Conversión de células madre pluripotentes inducidas por humanos (IPSC) en neuronas motoras craneales y espinales funcionales usando vectores PiggyBac

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este protocolo permite la conversión rápida y eficiente de células madre pluripotentes inducidas en neuronas motoras con una identidad espinal o craneal, mediante la expresión ectópica de factores de transcripción de vectores piggyBac inducibles.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Describimos aquí un método para obtener neuronas motoras craneales y espinales funcionales a partir de células madre pluripotentes inducidas por humanos (IPSC). La conversión directa en neurona motora se obtiene mediante la expresión ectópica de módulos alternativos de factores de transcripción, a saber, Ngn2, Isl1 y Lhx3 (NIL) o Ngn2, Isl1 y Phox2a (NIP). NIL y NIP especifican, respectivamente, la identidad de la neurona motora espinal y craneal. Nuestro protocolo comienza con la generación de líneas IPSC modificadas en las que Nil o NIP están integrados de forma estable en el genoma a través de un vector transposón piggybac. La expresión de los transgenes es inducida entonces por doxiciclina y lleva, en 5 días, a la conversión de los IPSC en progenitores MN. La posterior maduración, durante 7 días, conduce a poblaciones homogéneas de los MNs espinales o craneales. Nuestro método tiene varias ventajas sobre los protocolos anteriores: es extremadamente rápido y simplificado; no requiere infección viral o más aislamiento MN; permite generar diferentes subpoblaciones de MN (espinales y craneales) con un notable grado de maduración, como lo demuestra la capacidad de disparar trenes de potenciales de acción. Además, se puede obtener un gran número de neuronas motoras sin purificación de poblaciones mixtas. las neuronas motoras espinales y craneales derivadas de iPSC se pueden utilizar para el modelado in vitro de la esclerosis lateral amiotrófica y otras enfermedades neurodegenerativas de la neurona motora. Las poblaciones de neuronas motoras homogéneas pueden representar un recurso importante para la detección de fármacos específicos del tipo celular.

Introduction

La degeneración de la neurona motora (MN) desempeña un papel causal en las enfermedades humanas como la esclerosis lateral amiotrófica (ELA) y la atrofia muscular espinal (SMA). El establecimiento de sistemas de modelos celulares in vitro adecuados que recapitulan la complejidad del MN humano es un paso importante hacia el desarrollo de nuevos enfoques terapéuticos. Las células madre pluripotentes inducidas (iPSCs), que están dotadas de notables propiedades de diferenciación plurilinaje, se han derivado ahora de un número de pacientes afectados por las enfermedades de las neuronas motoras1,2. Las líneas adicionales de iPSC que transportan mutaciones patógenas asociadas a las enfermedades de MN han sido generadas por la edición génica, comenzando por el control "saludable" de las células madre pluripotentes3. Estas líneas representan herramientas útiles para el modelado de enfermedades in vitro y la detección de fármacos, siempre que estén disponibles los métodos apropiados para la diferenciación de iPSC en MNs. La razón detrás del desarrollo de este método es proporcionar a la comunidad científica interesada en las enfermedades del MN con un protocolo de diferenciación rápido y eficiente que da lugar a los MNs funcionales maduros. La primera ventaja de este método es su plazo de ejecución. Otro punto de fuerza relevante proviene de la eliminación de cualquier paso de purificación. Finalmente, el protocolo se puede utilizar para generar dos poblaciones distintas de neuronas motoras.

La posibilidad de generar diferentes subtipos de MNs es particularmente relevante para el modelado de enfermedades de manganeso. No todos los subtipos de MN son igualmente vulnerables en ELA y SMA y la aparición de síntomas en diferentes unidades de motor influye en gran medida en el pronóstico. En la ELA, el inicio de la columna vertebral con síntomas que comienzan en las extremidades superiores e inferiores conduce a la muerte en aproximadamente 3-5 años4. Por el contrario, el inicio bulbar, comenzando con la degeneración del MNs craneal, tiene un peor pronóstico. Por otra parte, el porcentaje de inicio bulbar es significativamente mayor en pacientes con mutaciones en las proteínas de unión al ARN FUS y TDP-43 que en individuos con mutaciones de SOD15. Casi la totalidad de los protocolos alternativos de diferenciación MN se basa en la actividad del ácido retinoico (RA), que confiere un carácter espinal a diferenciar iPSCs6,7,8. Esto limita la posibilidad de estudiar los factores intrínsecos, que podrían ser protectores en los subtipos específicos de MN9,10.

Consistente con un trabajo anterior en las células madre embrionarias de ratón11, hemos demostrado recientemente que en la expresión ectópico de iPSCs humanos de Ngn2, Isl1 y LHX3 (Nil) induce una identidad de MN espinal, mientras que Ngn2 y Isl1 más PHOX2A (NIP) especifican el mns craneal12. Por lo tanto, hemos desarrollado un protocolo eficiente, que conduce a la producción de MNs humanos dotados de propiedades funcionales en un plazo de 12 días. El propósito de este método es obtener, en un corto período de tiempo y sin la necesidad de purificación (por ejemplo, por FACS), poblaciones celulares altamente enriquecidas para MNs con identidad espinal o craneal.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. mantenimiento de las IPSC humanas

  1. Preparación de placas recubiertas de matriz
    1. Descongelar un vial de 5 mL de matriz (ver tabla de materiales) a 4 ° c durante la noche. Las existencias de matrices originales vienen en diferentes concentraciones de existencias y las alícuas se realizan de acuerdo con el factor de dilución indicado en la hoja de datos, específico para el lote individual. Es importante mantener el vial y los tubos fríos para evitar el gelificante prematuro de la matriz. Dosificar la matriz en alícuas en criotubos prerefrigerados sobre hielo. Congele las alícuas no utilizadas a-20 ° c.
    2. Coloque una alícuota sobre hielo durante aproximadamente 2 h para descongelar.
    3. Diluir la alícuota de la matriz con 20 mL de DMEM/F12 fría en un tubo cónico de 50 mL.
    4. Mezclar bien y dosificar 1 mL de matriz diluida en platos de 35 mm (cantidades equivalentes por área superficial de otros platos).
    5. Mantenga los platos que contienen la matriz diluida durante 1 h a temperatura ambiente para permitir el recubrimiento.
      Nota: Los platos, sellados con parafilm, se pueden almacenar a 4 ° c durante un máximo de 2 semanas.
  2. Preparación de la solución de acción (20 ml) y 1x alícullitas de trabajo del reactivo de disociación de células suaves (ver tabla de materiales).
    1. Disolver el polvo a 10 mg/mL en PBS (CA2 +/mg2 + gratis).
    2. Filtro esterilizar a través de una membrana filtrante de 0,22 μm.
    3. Preparar 20 alícuts (1 mL cada uno) y almacenar a-20 ° c.
    4. Antes de su uso, diluir una alícuota en PBS (CA2 +/mg2 + libre) a 1 mg/ml (1x de trabajo alícuotas).
      Nota: 1x alícuotas de trabajo se pueden almacenar a 4 ° c durante hasta 2 semanas.
  3. Passaging IPSC humanos.
    1. Antes de comenzar: si se almacena a 4 ° c, las placas recubiertas previamente calientes en la incubadora a 37 ° c durante 20-30 min. precalentarse a temperatura ambiente la cantidad de medio de iPSC humano (ver tabla de materiales) necesaria. Precalente el DMEM/F12.
    2. Aspirado medio de cultivo.
    3. Enjuague los IPSC con PBS (CA2 +/mg2 + gratis).
    4. Añadir 1x solución de disociación suave (0,5 mL para un plato de 35 mm). Incubar a 37 ° c hasta que los bordes de las colonias comiencen a desprenderse de la placa, por lo general 3-5 min.
    5. Aspirar la solución de disociación suave, teniendo cuidado de no separar las colonias de iPSC.
    6. Lavar las células con DMEM/F12 (2 mL para un plato de 35 mm) y aspirar a no separar las células. Repite este paso una vez más.
    7. Añadir medio humano iPSC (1 mL para una antena de 35 mm).
    8. Separe suavemente las colonias con un levantador de células y transfiera a un tubo de 15 mL.
    9. Rompa con cuidado los grumos de la célula pipeteando hacia arriba y hacia abajo con un P1000 pipeteador 3-4 veces.
    10. Aspirar el sobrenadante de la placa (s) recubierta por matriz.
    11. Sembrar las células en el volumen de cultivo apropiado del medio de la iPSC humana. La relación de división puede variar de línea a línea y es de aproximadamente 1:4-1:8. Cambia el medio diariamente.

2. la generación de líneas iPSC inducibles NIL y NIP

  1. Transfección celular.
    1. Enjuague las células con PBS (CA2 +/mg2 + libre).
    2. Añadir reactivo de disociación celular (ver tabla de materiales) (0,35 ml para un plato de 35 mm) e incubar a 37 ° c hasta que las células individuales estén separadas (5-10 min).
    3. Separación de células cuidadosamente completa mediante pipeteo hacia arriba y hacia abajo con un P1000 pipeteador 3-4 veces.
    4. Recoger en un tubo de 15 mL y añadir PBS (CA2 +/mg2 + gratis) a 10 ml. Cuente las celdas.
    5. Pellet 106 células y resuspendio en 100 μl de buffer R (incluido en el kit de electroporación celular, ver tabla de materiales).
    6. Añadir ADN plásmido para la transfección: 4,5 μg de vector transponibles (EPB-BSD-TT-Nil o EPB-BSD-TT-NIP12) y 0,5 μg del plásmido transposasa de piggybac13.
    7. Transfect con el sistema de electroporación celular (ver tabla de materiales) según las instrucciones del fabricante y como se describió anteriormente3 con los siguientes parámetros: 1.200 V de voltaje, 30 ms de ancho, 1 pulso. Siembra las células en un medio humano iPSC complementado con 10 μM Y-27632 (inhibidor de la roca, ver tabla de materiales) en un plato recubierto con matriz de 6 mm.
  2. Selección con antibióticos.
    1. Dos días después de la transfección, añadir 5 μg/mL de blasticidina al medio de cultivo.
    2. La mayoría de las células no transfectadas morirán a las 48 h de la selección de blasticidina. Mantenga las células en blastidina durante al menos 7-10 días para contrarrestar la selección de las células que no han integrado los transgenes en el genoma.
    3. Mantener las células transfectadas de forma estable como una población mixta, compuesta de células con diferentes números de transgenes y diferentes sitios de integración, o aislar clones individuales.
    4. Prepare un plato adicional para comprobar la expresión efectiva de los transgenes, tras 1 μg/mL de inducción de doxiciclina, por RT-PCR con imprimadores específicos de transgénicos para Ngn2 (forward: TATGCACCTCACCTCCCCATAG; Reverso: GAAGGGAGGAGGGCTCGACT), como se describió anteriormente12.
    5. En esta etapa, congelar las existencias de las nuevas líneas NIL-y NIP-iPSC en el medio de congelación para los iPSCs humanos (ver tabla de materiales).

3. diferenciación de la neurona motora

  1. Disocie las células con el reactivo de disociación celular tal como se describe (pasos 2.1.1.-2.1.3.). Recoger las células disociadas en un tubo de 15 mL y diluir con 5 volúmenes de DMEM/F12. Pellet de las células y resuspendio en el medio humano iPSC complementado con inhibidor de la roca de 10 μM. Cuente las células y las semillas en los platos recubiertos con matriz a una densidad de 62.500 células/cm2.
  2. El día después, reemplace el medio con DMEM/F12, complementado con 1x análogo de L-glutamina estable, 1x suplemento de cultivo celular de aminoácido no esencial (NEAA) y 0.5 x penicilina/estreptomicina, y conteniendo 1 μg/mL de doxiciclina. Esto se considera como día 0 de diferenciación. En el día 1, refresque el medio y la doxiciclina.
  3. En el día 2, cambie el medio a medio Neurobasal/B27 (medio Neurobasal complementado con 1x B27, 1x análogo de L-glutamina estable, 1x NEAA y 0,5 x penicilina/estreptomicina), conteniendo 5 μM de DAPT, 4 μM SU5402 y 1 μg/mL de doxiciclina (ver tabla de materiales ). Refresca el medio y la doxiciclina todos los días hasta el día 5.
  4. Día 5: disociación de células con reactivo de disociación celular (ver tabla de materiales).
    1. Enjuague las células con PBS (CA2 +/mg2 + libre).
    2. Añadir el reactivo de disociación celular (0,35 mL para un plato de 35 mm) e incubar a 37 ° c hasta que toda la monocapa de la célula se separe del plato. Tenga en cuenta que las celdas individuales no se separarán durante la incubación.
    3. Añadir 1 mL de DMEM/F12 y recoger las células en un tubo de 15 mL.
    4. Separación de células cuidadosamente completa mediante pipeteo hacia arriba y hacia abajo con un P1000 pipeteador 10-15 veces.
    5. Añada 4 mL de DMEM/F12 y cuente las células.
    6. En esta etapa, se congelan los progenitores de la neurona motora en el medio de congelación celular (ver tabla de materiales), según las instrucciones del fabricante.
    7. Pellet de las células y resuspendio en medio neuronal (Neurobasal/B27 medio complementado con 20 ng/mL BDNF, 10 ng/mL GDNF y 200 ng/mL ácido L-ascórbico, ver tabla de materials) complementado con inhibidor de roca de 10 μm.
    8. Siembra las células en poli-ornitina/laminado-o alternativamente en soportes recubiertos con matriz a la densidad de 100.000 células/cm2. Utilice soportes plásticos μ-Slide con recubrimiento de polímero (ver tabla de materiales) para el análisis de inmunostaining.
  5. En el día 6, cambiar el medio con medio neuronal fresca desprovista de inhibidor de la roca. En los próximos días, refresque la mitad del medio cada 3 días. El medio de cultivo debe cambiarse muy cuidadosamente para evitar el desprendimiento de la superficie.

4. Análisis de inmunostaining

  1. Fijación celular. Enjuagar las células con PBS (con CA2 +/mg2 +) e incubar durante 15 min en un 4% de PARAFORMALDEHÍDO en PBS (con CA2 +/mg2 +) a temperatura ambiente.
    PRECAUCIÓN: El paraformaldehído es tóxico y se sospecha que causa cáncer. Evite el contacto con la piel y los ojos y manipule bajo una campana de emanaciones químicas.
  2. Permeabilize con PBS (con CA2 +/mg2 +) que contiene 0,1% Triton X-100 durante 5 min a temperatura ambiente.
  3. Incubar durante 30 min a temperatura ambiente en solución de bloqueo de anticuerpos (ABS: 3% BSA en PBS con CA2 +/mg2 +).
  4. Incubar durante 1 h a temperatura ambiente con anticuerpos primarios en ABS: anti-TUJ1 (1:1000; conejo) y anti-Oct4 (1:200; ratón) o anti-CHAT (anti-colina acetiltransferasa; 1:150; cabra). Ver tabla de materiales.
  5. Incubar por 45 min a temperatura ambiente con el par de anticuerpo secundario de burro apropiado en ABS: Alexa Fluor 647 (1:250), anti-conejo Alexa Fluor 594 (1:250) y anti-Goat Alexa Fluor 488 (1:250). Ver tabla de materiales.
  6. Incubar en 0,4 μg/mL DAPI durante 5 min a temperatura ambiente para etiquetar núcleos.
  7. Monte las células con medio de montaje (ver tabla de materiales) para la toma de imágenes en un microscopio de fluorescencia.

5. Caracterización funcional mediante parches-abrazaderas de grabación

  1. Prepare la solución externa (NES) con equilibrio HEPES como sigue: 140 mM NaCl, 2,8 mM KCl, 2 mM CaCl 2, 2 mm MgCl2, 10 mm HEPES y 10 mm de glucosa. Establezca la osmolaridad entre 290-300 mΩ. Ajuste el pH a 7,3 utilizando 1N NaOH y almacene la solución a 4 ° c.
  2. Preparar la solución interna: 140 mM K-gluconato, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mm HEPES, 2 mm mg-ATP, 0,3 mm na-GTP. Ajuste el pH a 7,3 con 1M de KOH y compruebe que la osmolaridad está configurada en alrededor de 290 mΩ. Congelar la solución a-20 ° c en pequeñas alícullias.
  3. Antes de ejecutar los experimentos, precalentar la solución de NES en un baño de agua a unos 28-30 ° c.
  4. Tire de algunas Micropipetas de borosilicato (ID 0,86 mm; OD 1,5 mm) con una resistencia de punta: 5-6 MΩ y llenar con la solución intracelular antes de montarse en el portapipetas.
    Nota: Recuerde los alambres de plata de cloruro del electrodo de grabación y el electrodo de referencia en lejía durante al menos 30 min para formar una capa uniforme de AgCl en la superficie del alambre.
  5. Transferir la placa de Petri en la cámara de grabación y dejar que la cámara con la solución de NES a 1-2 mL/min. Deje que el flujo pase a través de un calentador en línea establecido a temperatura de 30 ° c con el fin de mantener la solución caliente.
  6. Coloque la cámara de grabación electrofisiológica bajo un microscopio vertical. Grabe las corrientes de membrana con el amplificador PATCH-CLAMP y adquiera los datos con un software adecuado.
  7. Abra el software de control del amplificador y ajuste la ganancia de señal en el valor 1 y el filtro de Bessel a 10 kHz. Asegúrese de que el filtro de Bessel sea 2,5 veces menor que la frecuencia de muestreo.
  8. Establezca los protocolos experimentales para los experimentos de tensión-abrazadera y corriente-abrazadera en el software de grabación.
  9. En la configuración del Protocolo, marque el modo de estimulación episódica y ajuste la frecuencia de muestreo a 25 kHz. Luego, muévase a la pestaña de forma de onda y escriba el voltaje o la amplitud del paso actual y la longitud como sigue.
  10. Para las corrientes de sodio de voltaje cerrado, utilice 15 pasos de tensión (50 ms de duración cada uno) de-100 mV a + 40 mV (incremento de 10 mV). Ejecute el protocolo después de imponer a la célula parcheada un potencial de retención de-60 mV a través del amplificador. Del mismo modo, las corrientes de potasio cerradas por voltaje son evocadas por pasos de voltaje (250 ms de duración cada uno) de-30 mV a + 50 mV (incremento de 10 mV) sosteniendo la célula grabada a-40 mV.
  11. Para investigar las propiedades de disparo de los MNs craneales y espinales derivados de iPSC, células de abrazadera, en modo de corriente-abrazadera, a un potencial de membrana de-70 mV y utilizar 4 pulsos de corriente (1 s de duración cada uno) de amplitud creciente (de + 20 pA a + 80 pA; 20 pA incremento).
  12. Adquiera para cada corriente activada por voltaje las corrientes, la actividad de cocción evocada y tres propiedades pasivas como la capacitancia de célula entera (cm), la resistencia de la membrana celular (RM) y el potencial de la membrana en reposo (RMP).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En la figura 1se muestra una descripción esquemática del método de diferenciación. Los IPSC humanos (WT I, línea3) fueron transfectados con EPB-BSD-TT-Nil o EPB-BSD-TT-NIP, generando, tras la selección de blasticidina, líneas celulares estables e inducibles12, en lo sucesivo denominadas IPCS-Nil e IPSC-NIP, respectivamente. Las células diferenciadoras se caracterizaron por la expresión del marcador de pluripotencia OCT4 y el marcador panneuronal TUJ1. El análisis de inmunostaining mostró una expresión uniforme de OCT4 en todas las células en el día 0, en ausencia de positividad TUJ1 (figura 2A). En el día 3, observamos una fuerte disminución en el número de células OCT4-positivas, reflejadas por la expresión de TUJ1 en un subconjunto de IPSC diferenciadores (figura 2B). En el día 5, no se observó ninguna expresión de OCT4 en la población, que mostraba una expresión consistente de TUJ1 y adquirió una morfología neuronal (figura 2C). Los progenitores de la neurona motora se disociaron y volvieron a chapar para una mayor maduración. Después de 7 días (12 días desde el día 0), las células expresan uniformemente TUJ1 y el marcador de neurona motora madura CHAT (figura 3). Se obtuvieron resultados similares con dos líneas de iPSC comerciales adicionales (ver tabla de materiales), utilizando las mismas condiciones de cultivo y diferenciación (figura complementaria S1 y figura complementaria S2). Del mismo modo que las neuronas motoras inducidas por NIL del ESCs del ratón11, los IPSC humanos inducidos con Nil y NIP expresaron bajos niveles de factores de transcripción de Hox y pueden ser modelados a lo largo del eje de rostro-caudal con ácido retinoico (figura complementaria S3 ).

Estos resultados se obtuvieron cuando 62.500 células/cm2 fueron sembradas al comienzo de la diferenciación e inducidas con 1 μm de doxiciclina en el día 0. Esto dio lugar a la concentración óptima de doxiciclina para lograr la máxima inducción de los transgenes sin toxicidad evidente para las células (figura complementaria S4A). Tras la extirpación de doxiciclina en el día 5, se silenció la expresión de los transgenes (figura complementaria S4B). También hemos realizado experimentos piloto para establecer la densidad óptima de las células en este punto del protocolo. Notamos que la variación de este parámetro en experimentos de diferenciación paralela proporcionó diferentes resultados. Con la densidad inicial bajada a 31.250 células/cm2, la diferenciación fue aparentemente normal, como se evalúa observando la morfología celular. Sin embargo, notamos la resistencia a la disociación en el día 5 (sección 3,4) y la viabilidad reducida en la posterior fase de maduración. Por el contrario, cuando la densidad inicial de las células se elevó a 125.000 células/cm2, observamos una diferenciación ineficiente, evaluada por la falta de adquisición de la morfología típica de la neurona. Esto dio lugar a una población mixta que contenía sólo una fracción menor de MNs, lo que necesitaría una mayor purificación (por ejemplo, por FACS). Por lo tanto, hemos establecido que la densidad óptima para obtener una población pura de células neuronales, capaz de sobrevivir en la cultura durante más de dos meses, es 62.500 células/cm2.

A continuación, evaluamos la maduración funcional de las neuronas del motor espinal de la iPSC NIL caracterizando sus propiedades electrofisiológicas (figura 4), como se informó anteriormente para las neuronas motoras craneales derivadas de la IPSC12. Las grabaciones de abrazadera de parche, ya sea en modalidad de tensión y de abrazadera de corriente, se realizaron en el día 7 del paso de maduración MNs del Protocolo (ver figura 1; tiempo total de diferenciación: 12 días) (figura 4A). En este momento, las neuronas motoras derivadas de la iPSC NIL mostraron un potencial de membrana en reposo ligeramente inferior (-30 ± 2 mV; n = 24) y un valor de capacitancia de celda similar (+ 25 ± 2 pF; n = 25) en comparación con el de la iPSC con el NIP12. Luego, para caracterizar más profundamente el grado de maduración de las células diferenciadas, investigamos su capacidad para evocar las corrientes de sodio y potasio cuando se estimuló con una serie de pulsos de tensión. En estos experimentos, las neuronas de IPSC derivadas de Nil muestran con éxito corrientes de sodio dependientes de la tensión (figura 4B) y corrientes de potasio dependientes del voltaje (figura 4C), alcanzando la amplitud máxima cuando se sujeta a una potencial de membrana cerca de − 20 mV y + 50 mV, respectivamente. Los potenciales de equilibrio para na+ y K+, calculados utilizando la ecuación de nernst (www.physiologyweb.com/Calculators/nernst_potential_calculator.html) con las soluciones extracelulares y intracelulares notificadas anteriormente, fueron + 110 mV y-102 mV respectivamente. Además, el 80% de los MNs de la iPSC en la modalidad de abrazadera de corriente nula fueron capaces de desencadenar trenes de espiga cuando se inyectaron con un pulso de corriente de + 60 pA o más (figura 4D). La corriente mínima requerida para provocar disparos repetitivos en más del 50% de las células registradas fue de + 40 pA (15 de 18 células; Figura 4 E). el umbral de Spike fue de-37,6 ± 0,8 mV y la frecuencia de disparo promedio en + 40 PA fue de aproximadamente 7,9 ± 2,2 Hz (n = 18; Figura 4 F).

En general, estos datos sugieren que, de manera similar a la iPSC previamente reportado de la IIP de NIP12, MNS espinal derivada de la IPSC-Nil tienen propiedades funcionales típicas de las neuronas maduras.

Figure 1
Figura 1 : Protocolo de diferenciación de la neurona motora. La figura muestra una representación esquemática del Protocolo de diferenciación, desde la generación de líneas iPSC estables con los vectores piggyBac hasta el punto de tiempo del análisis funcional notificado en el texto. Se muestran imágenes de contraste de fase representativa de las celdas en diferentes pasos del protocolo. Barras de escala = 50 μm. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Análisis de inmunostaining representativo de células diferenciadoras. las células iPSC-NIL e iPSC-NIP fueron analizadas por inmunostón para la expresión del marcador de pluripotencia OCT4 (púrpura) y el marcador panneuronal TUJ1 (rojo) en el día 0 (A), día 3 (B) y día 5 (C). Los núcleos se contraían con DAPI. Las imágenes confocales fueron adquiridas en el microscopio confocal de escaneo láser (ver tabla de materiales) usando un objetivo 20X na 0,75 con zoom 2x, 1024 x 1024 pixel, equipado con láseres de 405 nm, 473 nm, 559 nm y 635 nm. Se utilizaron los ajustes de filtro para DAPI, Alexa Fluor 594 y Alexa Fluor 647. Barras de escala = 50 μm. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Análisis de inmunostaining representativo de las neuronas motoras derivadas de la iPSC. las células iPSC-NIL e iPSC-NIP fueron analizadas por inmunostón para la expresión del marcador pan-neuronal TUJ1 (rojo) y el marcador de neurona motora CHAT (colina acetiltransferasa; verde) en el día 12. Los núcleos se contraían con DAPI. Las imágenes confocales se adquirieron como se describe en la leyenda figura 2 . Barras de escala = 50 μm. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Análisis funcional de neuronas motoras espinales y craneales. (A) campo brillante imagen de la abrazadera de parche de célula entera en la neurona de motor espinal derivada de IPSC Nil. (B) curva I/V representativa para na+ corriente registrada en el IIP derivado de Nil de IPSC en respuesta a una serie de pasos de tensión crecientes (n = 26; capacidad de retención igual a-60 MV). (C) curva I/V representativa para K+ grabada en mns de IPSC derivada de Nil en respuesta a una serie de pasos de tensión crecientes (n = 23; capacidad de retención igual a-40 mV). (D) rastro representativo de un tren de potenciales de acción evocado en respuesta a una inyección de corriente de 1 s duradera de + 60 PA. (E) histograma que represente el porcentaje de mns de IPSC derivada de Nil que elicitan potenciales de acción en cada pulso actual (n = 18). (F) histograma que muestra la frecuencia de disparo evocada en cada pulso actual (n = 18). La grabación electrofisiológica se realizó bajo un microscopio vertical. El sistema de grabación de las corrientes de membrana está indicado en la tabla de materiales. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Supplementary Figure 1
Figura complementaria S1: diferenciación MN utilizando hiPSCs Epimales. (A) imágenes de campo claro que diferencien Epimal HIPSC-Nil (izquierda) y Epimal HIPSC-NIP (derecha) en los puntos de tiempo indicados. Barras de escala = 50 μm. (B) análisis de la expresión de los marcadores indicados en las células del Epimal HIPSC-Nil (superior) y del Epimal HIPSC-NIP (inferior) por la PCR en tiempo real. Para cada marcador, el punto de tiempo con la expresión más alta se ha utilizado como muestra de calibrador. Los imprimadores utilizados para ISL1 son específicos para el gen endógeno. (C) inmunostenciamiento para el marcador PANNEURONAL TUJ1 (rojo) y marcador craneal MN PHOX2B (verde) en las células diferenciadas (día 6) Epimal HIPSC-Nil (izquierda) y Epimal HIPSC-NIP (derecha). Los núcleos se contraen con DAPI. Barra de escala para todos los paneles: 50 μm. (D) análisis de la expresión de HB9 y PHOX2B en la diferenciación de las células Epimal HIPSC-Nil (superior) y Epimal HIPSC-NIP (inferior) por la PCR QRT en tiempo real. El día 0 se ha utilizado como la muestra del calibrador. Los imprimadores y métodos de PCR se reportan en de Santis et al., 201812. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Supplementary Figure 2
Figura complementaria S2: diferenciación MN utilizando DS2U iPSCs. (A) las imágenes de campo claro de diferenciar DS2U-Nil (izquierda) y DS2U-NIP (derecha) en los puntos de tiempo indicados. Barras de escala = 50 μm. (B) análisis de la expresión de los marcadores indicados en la diferenciación de las células DS2U-Nil (superior) y DS2U-NIP (inferior) mediante la PCR QRT en tiempo real. Para cada marcador, el punto de tiempo con la expresión más alta se ha utilizado como muestra de calibrador. Los imprimadores utilizados para ISL1 son específicos para el gen endógeno. (C) inmunostenciamiento para el marcador pan-neuronal TUJ1 (rojo) y marcador craneal MN PHOX2B (verde) en las células diferenciadas (día 6) DS2U-Nil (izquierda) y DS2U-NIP (derecha). Los núcleos se contraen con DAPI. Barras de escala = 50 μm. (D) el análisis de la expresión de HB9 y PHOX2B en la diferenciación de las células DS2U-Nil (superior) y DS2U-NIP (inferior) por la PCR QRT en tiempo real. El día 0 se ha utilizado como la muestra del calibrador. Los imprimadores y métodos de PCR se reportan en de Santis et al., 201812. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Supplementary Figure 3
Figura complementaria S3: expresión del gen HOX. (A) análisis de la expresión de cuatro genes HOX diferentes (Hox a2, Hox B1, Hox A4, Hox B5) después de 5 días de diferenciación de las células IPSC-Nil e IPSC-Nil + RA por PCR QRT en tiempo real. IPSC-NIL en el día 0 se ha utilizado como la muestra de calibrador. (B) análisis de la expresión de cuatro genes HOX diferentes (Hox a2, Hox B1, Hox A4, Hox B5) después de 5 días de diferenciación de las células IPSC-NIP e IPSC-NIP + RA por PCR QRT en tiempo real. IPSC-NIP en el día 0 se ha utilizado como la muestra de calibrador. (C) pares de cebadores de PCR. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Supplementary Figure 4
Figura complementaria S4: Análisis de inducción de doxiciclina. (A) análisis en tiempo real de la QRT-PCR de la expresión de Ngn2 exógena en las células IPSC-Nil (superior) e IPSC-NIP (inferior) no tratadas o cultivadas durante 24 h en presencia de doxiciclina en diferentes concentraciones (0,5 μm, 1,0 μm, 2,0 μm). Ngn2 se analizó con imprimadores específicos para el gen del ratón exógeno. La línea parental iPSC, carente de construcciones NIL y NIP, se ha incluido en el análisis como un control. La expresión de los transgenes en iPSC-NIL e iPSC-NIP fue descuidable en ausencia de doxiciclina. iPSC-NIL e iPSC-NIP en el día 0 se han utilizado como muestras de calibrador. (B) análisis en tiempo real de la QRT-PCR de la expresión de Ngn2 exógena para diferenciar las células IPSC-Nil (izquierda) y IPSC-NIP (derecha) en los puntos de tiempo indicados del protocolo. Ngn2 se analizó con imprimadores específicos para el gen del ratón exógeno. iPSC-NIL e iPSC-NIP en el día 0 se han utilizado como muestras de calibrador. Los imprimadores y métodos de PCR se reportan en de Santis et al., 201812. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Este protocolo permite convertir eficientemente los IPSC humanos en neuronas motoras espinales y craneales gracias a la expresión ectópica de factores de transcripción específicos del linaje. Estos transgenes son inducibles por doxiciclina y se integran de forma estable en el genoma gracias a un vector basado en Transposon piggyBac. En una población mixta, una o varias copias del vector piggyBac se integrarán aleatoriamente en el genoma de las células individuales, aumentando el riesgo de alteraciones de la integridad del genoma. Por otra parte, una selección progresiva de subclones de iPSC puede ocurrir con el tiempo, con posibles consecuencias para la diferenciación y para el análisis comparativo de enfermedades y líneas celulares de control. En conjunto, los MNs derivados de la iPSC obtenidos con este Protocolo no serán aptos para la medicina regenerativa. Sin embargo, nuestro método podría ser particularmente útil para el modelado de la enfermedad de la neurona motora in vitro. Los principales puntos de fuerza están representados por las condiciones de cultivo extremadamente simplificadas, la rapidez de la conversión MN, el alto grado de maduración del MNs derivado de la iPSC y la posibilidad de obtener tanto el MNs espinal como el cráneo craneal, como se demostró anteriormente por Análisis de genes marcadores específicos expresión12. La robustez del Protocolo se demuestra por su reproducibilidad. Hasta ahora, hemos aplicado con éxito este protocolo más de 30 veces para la generación de MN espinal y/o craneal, evaluando los resultados por marcadores y/o análisis funcionales. Hemos mantenido con éxito cultivos de neuronas motoras por hasta dos meses sin una disminución evidente de la viabilidad. Además, una vez obtenida la línea iPSC de forma estable, cada experimento puede iniciarse por inducción de doxiciclina sin necesidad de nueva transfección. Los vectores virales tampoco son necesarios. Los resultados representativos presentados aquí se han obtenido mediante el electroporado de las IPSC con el sistema de electroporación celular indicado en la tabla de materiales. Sin embargo, otros métodos de electroporación pueden representar opciones alternativas. A la inversa, en nuestra experiencia, los sistemas de transfección basados en la lipofección no son una buena opción para las células madre pluripotentes12. Las poblaciones celulares obtenidas al final del proceso se componen casi exclusivamente de MNs, evitando la necesidad de una mayor purificación (por ejemplo, por FACS). Como hemos mostrado anteriormente12, el protocolo permite la obtención de 90% células TUJ1-positivas, de las cuales 95% donde también PHOX2B positivo en cultivos derivados de NIP.

Podemos prever algunos puntos críticos que deben tenerse en cuenta con precisión. En primer lugar, la calidad de la población inicial de IPSC es crucial para garantizar una conversión homogénea y consistente en MNs. culturas que contienen una fracción sustancial de la diferenciación (más del 5-10%) debe evitarse. Hemos establecido el protocolo utilizando el medio de iPSC humano descrito en la tabla de materiales como el medio de mantenimiento para iPSCs no diferenciados. Otros medios definidos comercialmente disponibles pueden representar opciones alternativas válidas, a pesar de que no hemos abordado experimentalmente este punto en la presente obra. Dado que la composición de los medios puede influir en la tasa de proliferación de la población celular inicial, la adaptación del Protocolo a otros medios de mantenimiento puede requerir la optimización de la densidad inicial en el día 0. Después de la transfección, es importante mantener las células bajo selección de antibióticos durante al menos 2 semanas para obtener líneas celulares estables. Podría ser apropiado para algunas aplicaciones derivar líneas clonales después de la integración de piggyBac, con el fin de obtener una población más homogénea en términos de niveles de expresión transgénica y un mejor control de los sitios de integración. La densidad de las células en el día 0, el tiempo de adición de doxiciclina al medio, es un parámetro crucial. Como se mencionó en la sección resultados representativos, se estima una densidad celular óptima para garantizar la reproducibilidad. No podemos excluir que otras líneas de células madre pluripotentes puedan requerir una densidad inicial diferente, que debe determinarse empíricamente en experimentos piloto, ya que la tasa de duplicación puede variar significativamente entre líneas individuales. El interruptor medio a Neurobasal/B27 debe ocurrir después de 48 h desde la inducción de doxiciclina (sección 3,3): la diferenciación puede resultar más lenta y menos eficiente si las células no se mantienen durante 2 días enteros en el medio DMEM/F12. La disociación en el día 5 debe realizarse sin enfatizar las células diferenciadoras. El tiempo de incubación con el reactivo de disociación celular (paso 3,4) puede diferir de lote a lote y debe ser estimado cuidadosamente en experimentos piloto. Tras la incubación con el reactivo de disociación celular, toda la célula monocapa se separa de la placa. Entonces, debe ser cuidadosamente disociado por pipeteo, como se describe en la sección 3,4, para preservar la integridad de la célula y para evitar el estrés mecánico, que podría tener un impacto negativo en el mantenimiento del cultivo celular más allá de D5. Finalmente, nos dimos cuenta de que después de re-chapado MNs se adhieren mejor a la cultura del tejido plástico que el vidrio. Los cubreobjetos de polímero aseguran una óptima adherencia de las células y las propiedades ópticas adecuadas son una buena opción para aplicaciones basadas en microscopía.

Nuestro método representa una "programación" directa de las células pluripotentes en un destino MN, y no recapitula los pasos intermedios a través de los cuales las células embrionarias adquieren una identidad MN durante el desarrollo in vivo, como la especificación inicial del ectodermo neural y patrones a lo largo de los ejes dorso-ventral y rostro-caudal. Por lo tanto, no sería adecuado modelar la especificación MN humana in vitro para estudiar, por ejemplo, mecanismos moleculares subyacentes a la diferenciación. Por otro lado, nuestro protocolo permite generar una cantidad considerable de MNs espinales o craneales sin necesidad de una mayor purificación. Tomando también en consideración el grado de maduración alcanzada, esto representa una herramienta útil para el estudio de la base molecular de las enfermedades neurodegenerativas de la neurona motora. En los últimos años, la comunidad científica ha producido un número consistente de líneas iPSC con mutaciones patógenas en genes relacionados con la enfermedad de la neurona motora. Por lo tanto, las colecciones de líneas iPSC "programables" de MN podrían generarse fácilmente mediante la integración estable de los módulos NIL y NIP en esas líneas iPSC mutantes. Podemos prever, como posible aplicación futura del método, la caracterización de los determinantes autónomos celulares que confieren una susceptibilidad diferente a los subtipos individuales de MN, comparando los MNs craneales y espinales Side-by-Side obtenidos de los IPSC con el mismo trasfondo genético. Además, la conversión efectiva de IPSC en MNs en condiciones de cultivo simplificado que necesitan una manipulación mínima (es decir, sin transición a través de cuerpos embrioides) y que puede fácilmente escalable, podría facilitar en gran medida el fármaco automatizado de alto rendimiento enfoques de cribado para las enfermedades de la neurona motora. El modelado in vitro de enfermedades neurodegenerativas de aparición adulta puede ser desafiante debido a la naturaleza fetal de las neuronas derivadas de iPSC14. Las estrategias previas concebidas para acelerar el envejecimiento de los MNs derivados de la diferenciación convencional de los IPSC, como la progerina de sobreexpresión15, podrían combinarse con nuestro método para obtener mejores modelos de enfermedades.

El método descrito aquí, basado en la expresión inducible de los factores de transcripción mediada por un vector piggyBac, se puede aplicar a otros tipos de células inducidas. Hemos demostrado previamente que las células musculares esqueléticas se pueden obtener de IPSC humanos por la expresión de BAF60c y MyoD16. Del mismo modo, podemos prever la posibilidad de extender el método a otros tipos de células de interés, incluyendo otros subtipos neuronales y astrocitos, por la expresión mediada por piggybac de conjuntos apropiados de factores de programación17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar

Acknowledgments

Los autores desean agradecer el servicio de imágenes del centro de vida nano Science, Istituto Italiano di tecnologia, para el apoyo y asesoramiento técnico. Estamos agradecidos a los miembros del centro para la vida Nano Ciencia para la discusión útil. Este trabajo fue apoyado parcialmente por una subvención de AriSLA (piloto Grant 2016 "StressFUS") a AR.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics