Insan kaynaklı pluripotent kök hücrelerinin (iPSCs), PiggyBac vektörler kullanarak fonksiyonel spinal ve kranial motor nöronlara dönüşümü

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu protokol indüklenebilir piggyBac vektörler transkripsiyon faktörlerin ektopik ifade, bir spinal veya kranial kimlik ile motor nöronlar içine indüklenen pluripotent kök hücrelerinin hızlı ve verimli dönüşüm sağlar.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Burada insan indüklenen pluripotent kök hücrelerden fonksiyonel omurilik ve kraniyal motor nöronları elde etmek için bir yöntem tarif (ıpscs). Motor nöron içine doğrudan dönüşüm transkripsiyon faktörleri alternatif modüller ektopik ifade ile elde edilir, yani Ngn2, Isl1 ve Lhx3 (NIL) veya Ngn2, Isl1 ve Phox2a (NSIP). NIL ve NıP sırasıyla spinal ve kraniyal motor nöron kimliğini belirtir. Protokollerimiz, NIP 'nin bir piggybac transpozon vektörü ile genomda stabil entegre edildiği değiştirilmiş IPSC hatları ile başlar. Transgenlerin ifadesi daha sonra doksisiklin ve yol açar, 5 gün içinde, ıpscs MN progenitors dönüşümüne. Sonraki olgunlaşma, 7 gün boyunca, spinal veya kranial MNs homojen nüfusa yol açar. Bizim yöntemi önceki protokoller üzerinde çeşitli avantajları tutar: son derece hızlı ve Basitleştirilmiş; viral enfeksiyon veya daha fazla MN yalıtım gerektirmez; farklı MN alt kitleleri (omurilik ve kranial) olgunlaşma dikkat çekici bir derece ile Üreten sağlar, eylem potansiyelleri trenler yangın yeteneği tarafından gösterilmiştir. Dahası, çok sayıda motor nöronları karışık nüfus arıtmadan elde edilebilir. IPSC-türev spinal ve kraniyal motor nöronlar Amilotrofik lateral skleroz ve motor nöron diğer nörodejeneratif hastalıkların in vitro modelleme için kullanılabilir. Homojen motor nöron nüfus hücre tipi spesifik ilaç gösterimleri için önemli bir kaynak temsil edebilir.

Introduction

Motor nöron (MN) dejenerasyonu amilotrofik lateral skleroz (ALS) ve spinal kas atrofi (SMA) gibi insan hastalıklarında etken rol oynar. İnsan MN karmaşıklığı özetlemek uygun in vitro hücre modeli sistemleri kurulması yeni terapötik yaklaşımlar gelişimine yönelik önemli bir adımdır. Belirgin plurilineage farklılaşma özellikleri ile donatılmış olan indüklenen pluripotent kök hücreleri (ıpscs), şimdi motor nöron hastalıkları etkilenen hastaların bir dizi türetilmiştir1,2. MN hastalıklarına ilişkili patojen mutasyonları taşıyan ek IPSC hatları, kontrol "sağlıklı" pluripotent kök hücreleri3' ten başlayarak gen düzenleme ile üretilir. Bu çizgiler in vitro hastalık modelleme ve ilaç taraması için yararlı araçları temsil eder, MNs içine IPSC farklılaşma için uygun yöntemler mevcuttur sağlanır. Bu yöntemin gelişiminin arkasındaki mantık, MN hastalıklarıyla ilgilenen bilimsel toplumu, Olgun fonksiyonel MNs 'ye yol veren hızlı ve verimli bir farklılaşma protokolüyle sağlamaktayız. Bu yöntemin ilk avantajı, yürütme zaman dilimi olur. Güç başka bir ilgili noktası herhangi bir arıtma adım eliminasyon gelir. Son olarak, protokol motor nöronların iki farklı nüfus oluşturmak için kullanılabilir.

MNs farklı alt türleri oluşturma olasılığı MN hastalıkları modelleme için özellikle ilgilidir. Tüm MN alt türleri ALS ve SMA 'da eşit derecede savunmasız değildir ve farklı motor ünitelerinde semptomların başlangıcı prognozu büyük ölçüde etkiler. ALS 'de, üst ve alt ekstremitelerde başlayan semptomlarla spinal başlangıçlar yaklaşık 3-5 yıl içinde ölüme yol açar4. Tersine, kraniyal MNS dejenerasyonu ile başlayan bulber başlangıcı, en kötü prognoz vardır. Dahası, RNA-bağlayıcı proteinleri FUS ve TDP-43 mutasyonları olan hastalarda SOD1 mutasyonları5olan bireylere göre, bulber başlangıcı yüzdesi önemli ölçüde daha yüksektir. Alternatif MN farklılaşma protokollerinin neredeyse bütünlüğü, ipscs6,7,8türevlerini ayırt etmek için omurilik karakterini gösteren retinoik asit (ra) aktivitesine dayanır. Bu spesifik MN alt türlerinden9,10koruyucu olabilir içsel faktörler, eğitim olasılığını sınırlar.

Fare embriyonik kök hücrelerinde bir önceki çalışma ile tutarlı11, son zamanlarda ınsan ıpscs ektopik ifade Ngn2, Isl1 ve LHX3 (NIL) BIR spinal MN kimlik indükler göstermiştir, Ngn2 ve Isl1 artı Phox2a (n) kranial MNS12belirtin. Bu nedenle, 12 gün boyunca işlevsel özelliklere sahip insan MNs üretimini sağlayan etkili bir protokol geliştirdik. Bu yöntemin amacı, kısa bir zaman diliminde ve arıtma (örneğin, FACS) gerek kalmadan elde etmektir, hücre nüfusu yüksek spinal veya kranial kimlik ile MNs için zenginleştirilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Insan iPSCs 'nin Bakımı

  1. Matris kaplı plakaların hazırlanması
    1. Çözme bir 5 mL matris şişe (bkz. malzeme tablosu) 4 °c gece. Orijinal matris stokları farklı stok konsantrasyonlarda gelir ve plakaya veri sayfasında belirtilen seyreltme faktörü göre yapılır, bireysel lot için özel. Matrisin erken jelini önlemek için şişe ve tüpler buz soğuk tutmak önemlidir. Buz üzerinde önceden soğutulmuş cryotubes içinde plakaya içine matris dağıtma. Kullanılmayan plakaya-20 °c ' de dondur.
    2. Yaklaşık 2 h çözülmek için buzda bir kısım yerleştirin.
    3. 50 ml konik tüpte 20 ml soğuk dmem/F12 ile matrisin kısım seyreltmeli.
    4. İyi karıştırın ve 35 mm yemeklere (diğer yemeklerin yüzey alanı başına eşdeğer tutarlar) 1 mL seyreltilmiş matrisin dağıtımı yapın.
    5. Kaplama sağlamak için oda sıcaklığında 1 saat için seyreltilmiş matris içeren yemekleri tutun.
      Not: Parafilm ile mühürlenmiş yemekler, 2 haftaya kadar 4 °C ' de depolanabilir.
  2. Stok çözeltisi (20 ml) ve 1 adet yumuşak hücre dağılma reaktörünün çalışma plakaya hazırlanması (bkz. malzeme tablosu).
    1. PBS 'de 10 mg/mL 'ye toz eritin (CA2 +/mg2 + ücretsiz).
    2. 0,22 μm filtre membran ile filtre sterilize edilir.
    3. 20 plakaya (her biri 1 ml) hazırlayın ve-20 °c ' de saklayın.
    4. Kullanmadan önce, PBS 'de bir kısım seyreltin (CA2 +/mg2 + ücretsiz) 1 mg/ml (1x çalışma aliquots).
      Not: 1x çalışma plakaya 2 hafta kadar 4 °c ' de depolanabilir.
  3. İnsan IPhone 'ları geçmekle.
    1. Başlamadan önce: 4 °C ' de depolanırsa, 37 °C ' de kuluçsa ön sıcak matris kaplı plakalar 20-30 dk. oda sıcaklığında önceden sıcak insan iPSC orta miktarı (bkz. malzeme tablosu) gerekli. Ön sıcak DMEM/F12.
    2. Aspirate kültür ortamı.
    3. Ipscs 'yi PBS ile durulayın (CA2 +/mg2 + ücretsiz).
    4. 1x nazik ayrışma solüsyonu ekleyin (35 mm 'lik bir çanak için 0,5 ml). 37 °C ' de kolonilerin kenarları tabandan ayrılmaya başlayana kadar genellikle 3-5 dak.
    5. Yumuşak ayrışma çözümünü aspirate, IPSC kolonilerini ayırmamaya dikkat edin.
    6. Hücreleri dmem/F12 (35 mm çanak için 2 ml) ile yıkayın ve hücreleri ayırmak için dikkatli olmak Aspire. Bu adımı bir kez daha tekrarlayın.
    7. İnsan iPSC Orta (35 mm çanak için 1 mL) ekleyin.
    8. Kolonileri bir hücre kaldırıcısı ile yavaşça ayırın ve 15 mL tüpüne aktarın.
    9. Bir P1000 pipetör 3-4 kez ile yukarı ve aşağı pipetleme tarafından yavaşça hücre kümeleri kırmak.
    10. Matris kaplı plaka (ler) den süpernatant aspirate.
    11. İnsan iPSC orta uygun kültür hacmi hücreleri tohum. Bölünmüş oranı satırdan satıra değişebilir ve yaklaşık 1:4-1:8. Günlük orta değiştirin.

2. NIL ve NıP Indüklenebilir iPSC hatları üretimi

  1. Hücre transfeksiyon.
    1. Hücreleri PBS ile durulayın (CA2 +/mg2 + ücretsiz).
    2. Hücre ayrışma reaktif ekleyin (bkz. malzeme tablosu) (35 mm çanak Için 0,35 ml) ve tek hücreler ayrılıncaya kadar 37 °c ' de inkübasyon (5-10 dk).
    3. Bir P1000 pipetör 3-4 kez ile yukarı ve aşağı pipetleme ile yavaşça komple hücre ayrımı.
    4. 15 mL 'Lik bir tüpte toplayın ve PBS (CA2 +/mg2 + ücretsiz) ' ye 10 ml ekleyin. Hücreleri say.
    5. Pellet 106 hücreler ve pelletini içinde 100 μL tampon R (hücre Elektroporasyon kiti dahil, bkz. malzeme tablosu).
    6. Transfeksiyon için Plasmid DNA ekleyin: 4,5 μg transpoze vektörü (EPB-BSD-TT-NIL veya EPB-BSD-TT-NIP12) ve 0,5 μg piggybac transposase Plasmid13.
    7. Hücre Elektroporasyon sistemi ile transfect ( malzeme tablosunabakın) üreticinin talimatlarına göre ve daha önce aşağıdaki parametrelerle3 açıklanan: 1.200 V voltaj, 30 MS genişlik, 1 darbe. 10 μM Y-27632 ile tamamlayıcı insan IPSC orta hücreleri tohum (ROCK inhibitörü, malzeme tablosubkz) 6 mm matris kaplı çanak.
  2. Antibiyotikler ile seçim.
    1. Transfeksiyondan iki gün sonra kültür ortamına 5 μg/mL Blasticidin ekleyin.
    2. Transfürif olmayan hücrelerin çoğu 48 h 'de Blasticidin seçimi içinde ölecek. Genomda transgenler entegre değil hücreleri karşı-seçmek için en az 7-10 gün boyunca Blasticidin hücreleri tutun.
    3. Farklı sayıda transgenler ve farklı entegrasyon sitesi içeren hücrelerden oluşan karışık bir nüfus olarak stabil transfenli hücreleri koruyun veya tek klonları yalıtın.
    4. 1 μg/mL doksisiklin indüksiyonunda, Ngn2 için transgeni özgül astar ile RT-PCR tarafından, transgenlerin etkili bir ifade için kontrol etmek için ek bir çanak hazırlamak (Forward: TATGCACCTCACCTCCCCATAG; Ters: GAAGGGAGGAGGGCTCGACT), daha önce açıklanan12.
    5. Bu aşamada, insan iPSCs (bkz. malzeme tablosu) için donma ortamında NIP-ipsc hatlarının romanını dondur.

3. motor neuron farklılaşma

  1. Hücrelerin hücre kesilmesi reakajıyla açıklandığı gibi ayırmak (Steps 2.1.1.-2.1.3.). 15 mL tüp ve DMEM/F12 5 hacimiyle seyreltilmiş hücreleri toplayın. 10 μM kaya inhibitörü ile tamamlayıcı hücre ve insan ipsc orta pelletini Pellet. 62.500 hücreler/cm2yoğunluğu matris kaplı yemeklerle hücreler ve tohum saymak.
  2. Sonraki gün, DMEM/F12 ile orta değiştirin, 1x istikrarlı L-glutamin analog ile tamamlayıcı, 1x esansiyel olmayan amino asit (NEAA) hücre kültürü takviyesi ve 0.5 x penisilin/streptomisin, ve içeren 1 μg/mL doksisiklin. Bu farklılaşma gün 0 olarak kabul edilir. 1. gün, orta ve doksisiklin yenileyin.
  3. 2. gün, 5 μM DAPT, 4 μM SU5402 ve 1 μg/mL doksisiklin içeren (1x B27, 1x istikrarlı L-glutamin analog, 1x NEAA ve 0.5 x penisilin/streptomisin) olan Nörobasal Orta (neurobasal/B27) orta, orta değiştirmek (bkz . malzeme tablosu ). Her gün 5 kadar orta ve doksisiklin yenileyin.
  4. 5. gün: hücre ayrışma reaktif ile hücreler ayrışma (bkz. malzeme tablosu).
    1. Hücreleri PBS ile durulayın (CA2 +/mg2 + ücretsiz).
    2. Hücre ayrışma reakajının (35 mm 'lik bir çanak için 0,35 ml) ekleyin ve tüm hücre tek tabakalı çanak ayrılır kadar 37 °c ' de inkübasyon. Tek hücrelerin inkübasyon sırasında ayrılmaz unutmayın.
    3. 1 mL DMEM/F12 ekleyin ve hücreleri 15 mL 'Lik bir tüpte toplayın.
    4. Bir P1000 pipetör 10-15 kez ile yukarı ve aşağı pipetleme ile yavaşça komple hücre ayrımı.
    5. 4 mL DMEM/F12 ekleyin ve hücreleri saymak.
    6. Bu aşamada, üretici talimatlarına göre, hücre donma Orta ( malzeme tablosunabakın) motor nöron ataları dondurmak.
    7. Pellet hücreleri ve nöronal Orta içinde pelletini (nörobazal/B27 orta ile tamamlayıcı 20 ng/ml BDNF, 10 ng/ml GDNF ve 200 ng/ml L-askorbik asit, bkz: malzeme s tablosu) 10 μM kaya inhibitörü ile desteklenmektedir.
    8. Poly-ornitin/laminin üzerindeki hücreleri tohumlama-veya alternatif olarak matris kaplı desteklerin yoğunluğu 100.000 hücreler/cm2. İmmünostatik analiz için polimer lamel magazini (bkz. malzeme tablosu) ile μ-Slide plastik destekler kullanın.
  5. 6. gün, taze nöronal orta ROCK inhibitörü yoksun orta değiştirin. Sonraki günlerde, her 3 günde bir ortamın yarısını yenileyin. Kültür ortamı, yüzeyden dekolmanı önlemek için çok dikkatli bir şekilde değiştirilmelidir.

4. immünostam Analizi

  1. Hücre fikreme. Hücreleri PBS ile durulayın (CA2+/mg2 +ile) ve PBS 'de% 4 civarında formaldehite (CA2 +/mg2 +ile) Oda sıcaklığında 15 dakika boyunca inküye yapın.
    Dikkat: Paraformaldehyde zehirli ve kansere neden olduğundan şüpheleniliyor. Cilt ve gözler ile temasından kaçının ve kimyasal duman kaputu altında tutunuz.
  2. Oda sıcaklığında 5 dakika boyunca% 0,1 Triton X-100 içeren PBS (CA2 +/mg2 +ile) ile geçirgen.
  3. Antikor engelleme çözeltisi içinde oda sıcaklığında 30 dakika boyunca inküye (ABS:% 3 BSA, PBS 'de CA2 +/mg2 +ile).
  4. ABS: Anti-TUJ1 (1:1000; tavşan) ve anti-Oct4 (1:200; fare) veya anti-sohbet (Anti-Kolin asetiltransferaz; 1:150; keçi) Primer antikorlar ile Oda sıcaklığında 1 h için inküye. Bkz. malzeme tablosu.
  5. ABS 'de uygun eşek ikincil antikor çifti ile Oda sıcaklığında 45 dk için inküat: Anti-fare Alexa Fluor 647 (1:250), Anti-tavşan Alexa Fluor 594 (1:250) ve anti-keçi Alexa Fluor 488 (1:250). Bkz. malzeme tablosu.
  6. 0,4 μg/mL DAPı 'de 5 dakika boyunca oda sıcaklığında, çekirdekleri etiketlemek için inküye yapın.
  7. Floresan mikroskobun görüntülenmesi için hücreleri montaj Orta (bkz. malzeme tablosu) ile bağlayın.

5. yama ile fonksiyonel karakterizasyon-kelepçe kayıtlar

  1. HEPES hazırlamak-equilibrated dış solüsyon (NES) aşağıdaki gibi: 140 mM NaCl, 2,8 mM KCl, 2 mM CaCl2, 2 mm MgCl2, 10 mm HEPES, ve 10 mm glikoz. 290-300 MΩ arasında Osmolarite ayarlayın. 1N NaOH kullanarak 7,3 için pH ayarlayın ve çözümü 4 °C ' de saklayın.
  2. İç solüsyonu hazırlayın: 140 mM K-glukonat, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mm HEPES, 2 mm MG-ATP, 0,3 mm na-GTP. 1m Koh ile 7,3 için pH ayarlayın ve Osmolarite yaklaşık 290 MΩ ayarlanır kontrol edin. Çözümü-20 °C ' de küçük aliquots 'da dondurur.
  3. Deneyleri çalıştırmadan önce, NES çözümünü su banyosundan yaklaşık 28-30 °C ' ye önceden ısıtın.
  4. Bazı borosilikat mikropipetleri çekin (ID 0,86 mm; OD 1,5 mm) bir uç direnci taşıyan: 5-6 MΩ ve pipet tutucusuna monte etmeden önce hücre içi çözeltisi ile doldurun.
    Not: Tel yüzeyinde AgCl 'nin üniforma tabakası oluşturmak için en az 30 dakika boyunca kayıt elektrot ve referans elektrot su klorür Gümüş Teller unutmayın.
  5. Petri çanağını kayıt odasına aktarın ve 1-2 mL/dak 'da NES çözümüyle odasına bırakın. Solüsyonu sıcak tutmak için 30 °C sıcaklıkta bir satır içi ısıtıcıdan geçen akışa izin verin.
  6. Electrofizyoloji kayıt odasını dik mikroskop altında yerleştirin. Yama kelepçe amplifikatör ile membran akımları kaydedin ve uygun bir yazılım ile veri elde.
  7. Amplifikatör kontrol yazılımını açın ve 1 değeri ve 10 kHz 'de Bessel filtresinde sinyal kazanımı ayarlayın. Bessel filtresinin örnekleme frekansından 2,5 kat daha düşük olduğundan emin olun.
  8. Kayıt yazılımında gerilim kelepçe ve akım kelepçe denemeleri için deneysel protokolleri ayarlayın.
  9. Protokol ayarında, epizodik stimülasyon modunu işaretleyiniz ve örnekleme sıklığını 25 kHz olarak ayarlayın. Sonra, dalga formu sekmesine gidin ve gerilim veya geçerli adım genlik ve uzunluğu takip olarak yazın.
  10. Voltaj-Gated sodyum akımları için, 15 gerilim basamakları (50 MS süresi)-100 mV ila + 40 mV (10 mV artışı) kullanın. Yamalı hücreye atladıktan sonra protokol çalıştırın-60 mV amplifikatör üzerinden bir tutma potansiyeli. Benzer şekilde, voltaj-Gated potasyum akımları (250 MS süresi her)-30 mV ile + 50 mV (10 mV artışı)-40 mV kaydedilmiş hücre tutan voltaj basamakları ile uyarılır.
  11. IPSC-türetilmiş kranial ve spinal MNs, kelepçe hücreleri, geçerli kelepçe modunda, bir membran potansiyeli-70 mV ve kullanım 4 akım darbeleri (1 s süresi her) artan amplitüd (+ 20 pA + 80 pA; 20 pA artışı) ateş özelliklerini araştırmak için.
  12. Her hücre voltajı-aktif akımları için elde, uyarılmış ateş aktivitesi ve üç pasif özellikleri tüm hücre kapasitans (cm), hücre membran direnci (RM) ve Istirahat membran potansiyeli (RMP) olarak.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 1' de farklılaşma yönteminin şematik bir açıklaması gösterilir. İnsan ipscs (WT I Line3) EPB-BSD-TT-NIL veya EPB-BSD-TT-NIP ile transfekte edildi, oluşturulan, Blasticidin seçimi üzerine, istikrarlı ve indüklenebilir hücre hatları12, bundan sonra IPSC-NIL ve IPSC-NIP olarak anılacaktır, sırasıyla. Farklılaşan hücreler pluripotency Marker OCT4 ve Pan-neuronal Marker TUJ1 ifadesi için karakterize edildi. İmmünostik analizi, TUJ1 pozitifliği yokluğunda, 0 gün içinde tüm hücrelerde OCT4 uniform ifade gösterdi (Şekil 2A). 3. gün, OCT4-Positive hücrelerin sayısında güçlü bir azalma gözlemledik, ıpscs türevinin bir alt kümesinde TUJ1 ifadesiyle yansıtılmış (Şekil 2B). 5. gün, TUJ1 tutarlı bir ifade gösterdi ve nöronal bir morfoloji (Şekil 2C) elde nüfus, OCT4 hiçbir ifade gözlenen. Motor nöron progenatörler daha sonra Disosiye ve daha fazla olgunlaşma için yeniden kaplama. 7 gün (0 günden beri 12 gün) sonra, hücreler düzgün TUJ1 ve olgun motor nöron Marker CHAT (Şekil 3) ifade etti. Aynı kültür ve farklılaşma koşullarını (Tamamlayıcı Şekil S1 ve Tamamlayıcı Şekil S2) kullanarak, Iki ek ticari IPSC hatları (bkz. malzeme tablosu) ile benzer sonuçlar elde edilmiştir. Benzer şekilde, fare ESCs11' den Nil kaynaklı motor nöronları, NIP ile indüklenen ınsan ıPSCS hox transkripsiyon faktörleri düşük seviyeleri ifade ve retinoik asit ile Rostro-caudal ekseni boyunca desenli olabilir (Tamamlayıcı şekil S3 ).

Bu sonuçlar, 62.500 hücreler/cm2 ' nin farklılaşması başlangıcında ve 0 gün Içinde 1 μM Doksisiklin ile indüklenen zaman elde edilmiştir. Bu, hücrelerin belirgin toksisitesi olmadan transgenlerin maksimum indüksiyon elde etmek için en iyi doksisiklin konsantrasyonu sonuçlandı (Tamamlayıcı ŞEKIL S4A). 5. günde doksisiklin kaldırıldıktan sonra transgenlerin ifadesi susturuldu (Tamamlayıcı ŞEKIL S4B). Ayrıca, protokol bu noktada hücrelerin optimum yoğunluğunu kurmak için pilot deneyler gerçekleştirdik. Biz paralel farklılaşma deneylerinde Bu parametre değişen farklı sonuçlar sağladı fark ettik. 31.250 hücrelerine/cm2' ye indirilmiş ilk yoğunluğa göre, hücre morfolojisi gözlemleyerek değerlendirilerek farklılaşma görünüşte normaldir. Ancak, biz gün 5 (Bölüm 3,4) ve daha sonra olgunlaşma aşamasında azaltılmış vızınlama direnci fark ettik. Buna karşılık, hücrelerin ilk yoğunluğu 125.000 hücrelere yükseltildiğinde/cm2, biz verimsiz farklılaşma gözlenen, tipik nöron benzeri morfoloji satın eksikliği ile değerlendirildiği gibi. Bu, daha fazla arıtma (örneğin, FACS) gerekir MNs, sadece küçük bir kısmını içeren karma bir nüfus sonuçlandı. Bu nedenle, en iyi yoğunluk nörogen hücrelerin saf bir nüfus elde etmek için, iki aydan fazla kültürde hayatta mümkün, 62.500 hücre/cm2olduğunu kurduk.

Daha sonra kendi elektrofizyolojik özellikleri karakterize ederek IPSC NIL-türetilen Spinal motor nöronların fonksiyonel olgunlaşma değerlendirildi (Şekil 4), daha önce ıPSC NIP türetilen kranial motor nöronlar için bildirilen12. Yama kelepçe kayıtları, ya voltaj ve akım-kelepçe modalitesi, 7 gün MNs olgunlaşma adımının protokolünün gerçekleştirildi (bkz. Şekil 1; toplam ayrım süresi: 12 gün) (Şekil 4A). Bu süre içinde, IPSC NIL-türetilmiş motor nöronlar biraz daha düşük istirahat membran potansiyeli gösterdi (-30 ± 2 mV; n = 24) ve benzer bir hücre kapasitans değeri (+ 25 ± 2 pF; n = 25) daha önce bildirilen IPSC NıP türetilen MNs12ile karşılaştırıldığında. Daha sonra, farklılaşmış hücrelerin olgunlaşma derecesini daha derin karakterize etmek için, bir dizi voltaj darbeleri ile uyarıldığında sodyum ve potasyum akımlarını uyandırmak için yeteneklerini araştırdık. Bu deneylerde, IPSC NIL-türetilen nöronlar başarıyla voltaj bağımlı sodyum akımları (Şekil 4B) ve voltaja bağlı potasyum akımları (Şekil 4C), en yüksek amplitüd ulaşır − 20 mV ve + 50 mV yakın membran potansiyeli sırasıyla. Na+ ve K+için denge potansiyelleri, önceden bildirilen ekstrelüler ve hücre Içi çözümlerle Nernst denklemi (www.physiologyweb.com/Calculators/nernst_potential_calculator.html) kullanılarak hesaplanır, + 110 mV ve-102 mV sırasıyla edildi. Buna ek olarak, IPSC NIL-türetilen MNs% 80 geçerli kelepçe modalite içinde sıkıştırılır başak trenleri + 60 pA veya daha fazla (Şekil 4D) geçerli bir darbe ile enjekte ederken tetiklemek başardı. Kaydedilmiş hücrelerin% 50 ' den fazla olarak tekrarlayan ateş etmek için gereken minimum akım + 40 pA (18 hücreden 15 ' i; Şekil 4 E). Spike threshold-37,6 ± 0,8 MV ve ortalama ateşleme frekansı + 40 pA yaklaşık 7,9 ± 2,2 Hz idi (n = 18; Şekil 4 F).

Genel olarak, bu veriler, benzer şekilde daha önce bildirilen IPSC NIP türetilmiş kranial MNS12, IPSC-NIL-türeyen spinal MNS olgun nöronların tipik işlevsel özelliklere sahip olduğunu düşündürmektedir.

Figure 1
Şekil 1 : Motor nöron farklılaşma protokolü. Şekil, metin içinde bildirilen fonksiyonel analizin zaman noktasına piggyBac vektörler ile istikrarlı IPSC hatları nesil farklılaşma protokolünün bir şematik temsili gösterir. Protokolün farklı adımlarında hücrelerin temsili faz kontrast görüntüleri gösterilir. Ölçek çubukları = 50 μm. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2 : Farklılaşan hücrelerin temsili immünostasyon analizi. IPSC-NIL ve IPSC-NıP hücreleri, pluripotency Marker OCT4 (mor) ve Pan-neuronal Marker TUJ1 (kırmızı) gün 0 (A), gün 3 (B) ve gün 5 (C) ifadesi için immünostasyon tarafından analiz edildi. Nuclei DAPı ile karşı koyanmış. Konfokal görüntüler lazer tarama konfokit mikroskop ( malzeme tablosu) Ile 20X na 0,75 objektif zoom 2x, 1024 x 1024 piksel, ile donatılmış kullanarak satın alındı 405 nm, 473 nm, 559 nm ve 635 nm lazerler. DAPı, Alexa Fluor 594 ve Alexa Fluor 647 için filtre ayarı kullanıldı. Ölçek çubukları = 50 μm. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 3
Şekil 3 : IPSC türev motor nöronların temsili immünostoz analizi. IPSC-NIL ve IPSC-NıP hücreleri Pan-nöronal Marker TUJ1 (kırmızı) ve motor nöron Marker CHAT (Kolin asetiltransferaz; yeşil) günde 12 ifade için immünostasyon tarafından analiz edildi. Nuclei DAPı ile karşı koyanmış. Konfoksel görüntüler Şekil 2 efsanesinde açıklandığı şekilde edinilmiş. Ölçek çubukları = 50 μm. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 4
Şekil 4 : Spinal ve kranial motor nöronların fonksiyonel analizi. (A) parlak alan görüntü tüm hücre yama kelepçe ıPSC NIL-türetilen Spinal motor nöron. (B) bir dizi artan voltaj adımına yanıt olarak ıPSC NIL-türetilen MNS 'de kaydedilen na+ akım Için temsilci ı/V eğrisi (n = 26; tutma potansiyeli-60 mV 'ye eşit). (C) artan voltaj adımlarının bir dizi yanıt olarak ıPSC NIL-türetilen MNS kaydedilmiş K+ Için temsilci ı/V eğrisi (n = 23; tutma olası eşit-40 MV). (D) eylem potansiyelleri bir tren temsilcisi iz 1 s kalıcı akım enjeksiyon yanıt olarak uyarılmış + 60 PA. (E) her geçerli darbenin eylem potansiyelini gösteren ıPSC NIL-türetilen MNS yüzdesini temsil eden histogram (n = 18). (F) histogram, her akım nabzında (n = 18) uyarılmış ateş sıklığını görüntüler. Elektrofizyolojik kayıt, dik mikroskop altında yapılmıştır. Membran akımları kayıt sistemi malzeme tablosunda belirtilir. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Supplementary Figure 1
Tamamlayıcı Şekil S1: Episomal hiPSCs kullanarak MN farklılaşma. (A) Brightfield Episomal HIPSC-NIL (sol) ve Episomal HIPSC-NIP (sağda) farklılaşan görüntüler belirtilen zaman noktalarında. Ölçek çubukları = 50 μm. (B) Episomal HIPSC-NIL (üst) ve Episomal HIPSC-NIP (Bottom) hücrelerinde gerçek zamanlı QRT-PCR farklılaşarak belirtilen işaretçilerin ifadesinin analizi. Her işaret için, en yüksek ifadeye sahip zaman noktası Kalibratör örneği olarak kullanılmıştır. ISL1 için kullanılan astar endojen geni için özeldir. (C) farklılaşan (gün 6) Episomal HIPSC-NIL (sol) ve Episomal HIPSC-NIP (sağ) hücrelerde Pan-NEURONAL Marker TUJ1 (kırmızı) ve KRANIYAL MN Marker PHOX2B (yeşil) için immünostasyon. Nükleler DAPı ile karşı koyanmış. Tüm paneller için ölçek çubuğu: 50 μm. (D) gerçek zamanlı QRT-PCR Ile Episomal HIPSC-NIL (üst) ve Episomal HIPSC-NIP (Bottom) hücrelerini AYıRT etmek HB9 ve PHOX2B ifadesinin analizi. 0. gün Kalibratör örneği olarak kullanıldı. PCR astar ve yöntemleri de Santis ve ark., 201812. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Supplementary Figure 2
Tamamlayıcı Şekil S2: DS2U iPSCs kullanarak MN farklılaşma. (A) BRIGHTFIELD DS2U-NIL (sol) ve DS2U-NIP (sağ) belirtilen zaman noktalarıyla farklılaşan görüntüler. Ölçek çubukları = 50 μm. (B) gerçek zamanlı QRT-PCR ile DS2U-NIL (üst) ve DS2U-NIP (Bottom) hücrelerinde ayrım yapan belirtilen işaretçilerin ifadesinin analizi. Her marker için en yüksek ifadeye sahip zaman noktası Kalibratör örneği olarak kullanılmıştır. ISL1 için kullanılan astar endojen geni için özeldir. (C) farklılaşılmış (gün 6) DS2U-NIL (sol) ve DS2U-NIP (sağ) hücrelerde Pan-NEURONAL Marker TUJ1 (kırmızı) ve KRANIAL MN Marker PHOX2B (yeşil) için immünostasyon. Nükleler DAPı ile karşı koyanmış. Ölçek çubukları = 50 μm. (D) gerçek zamanlı QRT-PCR ile DS2U-NIL (üst) ve DS2U-NIP (Bottom) hücrelerini AYıRT etmek HB9 ve PHOX2B ifadesinin analizi. 0. gün Kalibratör örneği olarak kullanıldı. PCR astar ve yöntemleri de Santis ve ark., 201812. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Supplementary Figure 3
Tamamlayıcı şekil S3: HOX gen ifadesi. (A) dört farklı hox genler (hox a2, hox B1, HOX a4, hox B5) ifadesinin analizi, 5 gün sonra IPSC-Nil ve ıPSC-NIL + ra hücrelerinin gerçek zamanlı QRT-PCR ile farklılaşması. 0 gün içinde ıPSC-NIL Kalibratör örneği olarak kullanılmıştır. (B) dört farklı hox GENLER (hox a2, hox B1, HOX a4, hox B5) ifadesinin analizi, 5 gün sonra IPSC-NIP ve ıPSC-NIP + ra hücrelerinin gerçek zamanlı QRT-PCR ile farklılaşması. 0 gün içinde ıPSC-NıP Kalibratör örneği olarak kullanılmıştır. (C) PCR astar çiftleri. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Supplementary Figure 4
Tamamlayıcı şekil S4: doksisiklin indüksiyon analizi. (A) gerçek zamanlı olarak analiz QRT-PCR ıSC-NIL (üst) ve ıPSC-NIP (alt) hücrelerde eksojen Ngn2 ifade (altta) tedavi edilmemiş veya kültür 24 saat farklı konsantrasyonda doksisiklin varlığı (0,5 μm, 1,0 μm, 2,0 μM). Ngn2, eksojen fare geni için spesifik astar ile incelenmiştir. Bir denetim olarak analizinde NıP ve n yapıları, yoksun ebeveyn IPSC hattı dahil edilmiştir. IPSC-NIL ve IPSC-NıP içindeki transgenlerin ifadesi doksisiklin yokluğunda ihmalkarlık oldu. 0 gün içinde IPSC-NIL ve IPSC-NıP Kalibratör örnekleri olarak kullanılmıştır. (B) ıSC-NIL (sol) ve ıPSC-NIP (sağ) hücrelerinde protokolün belirtilen zaman noktalarında ayrıştırılması içinde Exojen Ngn2 ifadesinin gerçek zamanlı QRT-PCR tarafından analizi. Ngn2, eksojen fare geni için spesifik astar ile incelenmiştir. 0 gün içinde IPSC-NIL ve IPSC-NıP Kalibratör örnekleri olarak kullanılmıştır. PCR astar ve yöntemleri de Santis ve ark., 201812. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu protokol, insan ıpscs 'yi, kemiğe özel transkripsiyon faktörlerinin ektopik ifadesi sayesinde Spinal ve kranial motor nöronlara verimli bir şekilde dönüştürmeyi sağlar. Bu transgenler, doksisiklin ile indüklenebilir ve piggyBac transposon tabanlı vektörü sayesinde genomda stabil bir şekilde entegre edilir. Karma bir nüfusa göre, piggyBac vektörünün bir veya birkaç kopyası, tek hücrelerin genomuna rasgele entegre edilecek ve genom bütünlüğü değişimi riskini arttırır. Dahası, iPSC subklonların Progressive seçimi zaman içinde, farklılaşma için olası sonuçlar ve hastalığın karşılaştırmalı analizi ve kontrol hücresi hatları ile ortaya çıkabilir. Tamamen, bu protokol ile elde edilen IPSC-türetilen MNs rejeneratif tıp için uygun olmayacaktır. Ancak, bizim yöntem özellikle in vitro motor nöron hastalığı modelleme için yararlı olabilir. Büyük güç noktaları son derece basitleştirilmiş kültür koşulları, MN dönüşüm hız, IPSC-türetilen MNs olgunlaşma yüksek derece ve olasılığı daha önce gösterdiği gibi, spinal ve kranial MNs hem elde etmek tarafından temsil edilir Özel Marker genler ifade analizi12. Protokolün sağlamlığı, yeniden üretilebilirliği ile gösterilmiştir. Şu ana kadar bu protokolü spinal ve/veya kranial MN üretimi için 30 katına kadar başarıyla uyguladım, sonuçları Marker ve/veya fonksiyonel analizlerle değerlendiriyoruz. Motor nöron kültürlerini başarılı bir şekilde azalmadan iki aya kadar başarıyla sürdürmüştür. Dahası, bir kez stabil dönüştürücü IPSC hattı elde edilmiştir, her deney yeni transfeksiyon gerek kalmadan doksisiklin indüksiyon tarafından başlatılabilir. Viral vektörler de gerekli değildir. Burada sunulan temsili sonuçlar, cihazlar tablosundabelirtilen hücre Elektroporasyon sistemi ile ıpscs electroporating tarafından elde edilmiştir. Ancak, diğer Elektroporasyon yöntemleri alternatif seçenekleri temsil edebilir. Bunun tersine, deneyimimizde, lipofeksiyon bazlı transfeksiyon sistemleri pluripotent kök hücreleri için iyi bir seçenek değildir12. Sürecin sonunda elde edilen hücre nüfusu, daha fazla arıtma ihtiyacını kaçınarak (örneğin, FACS), neredeyse sadece MNs oluşur. Daha önce12gösterdi, protokol 90% TUJ1-pozitif hücreler elde sağlar, hangi 95% burada da PHOX2B NIP türetilen kültürlerde pozitif.

Biz doğru dikkate alınması gereken bazı kritik noktaları düşünebiliriz. İlk olarak, iPSCs ilk nüfusun kalitesi MNs içine homojen ve tutarlı dönüşüm sağlamak için çok önemlidir. farklılaşma önemli bir kısmını içeren kültürler (% 5-10 ' den fazla) önlenmelidir. Değişken olmayan ıpscs için bakım ortamı olarak malzeme tablosunda açıklanan insan iPSC ortamını kullanarak Protokolü kurdık. Mevcut iş bu noktada deneysel olarak ele değil rağmen diğer ticari tanımlı medya, geçerli alternatif seçenekleri temsil edebilir. Medya bileşimi başlangıç hücresi popülasyonunun proliferasyon oranını etkileyebilecek olduğundan, protokolün diğer bakım ortamına adaptasyonu 0 gün içinde ilk yoğunluğun optimizasyonu gerektirebilir. Transfeksiyondan sonra, stabil hücre hatları elde etmek için hücreleri en az 2 hafta boyunca antibiyotik seçimi altında tutmak önemlidir. Bazı uygulamaların, transgen ifadesinin düzeyleri ve entegrasyon sitelerinin daha iyi bir kontrolü açısından daha homojen bir nüfus elde etmek amacıyla, piggyBac entegrasyonu sonrasında klonal çizgiler türetilmesi için uygun olabilir. Hücre yoğunluğu 0 gün, orta doksisiklin ek zaman, önemli bir parametresidir. Temsili sonuçlar bölümünde belirtildiği gibi, yeniden üretilebilirliği sağlamak için optimum hücre yoğunluğunu tahmin ettik. Biz diğer pluripotent kök hücre hatları farklı ilk yoğunluğu gerektirebilir dışlayamaz, hangi ampirik pilot deneylerde belirlenmelidir, çoğaltma oranı önemli ölçüde ayrı satır arasında değişebilir gibi. Doksisiklin İndüksiyon (Bölüm 3,3) bu yana 48 h sonrası Nörobasal/B27 orta geçiş gerçekleşmesi gerekir: diferansiyel DMEM/F12 ortamında 2 bütün gün boyunca tutulmazsa farklılaşma daha yavaş ve daha az verimli olabilir. 5. günde ayrımlama hücreleri vurgulmadan yapılmalıdır. Hücre dağılma reakajıyla birlikte inkübasyon süresi (adım 3,4) toplu iş arasında farklılık gösterebilir ve pilot deneylerinde dikkatle tahmin edilmelidir. Hücre dağılma reaktasyonu ile kuluçke üzerine, tüm hücre tek tabakalı plaka ayırır. Daha sonra, 3,4 bölümünde açıklandığı gibi, hücre bütünlüğünü korumak ve mekanik stres önlemek için, bu D5 ötesinde hücre kültürünün bakımı üzerinde olumsuz bir etkiye sahip olabilir pipetleme ile dikkatle Disosiye olmalıdır. Son olarak, yeniden kaplama MNs cam daha doku kültürü plastik daha iyi uyduktan sonra fark ettik. Optimum hücre uyumu ve uygun optik özellikleri sağlayan Polimer kapaklarının mikroskopi tabanlı uygulamalar için iyi bir seçenektir.

Bizim yöntemi bir MN kaderi içine pluripotent hücrelerin doğrudan "programlama" temsil eder ve hangi embriyonik hücreler içinde vivo geliştirme sırasında bir MN kimliği elde ara adımları özetlemek değil, örneğin sinir ektoderm için ilk belirtimi ve Dorso-ventral ve Rostro-caudal eksenleri boyunca desen. Bu nedenle, örneğin, farklılaşma altta yatan moleküler mekanizmalar, çalışmak için vitro insan MN belirtimi modeli için uygun olmayacaktır. Öte yandan, bizim protokol daha fazla arıtma gerek kalmadan spinal veya kranial MNs önemli miktarda üretme sağlar. Elde olgunlaşma derecesi de dikkate alınarak, bu motor nöron nörodejeneratif hastalıkların moleküler temelinde eğitim için yararlı bir araç temsil eder. Motor nöron hastalığı ile ilgili genlerde patojen mutasyonlar içeren tutarlı bir IPSC hattı sayısı, son yıllarda bilimsel toplum tarafından üretilmektedir. MN "programlanabilir" IPSC hatları koleksiyonları bu nedenle kolayca bu mutant IPSC hatları içinde NıP modülleri ve sabit entegrasyon tarafından oluşturulabilir. İPSCs 'den elde edilen yan yana kranial ve omurilik MNs karşılaştırması yaparak, yöntemin olası bir gelecekteki uygulaması olarak, bireysel MN alt türlerine farklı duyarlılık sağlayan hücre-otonom determinantların karakterizasyonu olarak varsayabiliriz. aynı genetik arka plan. Dahası, minimal manipülasyon (yani, embriyoid organları ile geçiş olmadan) ve kolayca ölçeklenebilir gereken Basitleştirilmiş kültür koşullarında MNs içine ıpscs etkili dönüşüm, büyük ölçüde otomatik yüksek verim ilaç kolaylaştırabilir motor nöron hastalıkları için tarama yaklaşımlar. In vitro modelleme erişkin-başlangıçlı nörodejeneratif hastalıkların foetal benzeri doğası nedeniyle zor olabilir IPSC-türetilen nöronlar14. Önceki Stratejiler, progerin ekspresyonu15gibi ipscs 'nin geleneksel farklılaşması ile türetilen MNS 'in yaşlanmayı hızlandırmak için geliştirildi, daha iyi hastalık modelleri elde etmek için yöntemimiz ile kombine edilebilir.

Burada açıklanan yöntem, bir piggyBac vektörü tarafından aracılı transkripsiyon faktörlerinin indüklenebilir ifadesine dayanarak, diğer indüklenen hücre türlerine uygulanabilir. Daha önce iskelet kas hücrelerinin BAF60c ve MyoD16ifadesiyle ınsan ipscs 'den elde edilebilir olduğunu gösterdik. Benzer şekilde, diğer nöronal alt türler ve astrositler de dahil olmak üzere diğer hücre türleri için yöntemi genişletmek için olasılığı hayal, programlama faktörleri uygun setleri piggybac-aracılı ifade tarafından17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar açıklamak için hiçbir şey var

Acknowledgments

Yazarlar, destek ve teknik tavsiyeler için Life nano Science, Istituto Italiano di Tecnologia Center 'da Imaging tesisine teşekkür etmek istiyor. Biz yararlı tartışma için yaşam nano bilim merkezi üyelerine minnettarız. Bu çalışmanın kısmen AriSLA (pilot Grant 2016 "StressFUS") dan AR için bir hibe tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics