Conversion de cellules souches pluripotentes induites par l’homme (iPSCs) en neurones moteurs spinaux et crânien fonctionnels utilisant des vecteurs PiggyBac

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ce protocole permet une conversion rapide et efficace des cellules souches pluripotentes induites en neurones moteurs avec une identité spinale ou crânienne, par l’expression ectopique des facteurs de transcription des vecteurs inductibles de piggyBac.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nous décrivons ici une méthode pour obtenir des neurones moteurs spinaux et crânien fonctionnels à partir de cellules souches pluripotentes induites par l’homme (iPSCs). La conversion directe en neurone moteur est obtenue par l’expression ectopique de modules alternatifs de facteurs de transcription, à savoir Ngn2, Isl1 et Lhx3 (NIL) ou Ngn2, Isl1 et Phox2a (NIP). NIL et NIP spécifient, respectivement, l’identité du neurone du moteur rachidien et crânien. Notre protocole commence par la génération de lignes iPSC modifiées dans lesquelles NIL ou NIP sont intégrés de manière stable dans le génome via un vecteur de transposon piggyBac. L’expression des transgènes est ensuite induite par la doxycycline et conduit, en 5 jours, à la conversion des IPSC en progéniteurs mn. La maturation subséquente, pendant 7 jours, conduit à des populations homogènes de MNs spinales ou crânienne. Notre méthode contient plusieurs avantages par rapport aux protocoles précédents: il est extrêmement rapide et simplifié; il ne nécessite pas d’infection virale ou d’isolement MN supplémentaire; Il permet de générer différentes sous-populations de MN (spinale et crânienne) avec un degré remarquable de maturation, comme en témoigne la capacité de tirer des trains de potentiels d’action. En outre, un grand nombre de neurones moteurs peuvent être obtenus sans purification de populations mixtes. les neurones moteurs spinaux et crânien dérivés de l’iPSC peuvent être utilisés pour la modélisation in vitro de la sclérose latérale amyotrophique et d’autres maladies neurodégénératives du Neuron du moteur. Les populations homogènes de neurons moteurs peuvent représenter une ressource importante pour les dépistages de médicaments spécifiques au type cellulaire.

Introduction

La dégénérescence du neurone du moteur (MN) joue un rôle causal dans les maladies humaines telles que la sclérose latérale amyotrophique (SLA) et l’atrophie musculaire spinale (SMA). L’établissement de systèmes de modèles cellulaires in vitro adaptés qui récapitulent la complexité du MN humain est une étape importante vers le développement de nouvelles approches thérapeutiques. Les cellules souches pluripotentes induites (ipscs), qui sont dotées de propriétés de différenciation plurilinéale remarquables, ont maintenant été dérivées d’un certain nombre de patients touchés par les maladies du neurone moteur1,2. D’autres lignées iPSC porteuses de mutations pathogènes associées à des maladies du MN ont été générées par l’édition génique, à partir de cellules souches pluripotentes de contrôle «saines»3. Ces lignes représentent des outils utiles pour la modélisation des maladies in vitro et le dépistage des médicaments, à condition que des méthodes appropriées pour la différenciation des iPSC dans les MNs soient disponibles. Le raisonnement qui sous-tend le développement de cette méthode est de fournir à la communauté scientifique intéressée par les maladies MN un protocole de différenciation rapide et efficace donnant naissance à des MNs fonctionnelles matures. Le premier avantage de cette méthode est son délai d’exécution. Un autre point de force pertinent vient de l’élimination de toute étape de purification. Enfin, le protocole peut être utilisé pour générer deux populations distinctes de neurones moteurs.

La possibilité de générer différents sous-types de MNs est particulièrement pertinente pour la modélisation des maladies MN. Tous les sous-types de MN ne sont pas tout aussi vulnérables dans le SLA et le SMA et l’apparition des symptômes dans différentes unités motrices influe grandement sur le pronostic. Dans l’ALS, l’apparition spinale avec des symptômes commençant dans les membres supérieurs et inférieurs conduit à la mort dans environ 3-5 ans4. Inversement, l’apparition de bulbardes, commençant par la dégénérescence des MNs crânienne, a un pronostic pire. En outre, le pourcentage d’apparition de bulbardes est significativement plus élevé chez les patients avec des mutations dans les protéines de liaison de l’ARN FUS et TDP-43 que chez les individus avec des mutations SOD15. Presque la totalité des protocoles alternatifs de différenciation du mn repose sur l’activité de l’acide rétinoïque (RA), qui confère un caractère spinal à la différenciation des ipscs6,7,8. Cela limite la possibilité d’étudier des facteurs intrinsèques, qui pourraient être protecteurs dans des sous-types de mn spécifiques9,10.

En accord avec un travail antérieur dans les cellules souches embryonnaires de souris11, nous avons récemment montré que dans l’expression ectopique d’ipscs humaine de Ngn2, Isl1 et LHX3 (Nil) induit une identité de mn spinale, tandis que Ngn2 et Isl1 plus PHOX2A (NIP) spécifient le MNS crânien12. Nous avons donc développé un protocole efficace, conduisant à la production de MNs humaines dotées de propriétés fonctionnelles dans un délai de 12 jours. Le but de cette méthode est d’obtenir, dans un court laps de temps et sans la nécessité de purification (par exemple, par FACS), les populations cellulaires hautement enrichi pour les MNs avec l’identité spinale ou crânienne.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. maintenance des IPSC humains

  1. Préparation de plaques enrobées de matrices
    1. Décongeler un flacon de 5 mL de matrice (voir tableau des matériaux) à 4 ° c pendant la nuit. Les stocks matriciels originaux proviennent de différentes concentrations de stocks et les aliquotes sont effectués selon le facteur de dilution indiqué sur la fiche technique, spécifique au lot individuel. Il est important de garder le flacon et les tubes froids pour éviter une gélification prématurée de la matrice. Distribuez la matrice en aliquotes dans des cryotubes préréfrigérés sur glace. Congeler les aliquotes inutilisés à-20 ° c.
    2. Placer une aliquote sur la glace pendant environ 2 h pour décongeler.
    3. Diluer l’aliquote de matrice avec 20 mL de DMEM/F12 froid dans un tube conique de 50 mL.
    4. Bien mélanger et distribuer 1 mL de matrice diluée dans des plats de 35 mm (quantités équivalentes par surface d’autres plats).
    5. Conserver les plats contenant une matrice diluée pendant 1 h à température ambiante pour permettre le revêtement.
      Remarque: Les plats, scellés avec du Parafilm, peuvent être stockés à 4 ° c pendant 2 semaines.
  2. Préparation de la solution d’action (20 ml) et 1x aliquotes de travail du réactif de dissociation cellulaire doux (voir tableau des matériaux).
    1. Dissoudre la poudre à 10 mg/mL dans du PBS (ca2 +/mg2 + gratuit).
    2. Filtrer stériliser à travers une membrane filtrante de 0,22 μM.
    3. Préparer 20 aliquotes (1 mL chacun) et les conserver à-20 ° c.
    4. Avant utilisation, diluer une aliquote dans du PBS (ca2 +/mg2 + Free) à 1 mg/ml (1x aliquots de travail).
      Remarque: 1x les aliquotes de travail peuvent être stockés à 4 ° c pendant 2 semaines maximum.
  3. Passaging iPSCs humains.
    1. Avant de commencer: s’il est stocké à 4 ° c, les plaques pré-chaudes enduites de matrice dans l’incubateur à 37 ° c pendant 20-30 min. Préchauffer à température ambiante la quantité de milieu humain iPSC (voir tableau des matériaux) nécessaire. Préchauffer le DMEM/F12.
    2. Milieu de culture aspirate.
    3. Rincez les IPSC avec du PBS (ca2 +/mg2 + gratuit).
    4. Ajouter 1x solution de dissociation douce (0,5 mL pour un plat de 35 mm). Incuber à 37 ° c jusqu’à ce que les bords des colonies commencent à se détacher de la plaque, généralement 3-5 min.
    5. Aspirer la solution de dissociation douce, en veillant à ne pas détacher les colonies iPSC.
    6. Laver les cellules avec du DMEM/F12 (2 mL pour un plat de 35 mm) et aspirer en veillant à ne pas détacher les cellules. Répétez cette étape une fois de plus.
    7. Ajouter le milieu iPSC humain (1 mL pour un plat de 35 mm).
    8. Détachez délicatement les colonies avec un lève-cellules et transférez-les dans un tube de 15 mL.
    9. Casser doucement les amas de cellules en pipetant de haut en bas avec un multipipette P1000 3-4 fois.
    10. Aspirer le surnageant de la (des) plaque (s) enrobées de matrice.
    11. Ensemencer les cellules dans le volume de culture approprié du milieu iPSC humain. Le ratio de fractionnement peut varier d’une ligne à l’autres et est d’environ 1:4-1:8. Changez le médium quotidiennement.

2. génération de lignes iPSC inducibles de NIL et de NIP

  1. Transfection cellulaire.
    1. Rincer les cellules avec du PBS (ca2 +/mg2 + gratuit).
    2. Ajouter le réactif de dissociation cellulaire (voir tableau des matériaux) (0,35 ml pour un plat de 35 mm) et incuber à 37 ° c jusqu’à ce que les cellules individuelles soient séparées (5-10 min).
    3. Terminez doucement la séparation cellulaire en pipetant de haut en bas avec un multipipette P1000 3-4 fois.
    4. Prélever dans un tube de 15 mL et ajouter du PBS (ca2 +/mg2 + gratuit) à 10 ml. Comptez les cellules.
    5. Granulés 106 cellules et resuspendre dans 100 μl de tampon R (inclus dans le kit d’électroporation cellulaire, voir tableau des matériaux).
    6. Ajouter l’ADN plasmidique pour la transfection: 4,5 μg de vecteur transposable (epB-BSD-TT-NIL ou epB-BSD-TT-NIP12) et 0,5 μg du plasmide de transposase piggyBac13.
    7. Transfect avec le système d’électroporation cellulaire (voir tableau des matériaux) selon les instructions du fabricant et comme décrit précédemment3 avec les paramètres suivants: 1 200 tension V, 30 ms de largeur, 1 impulsion. Ensemencer les cellules dans un milieu iPSC humain additionné de 10 μM Y-27632 (inhibiteur de roche, voir tableau des matériaux) dans un plat à matrice de 6 mm.
  2. Sélection avec des antibiotiques.
    1. Deux jours après la transfection, ajouter 5 μg/mL de blasticidine au milieu de culture.
    2. La plupart des cellules non transfection mourront dans les 48 h de sélection de blasticidine. Conserver les cellules dans la blasticidine pendant au moins 7-10 jours pour contrer-sélectionner les cellules qui n’ont pas intégré les transgènes dans le génome.
    3. Maintenir des cellules transfectées de manière stable en tant que population mixte, composée de cellules avec un nombre différent de transgènes et de différents sites d’intégration, ou isoler des clones isolés.
    4. Préparer un plat supplémentaire pour vérifier l’expression efficace des transgenes, sur 1 μg/mL d’induction de doxycycline, par RT-PCR avec des amorces spécifiques au transgène pour Ngn2 (Forward: TATGCACCTCACCTCCCCATAG; Inverse: GAAGGGAGGAGGGCTCGACT), comme décrit précédemment12.
    5. À ce stade, geler les stocks des nouvelles lignées NIL-et NIP-iPSC dans le milieu de congélation pour les IPCS humains (voir le tableau des matériaux).

3. différenciation du Neuron moteur

  1. Dissociez les cellules avec le réactif de dissociation de cellules comme décrit (étapes 2.1.1.-2.1.3.). Prélever des cellules dissociées dans un tube de 15 mL et diluer avec 5 volumes de DMEM/F12. Pellet les cellules et resuspendre dans le milieu humain iPSC complété avec 10 μM inhibiteur de roche. Comptez les cellules et les semences sur des plats enrobés de matrice à une densité de 62 500 cellules/cm2.
  2. Le lendemain, remplacez le milieu par le DMEM/F12, complété par 1x analogue de L-glutamine stable, 1x supplément de culture cellulaire de l’acide aminé non essentiel (NEAA) et 0,5 x pénicilline/streptomycine, et contenant 1 μg/mL de doxycycline. Ceci est considéré comme le jour 0 de la différenciation. Le jour 1, rafraîchissez le milieu et la doxycycline.
  3. Le deuxième jour, changez le milieu en milieu Neurobasal/2/17 (milieu Neurobasal additionné de 1x 2, 1x, analogue de L-glutamine stable, 1x NEAA et 0,5 x pénicilline/streptomycine), contenant 5 μM DAPT, 4 μM SU5402 et 1 μg/mL de doxycycline (voir tableau des matériaux ). Rafraîchissez le milieu et la doxycycline tous les jours jusqu’au jour 5.
  4. Jour 5: dissociation des cellules avec le réactif de dissociation cellulaire (voir tableau des matériaux).
    1. Rincer les cellules avec du PBS (ca2 +/mg2 + gratuit).
    2. Ajouter le réactif de dissociation cellulaire (0,35 mL pour un plat de 35 mm) et incuber à 37 ° c jusqu’à ce que toute la monocouche de la cellule se sépare du plat. Notez que les cellules individuelles ne seront pas séparées pendant l’incubation.
    3. Ajouter 1 mL de DMEM/F12 et collecter les cellules dans un tube de 15 mL.
    4. Terminez doucement la séparation cellulaire en pipetant de haut en bas avec un multipipette P1000 10-15 fois.
    5. Ajoutez 4 mL de DMEM/F12 et comptez les cellules.
    6. À ce stade, geler les progéniteurs du neurone du moteur dans le milieu de congélation cellulaire (voir tableau des matériaux), selon les instructions du fabricant.
    7. Pellet les cellules et resuspendre dans neuronal Medium (Neurobasal/2, 5milieu complété avec 20 ng/mL BDNF, 10 ng/mL GDNF et 200 ng/mL acide L-ascorbique, voir tableau des matériauxs) complété par 10 μM inhibiteur de roche.
    8. Ensemencer les cellules sur poly-ornithine/laminine-ou alternativement sur des supports revêtus de matrices à la densité de 100 000 cellules/cm2. Utilisez des supports en plastique μ-Slide avec des lamelles en polymère (voir tableau des matériaux) pour l’analyse Immunostatique.
  5. Le jour 6, changez le milieu avec le milieu neuronal frais dépourvu d’inhibiteur de roche. Les prochains jours, rafraîchissez la moitié du médium tous les 3 jours. Le milieu de culture doit être changé très soigneusement afin d’éviter le détachement de la surface.

4. analyse immunostaining

  1. Fixation des cellules. Rincer les cellules avec du PBS (avec ca2+/mg2 +) et incuber pendant 15 min dans du paraformaldéhyde à 4% dans du PBS (avec ca2 +/mg2 +) à température ambiante.
    Attention: Paraformaldéhyde est toxique et soupçonné de causer le cancer. Évitez tout contact avec la peau et les yeux et manipulez-les sous une hotte chimique.
  2. Perméabilize avec PBS (avec ca2 +/mg2 +) contenant 0,1% de Triton X-100 pendant 5 min à température ambiante.
  3. Incuber pendant 30 min à température ambiante dans la solution de blocage d’anticorps (ABS: 3% BSA dans PBS avec ca2 +/mg2 +).
  4. Incuber pendant 1 h à température ambiante avec des anticorps primaires en ABS: anti-TUJ1 (1:1000; lapin) et anti-Oct4 (1:200; souris) ou anti-CHAT (acétyltransférase anti-choline; 1:150; chèvre). Voir le tableau des matériaux.
  5. Incuber pendant 45 min à température ambiante avec une paire d’anticorps secondaire d’âne appropriée en ABS: anti-souris Alexa Fluor 647 (1:250), anti-lapin Alexa Fluor 594 (1:250) et anti-chèvre Alexa Fluor 488 (1:250). Voir le tableau des matériaux.
  6. Incuber en 0,4 μg/mL de DAPI pendant 5 min à température ambiante pour étiqueter les noyaux.
  7. Montez les cellules avec un support de montage (voir tableau des matériaux) pour l’imagerie à un microscope à fluorescence.

5. caractérisation fonctionnelle via des enregistrements patch-clamp

  1. Préparer la solution externe Equilibrée (NES) HEPES comme suit: 140 mM NaCl, 2,8 mM KCl, 2 mM CaCl2mm MgCl2, 10 mm HEPES et 10 mm de glucose. Réglez l’osmolarité entre 290-300 mΩ. Réglez le pH sur 7,3 à l’aide du NaOH 1N et stockez la solution à 4 ° c.
  2. Préparer la solution interne: 140 mM K-gluconate, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mm HEPES, 2 mm mg-ATP, 0,3 mm na-GTP. Réglez le pH sur 7,3 avec 1M KOH et vérifiez que l’osmolarité est fixée à environ 290 mΩ. Congeler la solution à-20 ° c dans les petits aliquots.
  3. Avant d’exécuter les expériences, préchauffer la solution NES dans un bain d’eau à environ 28-30 ° c.
  4. Tirer quelques micropipettes borosilicate (ID 0,86 mm; OD 1,5 mm) portant une résistance à la pointe: 5-6 MΩ et remplir avec la solution intracellulaire avant de le monter dans le porte-pipette.
    Remarque: N’oubliez pas de chlorure d’argent fils de l’électrode d’enregistrement et l’électrode de référence dans l’eau de Javel pendant au moins 30 min afin de former une couche uniforme d’AgCl sur la surface du fil.
  5. Transférer la boîte de Petri dans la chambre d’enregistrement et laisser la chambre avec la solution NES à 1-2 mL/min. Laisser le flux passer par un chauffe-eau en ligne réglé à une température de 30 ° c afin de maintenir la solution au chaud.
  6. Placer la chambre d’enregistrement électrophysiologique sous un microscope vertical. Enregistrez les courants membranaires avec l’amplificateur patch-clamp et acquérez des données avec un logiciel approprié.
  7. Ouvrez le logiciel de commande de l’amplificateur et réglez le gain de signal à la valeur 1 et le filtre Bessel à 10 kHz. Assurez-vous que le filtre Bessel est 2,5 fois plus bas que la fréquence d’échantillonnage.
  8. Définissez les protocoles expérimentaux pour les expériences de Clamp de tension et de serrage de courant dans le logiciel d’enregistrement.
  9. Dans le paramètre de protocole, cochez le mode de stimulation épisodique et réglez la fréquence d’échantillonnage à 25 kHz. Ensuite, passez à l’onglet de forme d’onde et tapez l’amplitude et la longueur de l’étape de tension ou de courant comme suit.
  10. Pour les courants de sodium à tension, utiliser 15 paliers de tension (durée de 50 ms chacun) de-100 mV à + 40 mV (incrément de 10 mV). Exécutez le protocole après avoir imposé à la cellule patchée un potentiel de maintien de-60 mV à travers l’amplificateur. De même, les courants de potassium à tension fermée sont évoqués par des paliers de tension (durée de 250 ms chacune) de-30 mV à + 50 mV (incrément de 10 mV) qui maintiennent la cellule enregistrée à-40 mV.
  11. Pour étudier les propriétés de tir des MNs crânienne et spinales dérivées de l’iPSC, les cellules de serrage, en mode de serrage actuel, à un potentiel membranaire de-70 mV et utilisent 4 impulsions de courant (1 s de durée chacune) d’amplitude croissante (de + 20 pA à + 80 pA; 20 pA d’incrément).
  12. Acquérir pour chaque courant de tension cellulaire activé, activité de tir évoquée et trois propriétés passives comme capacité de cellules entières (cm), résistance membranaire cellulaire (RM) et potentiel membranaire au repos (PGR).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Une description schématique de la méthode de différenciation est illustrée à la figure 1. Les iPSCs humains (WT I Line3) ont été transfrés avec EPB-BSD-TT-Nil ou EPB-BSD-TT-NIP, générant, sur sélection de blasticidine, des lignées cellulaires stables et inductibles12, ci-après appelées IPSC-Nil et IPSC-NIP, respectivement. Les cellules différenciantes ont été caractérisées pour l’expression du marqueur de pluripotence OCT4 et du marqueur Pan-neuronal TUJ1. L’analyse immunostaining a montré une expression uniforme de OCT4 dans toutes les cellules au jour 0, en l’absence de positivité TUJ1 (figure 2A). Au jour 3, nous avons observé une forte diminution du nombre de cellules OCT4-positives, reflétées par l’expression de TUJ1 dans un sous-ensemble des IPSC différenciants (figure 2B). Au jour 5, aucune expression de OCT4 n’a été observée dans la population, qui a montré une expression cohérente de TUJ1 et a acquis une morphologie neuronale (figure 2C). Les progéniteurs du neurone du moteur ont ensuite été dissociés et replaqués pour une maturation ultérieure. Après 7 jours (12 jours depuis le jour 0), les cellules ont uniformément exprimé TUJ1 et le marqueur de neurone moteur mature CHAT (figure 3). Des résultats similaires ont été obtenus avec deux autres lignes commerciales de l’iPSC (voir le tableau des matériaux), en utilisant les mêmes conditions de culture et de différenciation (figure supplémentaire S1 et figure supplémentaire S2). De même que les neurones moteurs induits par NIL à partir des ESCs11de la souris, les IPSC humains induits par Nil et NIP ont exprimé des niveaux faibles de facteurs de transcription HOX et peuvent être modelés le long de l’axe Rostro-caudal avec l’acide rétinoïque (figure supplémentaire S3 ).

Ces résultats ont été obtenus lorsque les cellules 62 500/cm2 ont été ensemencées au début de la différenciation et induites avec 1 μM de doxycycline au jour 0. Cela a entraîné la concentration optimale de doxycycline pour obtenir une induction maximale des transgènes sans toxicité évidente pour les cellules (figure supplémentaire S4A). Lors de l’enlèvement de la doxycycline au jour 5, l’expression des transgènes a été réduite au silence (figure supplémentaire S4B). Nous avons également effectué des expériences pilotes pour établir la densité optimale des cellules à ce stade du protocole. Nous avons remarqué que la variation de ce paramètre dans les expériences de différenciation parallèles a donné des résultats différents. Avec une densité initiale abaissée à 31 250 cellules/cm2, la différenciation était apparemment normale, évaluée en observant la morphologie des cellules. Cependant, nous avons remarqué une résistance à la dissociation au jour 5 (section 3,4) et une viabilité réduite dans la phase de maturation subséquente. Inversement, lorsque la densité initiale des cellules a été augmentée à 125 000 cellules/cm2, nous avons observé une différenciation inefficace, telle qu’évaluée par le manque d’acquisition de la morphologie typique de type Neuron. Cela a entraîné une population mixte ne contenant qu’une fraction mineure des MNs, qui nécessiterait une purification plus poussée (par exemple, par le FACS). Nous avons donc établi que la densité optimale pour obtenir une population pure de cellules neuronales, capable de survivre en culture pendant plus de deux mois, est de 62 500 cellules/cm2.

Nous avons ensuite évalué la maturation fonctionnelle des neurones moteurs spinaux dérivés de l’iPSC en caractérisant leurs propriétés électrophysiologiques (figure 4), comme indiqué précédemment pour les neurones moteurs crânien dérivés du NIP IPSC12. Des enregistrements de pinces de fixation, en modalité de tension et de courant, ont été effectués au jour 7 de l’étape de maturation des MNs du protocole (voir la figure 1; durée totale de différenciation: 12 jours) (figure 4A). À ce moment-là, les neurones moteurs dérivés de l’iPSC NIL ont montré un potentiel de membrane au repos légèrement inférieur (-30 ± 2 mV; n = 24) et une valeur de capacité cellulaire similaire (+ 25 ± 2 pF; n = 25) par rapport aux MNs12de l’IPSC précédemment rapportés. Ensuite, pour caractériser plus en profondeur le degré de maturation des cellules différenciées, nous avons étudié leur capacité à évoquer les courants de sodium et de potassium lorsqu’ils sont stimulés par une série d’impulsions de tension. Dans ces expériences, les neurones dérivés de l’IPSC Nil ont affiché avec succès des courants de sodium dépendants de la tension (figure 4B) et des courants de potassium dépendants de la tension (figure 4C), atteignant l’amplitude de crête lorsqu’il est serré à un potentiel membranaire proche de − 20 mV et + 50 mV, respectivement. Les potentiels d’équilibre de Na+ et K+, calculés à l’aide de l’équation de nernst (www.physiologyweb.com/Calculators/nernst_potential_calculator.html) avec les solutions extracellulaires et intracellulaires précédemment rapportées, respectivement + 110 mV et-102 mV. De plus, les 80% des MNs dérivées de l’iPSC à l’aide d’un seuil de courant ont été en mesure de déclencher des trains de pointes lorsqu’ils sont injectés avec une impulsion de courant de + 60 pA ou plus (figure 4D). Le courant minimum requis pour déclencher des tirs répétitifs dans plus de 50% des cellules enregistrées était de + 40 pA (15 sur 18 cellules; Figure 4 E). le seuil de Spike était de-37,6 ± 0,8 MV et la fréquence de tir moyenne à + 40 PA était d’environ 7,9 ± 2,2 Hz (n = 18; Figure 4 F).

Dans l’ensemble, ces données suggèrent que, de la même façon que les MNS crânienne de l’IPSC, dérivées du pin crânien12, les MNS spinales dérivées de l’IPSC ont des propriétés fonctionnelles typiques des neurones matures.

Figure 1
Figure 1 : Protocole de différenciation du neurone moteur. La figure montre une représentation schématique du protocole de différenciation, de la génération de lignes stables iPSC avec les vecteurs piggyBac jusqu’au point temporel de l’analyse fonctionnelle rapportée dans le texte. Des images de contraste de phase représentatives des cellules à différentes étapes du protocole sont affichées. Barres d’échelle = 50 μM. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
La figure 2 : Analyse immunocoloration représentative des cellules différenciantes. les cellules IPSC-Nil et IPSC-NIP ont été analysées par immunocoloration pour l’expression du marqueur de pluripotence Oct4 (violet) et du marqueur Pan-neuronal TUJ1 (rouge) au jour 0 (A), jour 3 (B) et jour 5 (C). Les noyaux ont été contre-colorés avec le DAPI. Des images confocales ont été acquises au microscope confocale à balayage laser (voir tableau des matériaux) à l’aide d’un objectif 20X na 0,75 avec zoom 2x, 1024 x 1024 Pixel, équipé de 405 nm, 473 nm, 559 nm et 635 nm lasers. Le réglage du filtre pour DAPI, Alexa Fluor 594 et Alexa Fluor 647 ont été utilisés. Barres d’échelle = 50 μM. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Analyse immunocoloration représentative des neurones moteurs dérivés de l’IPSC. les cellules IPSC-Nil et IPSC-NIP ont été analysées par immunocoloration pour l’expression du marqueur Pan-neuronal TUJ1 (rouge) et le marqueur de neurone du moteur chat (choline acétyltransférase; vert) au jour 12. Les noyaux ont été contre-colorés avec le DAPI. Les images confocales ont été acquises comme décrit dans la figure 2 Legend. Barres d’échelle = 50 μM. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Analyse fonctionnelle des neurones moteurs spinaux et crânien. (A) champ lumineux image de la pince à cellules entières sur le Neuron du moteur spinal dérivé de IPSC Nil. Bcourbe I/V représentative pour le courant na+ enregistré dans les MNS dérivées de l’IPSC en réponse à une série d’étapes de tension croissantes (n = 26; potentiel de maintien égal à-60 mV). Ccourbe I/V représentative pour K+ enregistrée dans les MNS dérivées d’IPSC Nil en réponse à une série d’étapes de tension croissantes (n = 23; potentiel de maintien égal à-40 mV). (D) trace représentative d’un potentiel de train d’action évoqué en réponse à une injection de courant durable de 1 s de + 60 PA. (E) histogramme représentant le pourcentage de MNS dérivées de l’IPSC qui ont provoqué des potentiels d’action à chaque impulsion actuelle (n = 18). (F) histogramme affichant la fréquence de tir évoquée à chaque impulsion de courant (n = 18). L’enregistrement électrophysiologique a été effectué sous un microscope vertical. Le système d’enregistrement des courants membranaires est indiqué dans le tableau des matériaux. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Supplementary Figure 1
Figure supplémentaire S1: différenciation mn à l’aide d’episomal hiPSCs. (A) images Brightfield de différencier HIPSC-Nil (gauche) et episomal HIPSC-NIP (à droite) aux points de temps indiqués. Barres d’échelle = 50 μM. Banalyse de l’expression des marqueurs indiqués dans la différenciation des cellules Episomales HIPSC-Nil (en haut) et episomal HIPSC-NIP (inférieures) par qRT-PCR en temps réel. Pour chaque marqueur, le point temporel avec l’expression la plus élevée a été utilisé comme échantillon de calibrateur. Les amorces utilisées pour ISL1 sont spécifiques pour le gène endogène. (C) immunostaining pour le marqueur Pan-neuronal TUJ1 (rouge) et le marqueur crânien mn PHOX2B (vert) dans les cellules Épomales EPISOMIQUES-Nil (gauche) et Episomale HIPSC-NIP (droite). Les noyaux sont contre-colorés avec le DAPI. Barre d’échelle pour tous les panneaux: 50 μM. (D) analyse de l’expression de HB9 et PHOX2B en différenciant les cellules HIPSC-Nil (en haut) et episomal HIPSC-NIP (inférieures) d’episomal par le qRT-PCR en temps réel. Le jour 0 a été utilisé comme échantillon de calibrateur. Les amorces et les méthodes de PCR sont rapportées dans de Santis et coll., 201812. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Supplementary Figure 2
Figure supplémentaire S2: différenciation mn à l’aide de DS2U iPSCs. (A) images Brightfield de différencier DS2U-Nil (gauche) et DS2U-NIP (droite) aux points de temps indiqués. Barres d’échelle = 50 μM. (B) analyse de l’expression des marqueurs indiqués pour différencier les cellules DS2U-Nil (en haut) et DS2U-NIP (inférieures) par le qRT-PCR en temps réel. Pour chaque marqueur, le point temporel avec l’expression la plus élevée a été utilisé comme échantillon de calibrateur. Les amorces utilisées pour ISL1 sont spécifiques pour le gène endogène. (C) immunostaining pour le marqueur Pan-neuronal TUJ1 (rouge) et le marqueur crânien mn PHOX2B (vert) dans les cellules différenciées (jour 6) DS2U-Nil (gauche) et DS2U-NIP (droite). Les noyaux sont contre-colorés avec le DAPI. Barres d’échelle = 50 μM. (D) analyse de l’expression de HB9 et PHOX2B en différenciant les cellules DS2U-Nil (en haut) et DS2U-NIP (inférieures) par le qRT-PCR en temps réel. Le jour 0 a été utilisé comme échantillon de calibrateur. Les amorces et les méthodes de PCR sont rapportées dans de Santis et coll., 201812. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Supplementary Figure 3
Figure supplémentaire S3: expression du gène HOX. (A) analyse de l’expression de quatre gènes Hox différents (HOX a2, HOX B1, HOX a4, HOX B5) après 5 jours de différenciation des cellules IPSC-Nil et IPSC-Nil + RA par qRT-PCR en temps réel. IPSC-NIL au jour 0 a été utilisé comme échantillon de calibrateur. Banalyse de l’expression de quatre gènes Hox différents (HOX a2, HOX B1, HOX a4, HOX B5) après 5 jours de différenciation des cellules IPSC-NIP et IPSC-NIP + RA en temps réel qRT-PCR. IPSC-NIP au jour 0 a été utilisé comme échantillon de calibrateur. (C) paires d’amorces PCR. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Supplementary Figure 4
Figure complémentaire S4: analyse par induction de la doxycycline. Aanalyse par qRT-PCR en temps réel de l’expression de Ngn2 exogènes dans des cellules IPSC-Nil (supérieures) et IPSC-NIP (inférieures) non traitées ou cultivées pendant 24 h en présence de doxycycline à une concentration différente (0,5 μm, 1,0 μm, 2,0 μm). Ngn2 a été analysé avec des amorces spécifiques pour le gène de la souris exogène. La ligne parentale iPSC, dépourvue de constructions NIL et NIP, a été incluse dans l’analyse comme un contrôle. L’expression des transgènes dans iPSC-NIL et iPSC-NIP a été négligable en l’absence de doxycycline. iPSC-NIL et iPSC-NIP au jour 0 ont été utilisés comme échantillons de calibrateur. Banalyse par PCR en temps réel de l’expression de la Ngn2 exogène dans les cellules de différenciation IPSC-Nil (gauche) et IPSC-NIP (droite) aux points de temps indiqués du protocole. Ngn2 a été analysé avec des amorces spécifiques pour le gène de la souris exogène. iPSC-NIL et iPSC-NIP au jour 0 ont été utilisés comme échantillons de calibrateur. Les amorces et les méthodes de PCR sont rapportées dans de Santis et coll., 201812. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ce protocole permet de convertir efficacement les IPSC humains en neurones moteurs spinaux et crânien grâce à l’expression ectopique de facteurs de transcription spécifiques à la lignée. Ces transgènes sont inductibles par la doxycycline et sont intégrés de manière stable dans le génome grâce à un vecteur basé sur le transposon piggyBac. Dans une population mixte, une ou plusieurs copies du vecteur piggyBac seront intégrées au hasard dans le génome de cellules individuelles, augmentant ainsi le risque d’altération de l’intégrité du génome. En outre, une sélection progressive de sous-clones de l’iPSC peut survenir au fil du temps, avec des conséquences possibles pour la différenciation et pour l’analyse comparative des lignées cellulaires de maladies et de contrôle. Au total, les MNs dérivées de l’iPSC obtenues avec ce protocole seront impropres à la médecine régénérative. Cependant, notre méthode pourrait être particulièrement utile pour la modélisation de la maladie du neurone moteur in vitro. Les principaux points de force sont représentés par les conditions de culture extrêmement simplifiées, la rapidité de la conversion du MN, le degré élevé de maturation des MNs dérivées de l’iPSC et la possibilité d’obtenir des MNs spinales et crânienne, comme démontré antérieurement par l’analyse des gènes ponctuels spécifiques de l’expression12. La robustesse du protocole est démontrée par sa reproductibilité. Jusqu’à présent, nous avons appliqué avec succès ce protocole plus de 30 fois pour la génération de MN spinale et/ou crânienne, en évaluant les résultats par marqueurs et/ou analyses fonctionnelles. Nous avons maintenu avec succès les cultures de neurone moteur pendant jusqu’à deux mois sans diminution évidente de la viabilité. De plus, une fois que la ligne iPSC a été obtenue de façon stable, chaque expérience peut être démarrée par induction de la doxycycline sans nécessiter de nouvelle transfection. Les vecteurs viraux ne sont pas non plus requis. Les résultats représentatifs présentés ici ont été obtenus par electroporating iPSCs avec le système d’électroporation cellulaire indiqué dans le tableau des matériaux. Cependant, d’autres méthodes d’électroporation peuvent représenter d’autres options. Inversement, dans notre expérience, les systèmes de transfection basés sur la lipofection ne sont pas une bonne option pour les cellules souches pluripotentes12. Les populations cellulaires obtenues à la fin du processus sont composées presque exclusivement de MNs, évitant ainsi la nécessité d’une purification supplémentaire (par exemple, par FACS). Comme nous l’avons montré précédemment12, le protocole permet d’obtenir 90% de cellules positives de TUJ1, dont 95% où aussi PHOX2B positif dans les cultures dérivées de NIP.

Nous pouvons envisager certains points critiques qui doivent être pris en considération avec précision. Premièrement, la qualité de la population initiale des IPSC est cruciale pour assurer une conversion homogène et cohérente en MNs. cultures contenant une fraction substantielle de la différenciation (plus de 5-10%) doit être évitée. Nous avons mis en place le protocole en utilisant le milieu iPSC humain décrit dans le tableau des matériaux comme support de maintenance pour les IPCS indifférenciés. D’autres médias définis dans le commerce peuvent représenter des options alternatives valables, bien que nous n’ayons pas abordé ce point dans le présent travail. Étant donné que la composition des médias peut influencer le taux de prolifération de la population de cellules de départ, l’adaptation du protocole à d’autres milieux de maintenance peut nécessiter une optimisation de la densité initiale au jour 0. Après la transfection, il est important de garder les cellules sous la sélection des antibiotiques pendant au moins 2 semaines pour obtenir des lignées cellulaires stables. Il pourrait être approprié pour certaines applications de dériver des lignées clonales après l’intégration de piggyBac, afin d’obtenir une population plus homogène en termes de niveaux d’expression transgénique et un meilleur contrôle des sites d’intégration. La densité des cellules au jour 0, le temps de l’addition de doxycycline au milieu, est un paramètre crucial. Comme indiqué dans la section résultats représentatifs, nous avons estimé une densité cellulaire optimale pour assurer la reproductibilité. Nous ne pouvons exclure que d’autres lignées de cellules souches pluripotentes puissent nécessiter une densité initiale différente, qui devrait être déterminée empiriquement dans les expériences pilotes, car le taux de duplication peut varier significativement entre les lignées individuelles. Le commutateur moyen à Neurobasal/48 doit se produire après l’induction de la doxycycline (section 3,3): la différenciation peut se traduire par un ralentissement et une efficacité moindre si les cellules ne sont pas détenues pendant 2 jours entiers dans le milieu DMEM/F12. La dissociation au jour 5 doit être effectuée sans insister sur les cellules différenciantes. Le temps d’incubation avec le réactif de dissociation cellulaire (étape 3,4) peut différer d’un lot à l’autre et doit être soigneusement estimé dans les expériences pilotes. Lors de l’incubation avec le réactif de dissociation cellulaire, toute la monocouche cellulaire se détache de la plaque. Ensuite, il doit être soigneusement dissocié par pipetage, comme décrit dans la section 3,4, pour préserver l’intégrité des cellules et pour éviter le stress mécanique, ce qui pourrait avoir un impact négatif sur le maintien de la culture cellulaire au-delà de D5. Enfin, nous avons remarqué que, après re-placage MNs adhérer mieux sur le plastique de culture tissulaire que le verre. Les lamelles en polymère garantissant une adhérence optimale des cellules et des propriétés optiques appropriées sont une bonne option pour les applications basées sur la microscopie.

Notre méthode représente une «programmation» directe des cellules pluripotentes dans un destin de MN, et ne récapitule pas les étapes intermédiaires par lesquelles les cellules embryonnaires acquièrent une identité de MN pendant le développement in vivo, tel que la spécification initiale à l’ectoderme neuronal et le long des axes dorso-ventral et Rostro-caudal. Par conséquent, il ne serait pas approprié de modéliser la spécification MN humaine in vitro pour étudier, par exemple, les mécanismes moléculaires sous-jacents à la différenciation. D’autre part, notre protocole permet de générer une quantité considérable de MNs spinales ou crânienne sans avoir besoin d’une purification supplémentaire. Prenant également en considération le degré de maturation atteint, cela représente un outil utile pour étudier la base moléculaire des maladies neurodégénératives du Neuron moteur. Au cours des dernières années, un nombre cohérent de lignées d’iPSC ayant des mutations pathogènes dans les gènes liés à la maladie des neurones moteurs a été produite par la communauté scientifique. Les collections de lignes iPSC «programmables» MN pourraient donc être facilement générées par l’intégration stable des modules NIL et NIP dans ces lignées mutantes iPSC. Nous pouvons envisager, comme une éventuelle application future de la méthode, la caractérisation des déterminants autonomes cellulaires qui confèrent une susceptibilité différente aux sous-types de MN individuels, en comparant les MNs crânienne et spinale côte à côte obtenues des IPSC avec le même fond génétique. En outre, la conversion efficace des IPSC en MNs dans des conditions de culture simplifiées nécessitant une manipulation minimale (c.-à-d. sans transition par des corps embryoïdes) et pouvant facilement être évolutive, pourrait grandement faciliter l’automatisation des médicaments à haut débit approches de dépistage des maladies des neurones moteurs. La modélisation in vitro des maladies neurodégénératives à déclenchement adulte peut être difficile en raison de la nature fœtale des neurones dérivés de l’iPSC14. Les stratégies précédentes conçues pour accélérer le vieillissement des MNs dérivées de la différenciation conventionnelle des IPSC, comme la surexpression de la progerine15, pourraient être combinées avec notre méthode pour obtenir de meilleurs modèles de maladies.

La méthode décrite ici, basée sur l’expression inductible des facteurs de transcription véhiculés par un vecteur piggyBac, peut être appliquée à d’autres types de cellules induites. Nous avons déjà montré que les cellules musculaires squelettiques peuvent être obtenues à partir des IPSC humains par l’expression de BAF60c et MyoD16. De même, nous pouvons envisager la possibilité d’étendre la méthode à d’autres types de cellules d’intérêt, y compris d’autres sous-types neuronaux et les astrocytes, par l’expression par piggyBac des ensembles appropriés de facteurs de programmation17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer

Acknowledgments

Les auteurs souhaitent remercier le centre d’imagerie de Center for Life nano science, Istituto Italiano di Tecnologia, pour son soutien et ses conseils techniques. Nous sommes reconnaissants aux membres du Center for Life nano science pour la discussion utile. Ce travail a été partiellement appuyé par une subvention d’AriSLA (subvention pilote 2016 «StressFUS») à l’AR.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics