश्रित आबादी से शुद्धि के बिना मोटर ंयूरॉंस की एक बड़ी संख्या में प्राप्त किया जा सकता है । iPSC-व्युत्पंन रीढ़ की हड्डी और कपाल मोटर ंयूरॉंस के लिए इस्तेमाल किया जा सकता है Amyotrophic पार्श्व स्केलेरोसिस और अंय neurodegenerative मोटर न्यूरॉन के रोगों के इन विट्रो मॉडलिंग । सजातीय मोटर ंयूरॉन आबादी कोशिका प्रकार विशिष्ट दवा स्क्रीनिंग के लिए एक महत्वपूर्ण संसाधन का प्रतिनिधित्व हो सकता है ।

Introduction

मोटर न्यूरॉन (MN) अध: पतन मानव रोगों जैसे कि Amyotrophic पार्श्व स्केलेरोसिस (ALS) और स्पाइनल मस्कुलर शोष (SMA) में एक प्रेरणाकारक भूमिका निभाता है । मानव MN की जटिलता को पुनर्गृहीत करने वाले इन विट्रो सेल मॉडल सिस्टम में उपयुक्त स्थापना करना नए चिकित्सीय दृष्टिकोणों के विकास की दिशा में एक महत्वपूर्ण कदम है । प्रेरित pluripotent स्टेम सेल (ipscs), जो उल्लेखनीय अनेकवंशीय भेदभाव गुणों के साथ संपंन कर रहे हैं, अब मोटर ंयूरॉन रोग1,2से प्रभावित रोगियों की संख्या से व्युत्पंन किया गया है । जीएमएन रोगों से जुड़े रोगजनक उत्परिवर्तनों को लेकर अतिरिक्त iPSC लाइनें जीन संपादन द्वारा उत्पन्न किया गया है, नियंत्रण से शुरू "स्वस्थ" pluripotent स्टेम सेल3. इन विट्रो रोग मॉडलिंग और दवा स्क्रीनिंग के लिए उपयोगी उपकरण का प्रतिनिधित्व करते हैं, बशर्ते कि MNs में iPSC विभेदन के लिए उचित तरीके उपलब्ध हैं । इस पद्धति के विकास के पीछे तर्क यह है कि वैज्ञानिक समुदाय को एक तेज और कुशल विभेदन प्रोटोकॉल के साथ एमएन रोगों में रुचि प्रदान करने के लिए परिपक्व कार्यात्मक एमएनएस को जंम दे रही है । इस विधि का पहला लाभ निष्पादन की अपनी समय सीमा है । शक्ति का एक अंय प्रासंगिक बिंदु किसी भी शुद्धि कदम के उंमूलन से आता है । अंत में, प्रोटोकॉल मोटर ंयूरॉंस के दो अलग आबादी उत्पंन करने के लिए इस्तेमाल किया जा सकता है ।

एमएनएस के विभिन्न उपप्रकारों के सृजन की संभावना विशेष रूप से एमएन रोगों की मॉडलिंग के लिए प्रासंगिक है । नहीं सभी MN उपप्रकार ALS और SMA में समान रूप से कमजोर कर रहे हैं और विभिन्न मोटर इकाइयों में लक्षण की शुरुआत बहुत रोग का निदान को प्रभावित करता है. ALS में, ऊपरी और निचले अंगों में शुरू लक्षण के साथ रीढ़ की हड्डी में शुरुआत के बारे में 3-5 साल4में मौत की ओर जाता है । इसके विपरीत, कंदाकार शुरुआत, कपाल MNs के पतन के साथ शुरू, एक सबसे बुरा पूर्वानुमान है. इसके अलावा, कंदाकार शुरुआत का प्रतिशत आरएनए में उत्परिवर्तनों के साथ रोगियों में काफी अधिक है-बाध्यकारी प्रोटीन fus और तेदेपा-४३ SOD1 उत्परिवर्तन5के साथ व्यक्तियों में से । वैकल्पिक MN विभेदन प्रोटोकॉल के लगभग समग्रता रेटिनॉइक एसिड की गतिविधि पर निर्भर करता है (आरए), जो एक रीढ़ की हड्डी को ipscs6,7,8फर्क करने के लिए प्रदान करते हैं । यह आंतरिक कारकों का अध्ययन करने की संभावना को सीमित करता है, जो विशिष्ट MN उप प्रकार9,10में सुरक्षात्मक हो सकता है ।

माउस भ्रूणीय स्टेम कोशिकाओं में पिछले एक काम के साथ संगत11, हम हाल ही में दिखाया है कि मानव Ipscs में Ngn2 की एक्टॉपिक अभिव्यक्ति, Isl1 और LHX3 (शूंय) एक रीढ़ की हड्डी MN पहचान लाती है, जबकि Ngn2 और Isl1 प्लस Phox2a (एनआईपी) निर्दिष्ट कपाल MNs12। हम इसलिए एक कुशल प्रोटोकॉल विकसित किया है, एक 12 दिनों के बदलाव में कार्यात्मक गुणों के साथ संपंन मानव MNs के उत्पादन के लिए अग्रणी । इस विधि के प्रयोजन के लिए एक कम समय सीमा में प्राप्त करने के लिए और शुद्धि के लिए आवश्यकता के बिना (जैसे, FACS द्वारा), सेल अत्यधिक रीढ़ की हड्डी या कपाल पहचान के साथ MNs के लिए समृद्ध आबादी है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. मानव iPSCs का रखरखाव

  1. मैट्रिक्स लेपित प्लेटों की तैयारी
    1. पिघलना मैट्रिक्स की एक 5 मिलीलीटर की शीशी ( सामग्री की तालिकादेखें) 4 डिग्री सेल्सियस रात में । मूल मैट्रिक्स शेयर अलग स्टॉक सांद्रता और aliquots पर आते है तनुता घटक के अनुसार किया जाता है डेटा पत्रक पर संकेत दिया, व्यक्तिगत बहुत कुछ के लिए विशिष्ट । यह महत्वपूर्ण है के लिए शीशी और ट्यूबों बर्फ ठंडा रखने के लिए मैट्रिक्स की समयपूर्व जेलन को रोकने के । बर्फ पर पूर्व ठंडा cryotubes में aliquots में मैट्रिक्स बांटना । अप्रयुक्त aliquots पर-20 ° c फ्रीज ।
    2. के बारे में 2 घंटे के लिए बर्फ पर एक aliquot प्लेस गल ।
    3. एक ५० मिलीलीटर शंक्वाकार ट्यूब में 20 मिलीलीटर की ठंडी डीएमईएम के साथ मैट्रिक्स के aliquot पतला/
    4. अच्छी तरह से मिलाएं और ३५ mm व्यंजन में पतला मैट्रिक्स के 1 मिलीलीटर बांटना (अंय व्यंजनों की सतह क्षेत्र के अनुसार बराबर मात्रा में) ।
    5. कमरे के तापमान पर 1 ज के लिए पतला मैट्रिक्स युक्त व्यंजन रखने के लिए कोटिंग की अनुमति ।
      नोट: व्यंजन, parafilm के साथ बंद, अप करने के लिए 2 सप्ताह के लिए 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।
  2. स्टॉक समाधान की तैयारी (20 मिलीलीटर) और 1x काम कर रहे aliquots के कोमल सेल पृथक्करण अभिकर्मक ( सामग्रियों की तालिकादेखें) ।
    1. 10 मिलीग्राम/एमएल में PBS (Ca2 +/एमजी2 + मुक्त) करने के लिए पाउडर भंग ।
    2. एक ०.२२ μm फ़िल्टर झिल्ली के माध्यम से जीवाणुरहित फ़िल्टर ।
    3. 20 aliquots (प्रत्येक 1 मिलीलीटर) और 20 डिग्री सेल्सियस पर स्टोर तैयार करें ।
    4. उपयोग करने से पहले, PBS में एक aliquot तनु (Ca2 +/mg2 + मुक्त) 1 मिलीग्राम/एमएल (1x काम कर रहे aliquot) ।
      नोट: 1x कार्यशील aliquots 4 ° c करने के लिए 2 सप्ताह के लिए संग्रहीत किया जा सकता है ।
  3. मानव iPSCs passaging.
    1. शुरू करने से पहले: यदि 4 डिग्री सेल्सियस, पूर्व गर्म मैट्रिक्स लेपित प्लेटों में ३७ डिग्री सेल्सियस पर इनक्यूबेटर में 20-30 मिनट के लिए । पूर्व गर्म कमरे के तापमान पर मानव iPSC माध्यम की राशि ( सामग्री की तालिकादेखें) की जरूरत है । पूर्व गर्म DMEM/
    2. महाप्राण संवर्ध माध् यम
    3. PBS (Ca2 +/एमजी2 + मुक्त) के साथ ipscs कुल्ला ।
    4. 1x सौंय वियोजन समाधान (०.५ मिलीलीटर एक ३५ mm पकवान के लिए) जोड़ें । ३७ डिग्री सेल्सियस पर इनक्यूबेट जब तक कालोनियों के किनारों थाली से अलग करने के लिए शुरू, आमतौर पर 3-5 मिनट.
    5. कोमल वियोजन समाधान महाप्राण, iPSC कालोनियों को अलग करने के लिए सावधान नहीं किया जा रहा.
    6. Dmem/F12 (एक ३५ mm पकवान के लिए 2 मिलीलीटर) के साथ कोशिकाओं को धोने और महाप्राण जा रहा है कोशिकाओं को अलग करने के लिए सावधान नहीं किया जा रहा है । इस चरण को एक बार दोहराएं ।
    7. मानव iPSC मध्यम (एक ३५ mm पकवान के लिए 1 मिलीलीटर) जोड़ें ।
    8. धीरे से एक सेल भारोत्तोलक के साथ बंद कालोनियों अलग और एक 15 मिलीलीटर ट्यूब को हस्तांतरण ।
    9. धीरे से एक P1000 pipetting 3-4 बार के साथ ऊपर और नीचे pipetting द्वारा सेल clumps तोड़ ।
    10. महाप्राण को मेट्रिक्स-कोटेड प्लेट से सुखाना ।
    11. मानव iPSC माध्यम के उपयुक्त संस्कृति की मात्रा में बीज कोशिकाओं । विभाजन अनुपात लाइन के लिए लाइन से भिंन हो सकते है और के बारे में 1:4-1:8 है । मीडियम को रोजाना बदलें ।

2. शूंय और चुटकी Inducible आईपीएससी लाइनों की पीढ़ी

  1. सेल ट्रांसजेक्शन ।
    1. PBS (Ca2 +/2 + मुक्त) के साथ कोशिकाओं कुल्ला ।
    2. सेल वियोजन अभिकर्मक जोड़ें ( सामग्री की तालिकादेखें) (०.३५ एक ३५ mm पकवान के लिए एमएल) और ३७ डिग्री सेल्सियस पर सेने जब तक एकल कोशिकाओं (5-10 मिनट) अलग कर रहे हैं ।
    3. धीरे से एक P1000 pipetting 3-4 बार pipetting ऊपर और नीचे से पूरा सेल जुदाई ।
    4. एक 15 मिलीलीटर ट्यूब में ले लीजिए और PBS जोड़ें (Ca2 +/ कक्षों की गणना करना ।
    5. गोली 106 कोशिकाओं और बफर आर के १०० μl में resuspend (सेल electroporation किट में शामिल, सामग्री तालिकादेखें) ।
    6. ट्रांस्जेक्शन के लिए प्लाज्मिड डीएनए जोड़ें: ४.५ माइक्रोग्राम पक्षाभ सदिश (epb-बीएसडी-टीटी-शूंय या epb-बीएसडी-टीटी-एनआईपी12) और ०.५ माइक्रोग्राम के piggybac transposase प्लास्मिड13
    7. सेल electroporation प्रणाली के साथ transfect ( सामग्री की तालिकादेखें) निर्माता के निर्देशों के अनुसार और के रूप में पहले निंनलिखित मानकों के साथ3 वर्णित: १,२०० वी वोल्टेज, 30 एमएस चौड़ाई, 1 पल्स । बीज मानव iPSC मध्यम में कोशिकाओं के साथ पूरक 10 μM Y-२७६३२ (रॉक अवरोध करनेवाला, सामग्री तालिकादेखें) एक 6 मिमी मैट्रिक्स में लेपित पकवान ।
  2. एंटीबायोटिक दवाओं के साथ चयन ।
    1. ट्रांस्जेक्शन के दो दिन बाद, कल्चर मीडियम में 5 μg/mL blasticidin जोड़ें ।
    2. गैर-transfected कोशिकाओं के अधिकांश blasticidin चयन के ४८ एच के भीतर मर जाएगा । जिन कोशिकाओं ने जीनोम में ट्रांसजीन को इंटीग्रेट नहीं किया है, उनका प्रतिचयन करने के लिए ब्लैससिडिन में कम से 7-10 दिनों तक कोशिकाओं को रखें ।
    3. एक मिश्रित आबादी के रूप में stably transfected कोशिकाओं को बनाए रखने, transजीन्स और विभिन्न एकीकरण साइटों की विभिन्न संख्या के साथ कोशिकाओं से बना है, या एकल क्लोनों को अलग.
    4. Ngn2 के लिए ट्रांसजीन-स्पेसिफिक प्राइमर्स के साथ आरटी-पीसीआर द्वारा 1 μg/mL डॉक्सीसाइलिन प्रेरण पर, ट्रांसजीन की प्रभावी अभिव्यक्ति के लिए जांच करने के लिए एक अतिरिक्त डिश तैयार करें (आगे: TATGCACCTCACCTCCCCATAG; रिवर्स: GAAGGGAGGAGGGCTCGACT), जैसा कि पहले12वर्णित है ।
    5. इस स्तर पर, उपंयास शूंय और चुटकी के शेयरों फ्रीज-iPSC लाइनों मानव Ipsc के लिए ठंड के माध्यम में ( सामग्री की तालिकादेखें) ।

3. मोटर न्यूरॉन विभेदन

  1. सेल वियोजन अभिकर्मक के रूप में वर्णित के साथ कोशिकाओं dissociate (2.1.1 कदम.-2.1.3.) । एक 15 मिलीलीटर ट्यूब में वियोजित कोशिकाओं को इकट्ठा करने और dmem/F12 के 5 संस्करणों के साथ पतला । गोली कोशिकाओं और मानव iPSC मध्यम में 10 μM रॉक निरोधक के साथ पूरक resuspend । ६२,५०० कोशिकाओं के घनत्व में मैट्रिक्स लेपित व्यंजनों पर कोशिकाओं और बीज की गणना/
  2. दिन के बाद, डीएमईएम के साथ माध्यम की जगह/F12, 1x स्थिर एल glutamine अनुरूप, 1x गैर आवश्यक अमीनो एसिड (NEAA) सेल संस्कृति के पूरक और 0.5 x पेनिसिलिन/ यह विभेदन के 0 दिन के रूप में माना जाता है । 1 दिवस पर, मध्यम और doxycycline ताज़ा करें ।
  3. 2 दिन में, 5 μM DAPT, 4 μM SU5402 और 1 μg/एमएल doxycycline (सामग्री की तालिका देखें) के माध्यम से Neurobasal/B27 माध्यम (Neurobasal मध्यम पूरक 1x B27, 1x स्थिर एल glutamine अनुरूप, 1x NEAA और 0.5 एक्स penicillin/ ). मध्यम और doxycycline हर दिन 5 दिन तक ताज़ा करें ।
  4. दिन 5: सेल वियोजन अभिकर्मक के साथ वियोजन सेल ( सामग्रियों की तालिकादेखें) ।
    1. PBS (Ca2 +/2 + मुक्त) के साथ कोशिकाओं कुल्ला ।
    2. सेल वियोजन अभिकर्मक जोड़ें (०.३५ मिलीलीटर एक ३५ mm पकवान के लिए) और ३७ डिग्री सेल्सियस पर सेते जब तक पूरे सेल monolayer पकवान से अलग । ध्यान दें कि इंक्यूबेशन के दौरान सिंगल सेल अलग नहीं होंगे ।
    3. DMEM/F12 के 1 मिलीलीटर जोड़ें और एक 15 मिलीलीटर ट्यूब में कोशिकाओं को इकट्ठा ।
    4. धीरे से एक P1000 pipetting 10-15 बार pipetting ऊपर और नीचे से पूरा सेल जुदाई ।
    5. DMEM/F12 के 4 मिलीलीटर जोड़ें और कोशिकाओं की गणना ।
    6. इस स्तर पर, सेल बर्फ़ीली माध्यम में मोटर न्यूरॉन progenitors फ्रीज ( सामग्री की तालिकादेखें), निर्माता के निर्देश के अनुसार.
    7. गोली कोशिकाओं और Neuronal मध्यम (Neuroबसंल/B27 मध्यम 20 एनजी/एमएल BDNF, 10 एनजी/एमएल GDNF और २०० एनजी/एमएल एल ascorbic एसिड के साथ पूरक में resuspend, सामग्री की तालिकादेखें) 10 ΜM रॉक अवरोध के साथ पूरक ।
    8. बीजों को पॉली-ऑर्निथीन/लैमिनिन-या वैकल्पिक रूप से मैट्रिक्स-कोटेड पर १००,००० कोशिकाओं/ का प्रयोग करें-स्लाइड प्लास्टिक बहुलक coverslip के साथ समर्थन करता है ( सामग्री की तालिकादेखें) immunostaining विश्लेषण के लिए.
  5. 6 दिन, रॉक अवरोध रहित ताजा न्यूरोनल माध्यम के साथ माध्यम बदल जाते हैं । अगले दिन हर 3 दिन में आधे मीडियम को रिफ्रेश करें । संस्कृति माध्यम को सतह से अलगाव को रोकने के लिए बहुत सावधानीपूर्वक बदला जाना चाहिए ।

4. immunostaining विश्लेषण

  1. सेल निर्धारण । PBS (Ca2 +/mg2 +) के साथ कोशिकाओं को कुल्ला और 4% में 15 मिनट के लिए सेने pbs में paraformaldehyde (ca के साथ2 +/
    चेतावनी: पैराफार्मलेडिहाइड विषाक्त और कैंसर का कारण होने की आशंका है । त्वचा और आंखों के साथ संपर्क से बचें और एक रासायनिक धूआं हुड के नीचे संभाल ।
  2. PBS के साथ permeabilize (Ca2 +/Mg2 +) युक्त ०.१% ट्राइटन एक्स-१०० कमरे के तापमान पर 5 मिनट के लिए ।
  3. एंटीबॉडी ब्लॉकिंग समाधान (एबीएस: 3% BSA में Ca2 +/Mg2 +) के साथ कमरे के तापमान पर 30 मिनट के लिए इनक्यूबेट ।
  4. एबीएस में प्राथमिक एंटीबॉडी के साथ कमरे के तापमान पर 1 घंटे के लिए सेक्यूबेट: anti-TUJ1 (1:1000; खरगोश) और एंटी-Oct4 (1:200; माउस) या एंटी-चैट (एंटी-कोलीन एसिटाइलट्रांस्ट्रांसफर; 1:150; बकरी) । सामग्री तालिकादेखें ।
  5. उपयुक्त गधा ABS में द्वितीयक एंटीबॉडी जोड़ी के साथ कमरे के तापमान पर ४५ मिनट के लिए सेबेट: विरोधी माउस Alexa Fluor ६४७ (1:250), विरोधी खरगोश Alexa Fluor ५९४ (1:250) और विरोधी बकरी Alexa Fluor ४८८ (1:250) । सामग्री तालिकादेखें ।
  6. कमरे के तापमान पर 5 मिनट के लिए ०.४ μg/एमएल DAPI में सेक्यूबेट करने के लिए लेबल नाभिक ।
  7. बढ़ते माध्यम से कोशिकाओं को माउंट ( सामग्री की तालिकादेखें) एक प्रतिदीप्ति माइक्रोस्कोप पर इमेजिंग के लिए ।

5. पैच-दबाना रिकॉर्डिंग के माध्यम कार्यात्मक लक्षण वर्णन

  1. निम्नलिखित के रूप में HEPES-equilibrated बाहरी समाधान (NES) तैयार: १४० मिमी NaCl, २.८ मिमी KCl, 2 मिमी CaCl 2, 2 मिमी MgCl2, 10 मिमी hepes, और 10 मिमी ग्लूकोज. 290-300 mω के बीच परासारिता सेट करें । पीएच को ७.३ के लिए 1N NaOH का उपयोग कर समायोजित करें और 4 डिग्री सेल्सियस पर समाधान की दुकान ।
  2. आंतरिक समाधान तैयार करें: १४० मिमी K-gluconate, 2 मिमी NaCl, 5 मिमी बाप्टा, 2 मिमी MgCl2, 10 मिमी hepes, 2 मिमी मिलीग्राम-एटीपी, ०.३ मिमी ना-gtp. 1m KOH के साथ ७.३ पीएच समायोजित करें और जांच लें कि परासारिता के आसपास २९० mω पर सेट है । छोटे aliquots में-20 डिग्री सेल्सियस पर समाधान फ्रीज ।
  3. प्रयोगों को चलाने से पहले, के बारे में 28-30 डिग्री सेल्सियस के लिए एक पानी के स्नान में NES समाधान पूर्व गर्म ।
  4. कुछ बोरोसिलिकेट माइक्रोपिपेट्स खींचो (आईडी ०.८६ मिमी; OD १.५ mm) एक टिप प्रतिरोध असर: 5-6 mω और पिपेट धारक में बढ़ते से पहले intracellular समाधान के साथ भरें ।
    नोट: क्लोराइड चांदी तारों की रिकॉर्डिंग इलेक्ट्रोड और संदर्भ इलेक्ट्रोड करने के लिए ब्लीच में न्यूनतम 30 मिनट के लिए याद रखें ताकि तार की सतह पर एजीसीएल की एक समान परत बनाने के लिए ।
  5. रिकॉर्डिंग चैंबर में पेट्री डिश स्थानांतरण और 1-2 मिलीलीटर/मिनट पर NES समाधान के साथ चैंबर चलो । एक इनलाइन हीटर से गुजरने वाले प्रवाह को 30 डिग्री सेल्सियस के तापमान पर सेट करने दें ताकि समाधान को गर्म रखा जा सके ।
  6. एक ईमानदार माइक्रोस्कोप के तहत इलेक्ट्रोफिजियोलॉजिकल रिकॉर्डिंग चैंबर रखें । रिकार्ड झिल्ली धाराओं पैच के साथ-दबाना एम्पलीफायर और एक उपयुक्त सॉफ्टवेयर के साथ डेटा प्राप्त.
  7. एम्पलीफायर नियंत्रण सॉफ्टवेयर खोलें, और 10 kHz पर मान 1 और Bessel फिल्टर पर संकेत लाभ सेट. सुनिश्चित करें कि बेसल फ़िल्टर २.५ बार कम नमूना आवृत्ति से है ।
  8. रिकॉर्डिंग सॉफ्टवेयर में वोल्टेज दबाना और वर्तमान दबाना प्रयोगों के लिए प्रयोगात्मक प्रोटोकॉल सेट करें ।
  9. प्रोटोकॉल सेटिंग में, प्रासंगिक उत्तेजना मोड टिक और 25 kHz पर नमूना आवृत्ति सेट. फिर, तरंग टैब पर जाएँ और वोल्टेज या वर्तमान चरण आयाम और लंबाई का पालन के रूप में टाइप करें ।
  10. वोल्टेज-gated सोडियम धाराओं के लिए, 15 वोल्टेज कदम का उपयोग करें (५० ms अवधि प्रत्येक) से-१०० mV करने के लिए + ४० एमवी (10 एमवी वेतन वृद्धि). के बाद प्रोटोकॉल भागो समझौता सेल के एक होल्डिंग क्षमता-६० एमवी प्रवर्धक के माध्यम से । इसी प्रकार वॉल्टेज-गेटेड पोटेशियम धाराएँ वोल्टेज के कदम से (२५० ms अवधि प्रत्येक) से-30 एमवी से + ५० एमवी (10 एमवी वेतनवृद्धि) में दर्ज की गई सेल को-४० एमवी तक पैदा कर रहे हैं ।
  11. के फायरिंग संपत्तियों की जांच के लिए iPSC-व्युत्पंन कपाल और रीढ़ की हड्डी, दबाना कोशिकाओं, वर्तमान में दबाना मोड में, एक झिल्ली की क्षमता पर-७० mV और 4 वर्तमान दालों का उपयोग करें (1 s अवधि प्रत्येक) बढ़ाने के आयाम (से + 20 pa करने के लिए + ८० pA; 20 pA वृद्धि).
  12. प्रत्येक कोशिका वोल्टेज सक्रिय धाराओं के लिए प्राप्त करें, गोलीबारी गतिविधि और तीन निष्क्रिय गुणों के रूप में पूरे सेल समाई (सेमी), सेल झिल्ली प्रतिरोध (Rm) और आराम झिल्ली क्षमता (आरएमपी) पैदा की ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

विभेदन विधि का एक योजनाबद्ध वर्णन चित्र 1में दर्शाया गया है । मानव iPSCs (WT मैं लाइन3) Epb-बीएसडी-टीटी-शूंय या Epb-बीएसडी-टीटी-चुटकी, सृजन, blasticidin चयन, पर स्थिर और inducible सेल लाइनों12, इसके बाद ipscs-शूंय और ipscs-चुटकी, क्रमशः के रूप में संदर्भित करने के साथ transfected थे । Differentiating कोशिकाओं को pluripotency मार्कर OCT4 की अभिव्यक्ति और पैन neuronal मार्कर TUJ1 के लिए विशेषता थे. Immunostaining विश्लेषण 0 दिन में सभी कोशिकाओं में OCT4 की एक समान अभिव्यक्ति दिखाया, TUJ1 धनात्मकता के अभाव में (चित्रा 2). 3 दिन में, हम OCT4-सकारात्मक कोशिकाओं की संख्या में एक मजबूत कमी देखी गई, iPSCs फर्क के एक सबसेट में TUJ1 की अभिव्यक्ति द्वारा प्रतिबिंबित (चित्रा 2बी). 5 दिन में जनसंख्या में OCT4 की कोई अभिव्यक्ति नहीं देखी गई, जिसने TUJ1 की सुसंगत अभिव्यक्ति दिखाई और एक न्यूरोनल मॉर्टोलोजी (चित्रा 2) का अधिग्रहण किया । तब मोटर न्यूरॉन प्रजनकों को और अधिक परिपक्वता के लिए फिर से वियोजित किया गया और पुनः चढ़ाया गया. 7 दिनों के बाद (0 दिन के बाद से 12 दिन), कोशिकाओं को समान रूप से व्यक्त TUJ1 और परिपक्व मोटर न्यूरॉन मार्कर चैट (चित्रा 3). इसी तरह के परिणाम दो अतिरिक्त वाणिज्यिक iPSC लाइनों के साथ प्राप्त किया गया है ( सामग्री की तालिकादेखें), एक ही संस्कृति और भेदभाव की स्थिति का उपयोग कर (अनुपूरक चित्रा S1 और अनुपूरक चित्रा S2). इसी प्रकार शून्य-प्रेरित मोटर न्यूरॉन्स से माउस escs11के लिए, एक शून्य और चुटकी के साथ प्रेरित मानव ipscs ने होक्स ट्रांसक्रिप्शन कारकों के निम्न स्तर व्यक्त किया और रेटिनोइक एसिड के साथ रोस्ट्रो-कॉडल अक्ष के साथ नमूनों जा सकता है (अनुपूरक आंकड़ा S3 ).

इन परिणामों को प्राप्त किया गया था जब ६२,५०० कोशिकाओं/सेमी2 भेदभाव की शुरुआत में वरीयता दी और 0 दिन में 1 μm doxycycline के साथ प्रेरित किया गया । यह कोशिकाओं के लिए स्पष्ट विषाक्तता के बिना transgenes के अधिकतम प्रेरण प्राप्त करने के लिए doxycycline के इष्टतम एकाग्रता के परिणामस्वरूप (अनुपूरक चित्रा S4A). 5 दिन में doxycycline के हटाने पर, transgenes की अभिव्यक्ति मौन था (अनुपूरक आंकड़ा S4B) । हम भी प्रोटोकॉल के इस बिंदु पर कोशिकाओं का इष्टतम घनत्व स्थापित करने के लिए प्रायोगिक प्रयोगों प्रदर्शन किया है. हमने देखा है कि समानांतर विभेदन प्रयोगों में इस पैरामीटर बदलती अलग परिणाम प्रदान की है । प्रारंभिक घनत्व के साथ ३१,२५० कोशिकाओं को कम/2, भिंनता जाहिरा तौर पर सामांय था, के रूप में कोशिका morphology देख द्वारा मूल्यांकन किया । तथापि, हमने 5 दिन (धारा ३.४) में वियोजन और परवर्ती परिपक्वता चरण में कम व्यवहार्यता का प्रतिरोध देखा । इसके विपरीत, जब कोशिकाओं के प्रारंभिक घनत्व १२५,००० कोशिकाओं के लिए उठाया गया था/2, हम अक्षम भेदभाव मनाया, के रूप में ठेठ ंयूरॉन के अधिग्रहण की कमी से मूल्यांकन-morphology की तरह । इस के परिणामस्वरूप एक मिश्रित आबादी में केवल MNs का एक छोटा सा अंश है, जो और अधिक शुद्धि की आवश्यकता होगी (जैसे, FACS द्वारा). हम इसलिए स्थापित किया है कि इष्टतम घनत्व न्यूरोनल कोशिकाओं की एक शुद्ध जनसंख्या प्राप्त करने के लिए, दो महीने से अधिक के लिए संस्कृति में जीवित रहने में सक्षम है,६२,५०० कोशिकाओं/

हम तो उनके electrophysiological गुणों की विशेषता द्वारा iPSC निल-व्युत्पन्न रीढ़ की हड्डी मोटर ंयूरॉंस के कार्यात्मक परिपक्वता का आकलन (चित्रा 4), के रूप में पहले IPSC चुटकी के लिए रिपोर्ट-कपालीय मोटर ंयूरॉंस12व्युत्पंन । पैच दबाना रिकॉर्डिंग, या तो वोल्टेज और वर्तमान में दबाना modality में, प्रोटोकॉल के MNs परिपक्वता कदम के 7 दिन में प्रदर्शन किया गया था ( 1 चित्रादेखें; भिंनता का कुल समय: 12 दिन) (चित्रा 4) । इस समय बिंदु पर, iPSC शून्य-व्युत्पन्न मोटर न्यूरॉन्स एक थोड़ा कम आराम झिल्ली की क्षमता दिखाया (-30 ± 2 एमवी; एन = 24) और एक समान सेल धारिता मान (+ 25 ± 2 pF; n = 25) पहले रिपोर्ट की तुलना में iPSC चुटकी-एमएनएस प्राप्त12. फिर, विभेदित कोशिकाओं के परिपक्वता की डिग्री की गहराई की विशेषता के लिए, हम उनके सोडियम और पोटेशियम धाराओं पैदा जब वोल्टेज दालों की एक श्रृंखला के साथ उत्तेजित करने की क्षमता की जांच की । इन प्रयोगों में, ipsc शून्य व्युत्पन्न तंत्रिकाओं सफलतापूर्वक प्रदर्शित वोल्टेज पर निर्भर सोडियम धाराओं (चित्रा 4बी), और वोल्टेज पर निर्भर पोटेशियम धाराओं (चित्रा 4सी), शिखर आयाम तक पहुँचने जब एक पर clamped झिल्ली की क्षमता − 20 एमवी और + ५० एमवी के पास क्रमशः । Na के लिए संतुलन क्षमता+ और K+, की गणना nernst समीकरण (www.physiologyweb.com/calculators/nernst_potential_calculator.html) का उपयोग कर पहले रिपोर्ट की गई extracellular और intracellular समाधान के साथ, थे + ११० एमवी और-१०२ एमवी क्रमशः । इसके अलावा, ipsc शूंय-प्राप्त MNs वर्तमान में clamped-दबाना साधन के ८०% से स्पाइक गाड़ियों जब + ६० pA या अधिक की एक वर्तमान पल्स के साथ इंजेक्शन ट्रिगर करने में सक्षम थे (चित्रा 4डी) । दर्ज की गई कोशिकाओं के ५०% से अधिक में दोहराव फायरिंग प्राप्त करने के लिए आवश्यक न्यूनतम वर्तमान + ४० फिलीस्तीनी अथॉरिटी (18 कोशिकाओं में से 15; चित्रा 4 ). स्पाइक थ्रेशोल्ड था-३७.६ ± ०.८ एमवी और औसत फायरिंग आवृत्ति पर + ४० फिलीस्तीनी अथॉरिटी के बारे में ७.९ ± २.२ हर्ट्ज (n = 18; चित्रा 4 F) ।

कुल मिलाकर, इन आंकड़ों का सुझाव है कि, इसी तरह से पहले की रिपोर्ट iPSC चुटकी-प्राप्त कपाल एमएनएस12, IPSC-शून्य-व्युत्पन्न रीढ़ की हड्डी एमएनएस परिपक्व न्यूरॉन्स के ठेठ गुण कार्यात्मक है.

Figure 1
चित्रा 1 : मोटर न्यूरॉन विभेदन प्रोटोकॉल । अंक के एक योजनाबद्ध प्रतिनिधित्व से पता चलता है भेदभाव प्रोटोकॉल, के साथ स्थिर iPSC लाइनों के उत्पादन से piggyBac वैक्टर के समय बिंदु पर कार्यात्मक विश्लेषण के पाठ में रिपोर्ट. प्रतिनिधि कला प्रोटोकॉल के विभिन्न चरणों में कक्षों की कंट्रास्ट छवियां दिखाई जाती हैं । स्केल पट्टियां = ५० μm । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 2
चित्रा 2 : प्रतिनिधि कोशिकाओं के विभेदे के प्रतिरक्षा अभिरंजन विश्लेषण । iPSC-शूंय और iPSC-निप कोशिकाओं का विश्लेषण कर रहे थे immunostaining द्वारा की अभिव्यक्ति के लिए pluripotency मार्कर OCT4 (बैंगनी) और पैन-neuronal मार्कर TUJ1 (लाल) पर दिन 0 (), दिन 3 () और 5 दिन () नाभिक के साथ DAPI पर प्रतिदाग थे । संनाभि छवियों लेजर स्कैनिंग संनाभि माइक्रोस्कोप पर अधिग्रहीत किया गया ( सामग्री की तालिकादेखें) 2x ज़ूम के साथ एक 20x NA ०.७५ उद्देश्य का उपयोग कर, १०२४ एक्स १०२४ पिक्सेल, ४०५ एनएम, ४७३ एनएम, ५५९ एनएम और ६३५ एनएम पराबैंगनीकिरण के साथ सुसज्जित है । DAPI, Alexa Fluor ५९४ और Alexa Fluor ६४७ के लिए फ़िल्टर सेटिंग का इस्तेमाल किया गया । स्केल पट्टियां = ५० μm । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 3
चित्रा 3 : IPSC-व्युत्पंन मोटर ंयूरॉंस के प्रतिनिधि immunostaining विश्लेषण । iPSC-शूंय और iPSC-चुटकी कोशिकाओं को immunostaining द्वारा विश्लेषण किया गया पैन-neuronal मार्कर TUJ1 की अभिव्यक्ति के लिए (लाल) और मोटर ंयूरॉन मार्कर चैट (choline acetyltransferase; हरा) 12 दिन में । नाभिक के साथ DAPI पर प्रतिदाग थे । Confocal छवियां आकृति 2 लेजेंड में वर्णित के रूप में अधिग्रहीत की गई थीं । स्केल पट्टियां = ५० μm । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 4
चित्रा 4 : रीढ़ की हड्डी और कपालीय मोटर ंयूरॉंस के कार्यात्मक विश्लेषण । () आईपीएससी निल-व्युत्पन्न स्पाइनल मोटर न्यूरॉन पर संपूर्ण-कोशिका पैच क्लैंप की चमकीली क्षेत्र छवि । () बढ़ती वोल्टेज कदमों की एक श्रृंखला के प्रत्युत्तर में एनए+ वर्तमान के लिए प्रतिनिधि-I/वी-कर्व (n = 26; क्षमता के बराबर-६० एमवी) () बढ़ती वोल्टेज कदम की एक श्रृंखला के प्रत्युत्तर में आईपीएससी शून्य-व्युत्पन्न एमएनएस में दर्ज किए गए K+ के लिए प्रतिनिधि आई/वी कर्व (एन = 23; ४० एमवी के बराबर क्षमता होल्डिंग) । () + ६० फिलीस्तीनी अथॉरिटी के 1 एस स्थायी वर्तमान इंजेक्शन के जवाब में कार्रवाई की क्षमता की एक गाड़ी की प्रतिनिधि ट्रेस । () हिस्टोग्राम आईएससी शून्य-व्युत्पन्न एमएनएस के प्रतिशत का प्रतिनिधित्व करते हुए प्रत्येक वर्तमान पल्स (n = 18) पर कार्रवाई की क्षमता प्राप्त करता है । (च) प्रत्येक धारा स्पंद (द = 18) पर की गई ज्वालन आवृत्ति प्रदर्शित करते हुए हिस्टोग्राम । इलेक्ट्रोफिजियोलॉजिकल रिकॉर्डिंग एक ईमानदार माइक्रोस्कोप के तहत किया गया था । झिल्ली धाराओं रिकॉर्डिंग प्रणाली सामग्री की तालिका में संकेत दिया है । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Supplementary Figure 1
पूरक चित्र S1: MN का विभेदन एपिसोमल hiPSCs का उपयोग कर । () निदष्ट समय बिंदुओं पर अंतर-सूत्री HIPSC-शून्य (लेफ्ट) और एपिसोमल hipsc-एनआईपी (दाएं) स्केल पट्टियां = ५० μm । () एपिसोमल एचपीएससी-शून्य (टीओपी) और एपिसोमल एचपीएससी-एनआईपी (बॉटम) प्रकोष्ठों में अंतर करने वाले निदष्ट मार्करों की अभिव्यक्ति का वास्तविक समय क्यूआरटी-पीसीआर द्वारा विश्लेषण । प्रत्येक मार्कर के लिए, उच्चतम अभिव्यक्ति के साथ समय बिंदु अंशशोधन नमूना के रूप में इस्तेमाल किया गया है. ISL1 के लिए इस्तेमाल किया primers अंतर्जात जीन के लिए विशिष्ट हैं. () विशिष्ट (दिन-6) एपिसोमल एचपीएससी-शून्य (लेफ्ट) और एपिसोमल एचपीएससी-एनआईपी (दाएं) कोशिकाओं में पैन-न्यूरोनल मार्कर TUJ1 (लाल) और कपाल मिलियन मार्कर PHOX2B (ग्रीन) के लिए प्रतिप्रतिरक्षण । केंद्रक का दापी से प्रतिदाग होता है । सभी पैनलों के लिए स्केल बार: ५० μm । () एपीसोमीय एचपीएससी-शून्य (शीर्ष) और एपिसोमल एचपीएससी-एनआईपी (बॉटम) प्रकोष्ठों में अंतर करने में HB9 और PHOX2B की अभिव्यक्ति का विश्लेषण वास्तविक समय क्यूआरटी-पीसीआर द्वारा किया जाता है । 0 दिन अंशदाता नमूना के रूप में इस्तेमाल किया गया है । डी सैंटिस एट अल, २०१८12में पीसीआर प्राइमर्स और तरीके बताए गए हैं । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Supplementary Figure 2
अनुपूरक आंकड़ा S2: MN DS2U ipscs का उपयोग कर भेदभाव । () दर्शाए गए समय बिंदुओं पर DS2U-शून्य (बाएं) और DS2U-एनआईपी में अंतर करने वाली ब्राइटफील्ड छवियां । स्केल पट्टियां = ५० μm । () वास्तविक समय क्यूआरटी-पीसीआर द्वारा DS2U-शून्य (शीर्ष) और DS2U-एनआईपी (बॉटम) प्रकोष्ठों में अंतर करने में निदष्ट मार्करों की अभिव्यक्ति का विश्लेषण । प्रत्येक मार्कर के लिए उच्चतम अभिव्यक्ति के साथ समय बिंदु अंशशोधन नमूना के रूप में इस्तेमाल किया गया है । ISL1 के लिए इस्तेमाल किया primers अंतर्जात जीन के लिए विशिष्ट हैं. () पैन-न्यूरोनल मार्कर TUJ1 (लाल) और कपाल मिलियन मार्कर PHOX2B (ग्रीन) विभेदक (डे-6) DS2U-शून्य (लेफ्ट) और DS2U-एनआईपी (दाएं) कोशिकाओं के लिए प्रतिरक्षा । केंद्रक का दापी से प्रतिदाग होता है । स्केल पट्टियां = ५० μm । () DS2U-शून्य (शीर्ष) और DS2U-एनआईपी (बॉटम) प्रकोष्ठों में अंतर करने में HB9 और PHOX2B की अभिव्यक्ति का वास्तविक समय क्यूआरटी-पीसीआर द्वारा विश्लेषण । 0 दिन अंशदाता नमूना के रूप में इस्तेमाल किया गया है । डी सैंटिस एट अल, २०१८12में पीसीआर प्राइमर्स और तरीके बताए गए हैं । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Supplementary Figure 3
अनुपूरक आंकड़ा S3: HOX जीन अभिव्यक्ति । () वास्तविक समय क्यूआरटी-पीसीआर द्वारा आईपीएससी-शून्य और आईपीएससी-शून्य + आरए प्रकोष्ठों के विभेदन के 5 दिनों के बाद चार भिन्न होक्स जीनों (होक्स ए2, होक्स B1, Hox A4, होक्स B5) की अभिव्यक्ति का विश्लेषण । 0 दिन में IPSC-शूंय अंशदाता नमूने के रूप में इस्तेमाल किया गया है । () वास्तविक समय क्यूआरटी-पीसीआर द्वारा आईपीएससी-एनआईपी और आईपीएससी-एनआईपी + आरए कोशिकाओं के विभेदन के 5 दिनों के बाद चार विभिन्न होक्स जीन (होक्स ए2, होक्स बी 1, होक्स A4, होक्स B5) की अभिव्यक्ति का विश्लेषण । 0 दिन में IPSC-चुटकी अंशशोधन नमूना के रूप में इस्तेमाल किया गया है । () पीसीआर प्राइमर जोड़े । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Supplementary Figure 4
अनुपूरक चित्रा S4: Doxycycline प्रेरण विश्लेषण । () आईपीएससी-निल (टीओपी) और आईपीएससी-एनआईपी (बॉटम) में बाह्य Ngn2 की अभिव्यक्ति की वास्तविक समय क्यूआरटी-पीसीआर द्वारा विश्लेषण विभिन्न सांद्रता (०.५ μm, १.० μm, २.० μm) पर डॉक्सीसाइलिन की उपस्थिति में 24 घंटे के लिए अनुपचारित या सुसंस्कृत कोशिका । Ngn2 बहिर्जात माउस जीन के लिए विशिष्ट प्राइमरों के साथ विश्लेषण किया गया था । माता पिता iPSC रेखा, शूंय और चुटकी constructs से रहित, विश्लेषण में एक नियंत्रण के रूप में शामिल किया गया है । आईपीएससी-शून्य और आईपीएससी-एनआईपी में ट्रांसजीन की अभिव्यक्ति डॉक्क्साइक्लीन की अनुपस्थिति में उपेक्षा की गई थी । 0 दिन में iPSC-शूंय और iPSC-चुटकी अंशशोधन नमूने के रूप में इस्तेमाल किया गया है । () प्रोटोकाल के निदष्ट समय बिंदुओं पर आईपीएससी-शून्य (लेफ्ट) और आईपीएससी-एनआईपी (दाएं) प्रकोष्ठों में अंतर करने में बहिर्जात Ngn2 की अभिव्यक्ति की रीयल टाइम क्यूआरटी-पीसीआर द्वारा विश्लेषण । Ngn2 बहिर्जात माउस जीन के लिए विशिष्ट प्राइमरों के साथ विश्लेषण किया गया था । 0 दिन में iPSC-शूंय और iPSC-चुटकी अंशशोधन नमूने के रूप में इस्तेमाल किया गया है । डी सैंटिस एट अल, २०१८12में पीसीआर प्राइमर्स और तरीके बताए गए हैं । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस प्रोटोकॉल को कुशलता से रीढ़ की हड्डी और कपाल मोटर ंयूरॉंस धंयवाद में मानव ipscs वंश-विशिष्ट ट्रांसक्रिप्शन कारकों की अस्थानिक अभिव्यक्ति को बदलने की अनुमति देता है । इन transgenes doxycycline और stably एक piggyBac पक्षासन आधारित वेक्टर को जीनोम धंयवाद में एकीकृत द्वारा inducible हैं । एक मिश्रित आबादी में, piggyBac वेक्टर की एक या कई प्रतियां बेतरतीब ढंग से व्यक्तिगत कोशिकाओं के जीनोम में एकीकृत किया जाएगा, जीनोम अखंडता परिवर्तन के जोखिम में वृद्धि । इसके अलावा, iPSC सबक्लोनों का एक प्रगतिशील चयन समय के साथ हो सकता है, भेदभाव के लिए संभावित परिणामों के साथ और रोग और नियंत्रण सेल लाइनों के तुलनात्मक विश्लेषण के लिए. कुल मिलाकर, इस प्रोटोकॉल के साथ प्राप्त iPSC-प्राप्त MNs पुनर्योजी चिकित्सा के लिए अनुपयुक्त हो जाएगा. हालांकि, हमारे विधि इन विट्रो मोटर न्यूरॉन रोग मॉडलिंग के लिए विशेष रूप से उपयोगी हो सकता है. शक्ति के प्रमुख बिंदुओं को बेहद सरलीकृत संस्कृति की स्थिति, MN रूपांतरण की तीव्रता, iPSC-प्राप्त MNs की परिपक्वता की उच्च डिग्री और दोनों रीढ़ की हड्डी और कपाल MNs प्राप्त करने की संभावना के द्वारा प्रतिनिधित्व कर रहे हैं, के रूप में पहले से प्रदर्शन विशिष्ट मार्कर जीन अभिव्यक्ति का विश्लेषण12. प्रोटोकॉल की मजबूती का प्रदर्शन उसकी पुनरुद्दायता से होता है । अब तक, हमने इस प्रोटोकॉल को सफलतापूर्वक लागू किया है 30 बार से अधिक रीढ़ की हड्डी और/या कपाल MN पीढ़ी के लिए, मार्कर और/या कार्यात्मक विश्लेषण द्वारा परिणामों का आकलन । हम सफलतापूर्वक व्यवहार्यता की स्पष्ट कमी के बिना दो महीने के लिए मोटर न्यूरॉन संस्कृतियों को बनाए रखा है । इसके अलावा, एक बार stably transduced iPSC लाइन प्राप्त किया गया है, प्रत्येक प्रयोग नए transduced की आवश्यकता के बिना doxycycline प्रेरण द्वारा शुरू किया जा सकता है । वायरल वैक्टर की भी आवश्यकता नहीं है । यहां प्रस्तुत प्रतिनिधि परिणाम सामग्री तालिकामें दर्शाए गए सेल इलेक्ट्रोपोलेशन सिस्टम के साथ इलेक्ट्रोपोर्टिंग ipscs द्वारा प्राप्त किए गए हैं । हालांकि, अन्य इलेक्ट्रोपोलेशन विधियाँ वैकल्पिक विकल्प का प्रतिनिधित्व हो सकता है । इसके विपरीत, हमारे अनुभव में, lipofection पर आधारित अभिकर्मक सिस्टम pluripotent स्टेम सेल के लिए एक अच्छा विकल्प नहीं है12। सेल प्रक्रिया के अंत में प्राप्त आबादी MNs के लगभग विशेष रूप से बना रहे हैं, आगे शुद्धि के लिए आवश्यकता से परहेज (जैसे, FACS द्वारा). जैसा कि हम पहले12दिखाया, प्रोटोकॉल ९०% TUJ1-सकारात्मक कोशिकाओं को प्राप्त करने की अनुमति देता है, जिनमें से ९५% जहां भी चुटकी में सकारात्मक PHOX2B-संस्कृतियों व्युत्पंन ।

हम कुछ महत्वपूर्ण बिंदुओं की परिकल्पना कर सकते हैं जिन पर सही ढंग से विचार किया जाना चाहिए । पहला, आईपीएससी की आरंभिक आबादी की गुणवत्ता एमएनएस में सजातीय और सुसंगत रूपांतरण सुनिश्चित करने के लिए महत्वपूर्ण है । भिंनता का एक बड़ा अंश युक्त संस्कृतियों (अधिक से अधिक 5-10%) से बचना चाहिए । हमने मानव iPSC माध्यम का उपयोग करते हुए प्रोटोकॉल स्थापित किया है जो कि सामग्री तालिका में अविभेदित Ipsc के रखरखाव माध्यम के रूप में वर्णित है । व्यावसायिक रूप से उपलब्ध अंय निर्धारित मीडिया मांय वैकल्पिक विकल्पों का प्रतिनिधित्व कर सकता है, बावजूद इसके हमने प्रयोगात्मक रूप से वर्तमान कार्य में इस बिन्दु को संबोधित नहीं किया है । चूंकि मीडिया संरचना शुरू सेल जनसंख्या के प्रसार दर को प्रभावित कर सकता है, अंय रखरखाव मीडिया के लिए प्रोटोकॉल के अनुकूलन 0 दिन में प्रारंभिक घनत्व के अनुकूलन की आवश्यकता हो सकती है । Transfection के बाद, यह करने के लिए एंटीबायोटिक चयन के तहत कोशिकाओं को रखने के लिए महत्वपूर्ण है 2 सप्ताह के लिए स्थिर सेल लाइनों प्राप्त. यह कुछ अनुप्रयोगों के लिए उपयुक्त हो सकता है piggybac एकीकरण के बाद क्लोनी लाइनों को प्राप्त करने के क्रम में ट्रांसजीन अभिव्यक्ति के स्तर और एकीकरण साइटों की एक बेहतर नियंत्रण के संदर्भ में एक अधिक सजातीय आबादी हासिल करने के लिए । 0 दिन में कोशिकाओं का घनत्व, माध्यम के लिए doxycycline अलावा के समय, एक महत्वपूर्ण पैरामीटर है । के रूप में प्रतिनिधि परिणाम अनुभाग में उल्लेख किया है, हम एक इष्टतम सेल घनत्व के लिए reproducibility सुनिश्चित करने का अनुमान है । हम बाहर नहीं कर सकते है कि अंय pluripotent स्टेम सेल लाइनों अलग प्रारंभिक घनत्व है, जो प्रायोगिक प्रयोगों में, के रूप में दोहराव दर महत्वपूर्ण व्यक्तिगत लाइनों के बीच काफी भिंन हो सकता है अनुभववान होना चाहिए की आवश्यकता हो सकती है । Neurobasal करने के लिए मध्यम स्विच/B27 के बाद होना चाहिए ४८ h के बाद से doxycycline प्रेरण (धारा ३.३): विभेदन धीमी और कम कुशल परिणाम हो सकता है अगर कोशिकाओं DMEM में 2 पूरे दिनों के लिए आयोजित नहीं कर रहे है/ 5 दिन में वियोजन कोशिकाओं फर्क पर जोर दिया बिना किया जाना चाहिए । सेल वियोजन अभिकर्मक के साथ ऊष्मायन के समय (कदम ३.४) बैच से बैच के लिए अलग हो सकता है और सावधानी से प्रायोगिक प्रयोगों में अनुमान लगाया जाना चाहिए । सेल वियोजन अभिकर्मक के साथ ऊष्मायन पर, पूरे सेल monolayer थाली से detaches । फिर, यह सावधानी से अलग करना चाहिए pipetting द्वारा, के रूप में वर्णित अनुभाग में ३.४, सेल अखंडता को संरक्षित करने के लिए और यांत्रिक तनाव से बचने के लिए, जो D5 से परे कोशिका संस्कृति के रखरखाव पर एक नकारात्मक प्रभाव हो सकता है । अंत में, हमने देखा है कि बाद पुन: चढ़ाना MNs कांच की तुलना में ऊतक संस्कृति प्लास्टिक पर बेहतर पालन । बहुलक coverslips इष्टतम सेल पालन सुनिश्चित करने और उपयुक्त ऑप्टिकल गुण microscopy आधारित अनुप्रयोगों के लिए एक अच्छा विकल्प हैं ।

हमारी विधि एक mn भाग्य में pluripotent कोशिकाओं के एक प्रत्यक्ष "प्रोग्रामिंग" का प्रतिनिधित्व करता है, और मध्यवर्ती कदम है जो के माध्यम से भ्रूणीय कोशिकाओं के दौरान एक mn पहचान प्राप्त vivo के विकास में, इस तरह के प्रारंभिक विनिर्देश के रूप में संक्षेप तंत्रिका बहिर्जनस्तर और डोर्सो-अधर और रोस्ट्रो-पुच्छीय अक्ष के साथ patterning । इसलिए, उदाहरण के लिए अध्ययन करने के लिए विट्रो में मानव MN विनिर्देशन मॉडल के लिए उपयुक्त नहीं होगा, यह अंतर अंतर्निहित आण्विक तंत्र । दूसरी ओर, हमारे प्रोटोकॉल को और अधिक शुद्धि की आवश्यकता के बिना रीढ़ की हड्डी या कपाल MNs के एक काफी मात्रा में उत्पादन की अनुमति देता है । यह भी ध्यान में रखते हुए प्राप्त परिपक्वता की डिग्री, यह मोटर न्यूरॉन के न्यूरोडीजेनेरेटिव रोगों के आणविक आधार का अध्ययन करने के लिए एक उपयोगी उपकरण का प्रतिनिधित्व करता है. मोटर न्यूरॉन रोग से संबंधित जीन में रोगजनक म्यूटेशन के साथ iPSC लाइनों की एक सुसंगत संख्या पिछले वर्षों में वैज्ञानिक समुदाय द्वारा उत्पादित किया गया है. MN "प्रोग्राम" iPSC लाइनों के संग्रह इसलिए आसानी से उन उत्परिवर्ती iPSC लाइनों में शूंय और चुटकी मॉड्यूल के स्थिर एकीकरण द्वारा उत्पंन किया जा सकता है । हम यह परिकल्पना कर सकते हैं, विधि के भावी अनुप्रयोग के रूप में, कोशिका-स्वायत्त निर्धारकों के लक्षण वर्णन, जो अलग-अलग MN के उपप्रकारों को विभिन्न संवेदनशीलता प्रदान करते हैं एक ही आनुवंशिक पृष्ठभूमि । इसके अलावा, सरलीकृत संस्कृति की स्थिति है कि ंयूनतम हेरफेर की जरूरत है (यानी, embryoid निकायों के माध्यम से संक्रमण के बिना) में iPSCs के प्रभावी रूपांतरण और है कि आसानी से स्केन हो सकता है, बहुत स्वचालित उच्च throughput दवा की सुविधा हो सकती है मोटर न्यूरॉन रोगों के लिए स्क्रीनिंग दृष्टिकोण. IPSC-व्युत्पन्न न्यूरॉन्स के भ्रूण की तरह प्रकृति की वजह से वयस्क शुरुआत neurodegenerative रोगों की इन विट्रो मॉडलिंग चुनौतीपूर्ण हो सकताहै. इस तरह progerin ओवरएक्सप्रेशन15के रूप में ipscs के पारंपरिक भेदभाव से व्युत्पंन एमएनएस की उंर बढ़ने में तेजी लाने के लिए तैयार पिछली रणनीतियों, बेहतर रोग मॉडल प्राप्त करने के लिए हमारी विधि के साथ जोड़ा जा सकता है ।

विधि यहां वर्णित, प्रतिलेखन कारकों की एक piggybac वेक्टर द्वारा मध्यस्थता कारक के inducible अभिव्यक्ति के आधार पर, अंय प्रेरित सेल प्रकार के लिए लागू किया जा सकता है । हम पहले से पता चला है कि कंकाल की मांसपेशी कोशिकाओं BAF60c और Myod16की अभिव्यक्ति द्वारा मानव ipscs से प्राप्त किया जा सकता है । इसी तरह, हम संभावना कल्पना कर सकते है अन्य न्यूरोनल उपप्रकार और astrocytes सहित अन्य कोशिका प्रकार के ब्याज के लिए विधि का विस्तार करने के लिए, piggybac द्वारा उचित सेट की मध्यस्थता अभिव्यक्ति के कारक17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों को प्रकट करने के लिए कुछ भी नहीं है

Acknowledgments

लेखकों के जीवन नैनो विज्ञान के लिए केंद्र में इमेजिंग सुविधा का शुक्रिया अदा करना चाहते हैं, Isरवैए को Italiano di Tecnologia, समर्थन और तकनीकी सलाह के लिए । हम उपयोगी चर्चा के लिए जीवन नैनो विज्ञान के लिए केंद्र के सदस्यों के लिए आभारी हैं । यह कार्य आंशिक रूप से एक अनुदान द्वारा AriSLA (पायलट अनुदान २०१६ "StressFUS") AR करने के लिए समर्थित किया गया था ।

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics