Omdannelse af humane induceret pluripotente stamceller (iPSCs) til funktionel spinal og kraniel motor neuroner brug PiggyBac vektorer

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokol giver mulighed for hurtig og effektiv omdannelse af inducerede pluripotente stamceller til motoriske neuroner med en spinal eller kranie identitet, ved Ektopisk udtryk af transkription faktorer fra inducerble piggybac vektorer.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi beskriver her en metode til at opnå funktionelle spinal og kraniel motoriske neuroner fra menneskeskabte pluripotente stamceller (iPSCs). Direkte omdannelse til motor neuron er opnået ved Ektopisk udtryk af alternative moduler af transkription faktorer, nemlig Ngn2, Isl1 og Lhx3 (NIL) eller Ngn2, Isl1 og Phox2a (NIP). NIL og NIP specificere henholdsvis spinal og kraniel motoriske neuron identitet. Vores protokol starter med dannelsen af modificerede iPSC linjer, hvor NIL eller NIP er stabilt integreret i genomet via en piggyBac transposon vektor. Ekspressionen af transgener induceres derefter af doxycyclin og fører i 5 dage til omdannelsen af iPSCs til MN-progenitorer. Efterfølgende modning, i 7 dage, fører til homogene populationer af spinal eller craniale MNs. Vores metode rummer flere fordele i forhold til tidligere protokoller: den er ekstremt hurtig og forenklet; Det kræver ikke virus infektion eller yderligere MN-isolation. Det gør det muligt at generere forskellige MN subpopulationer (spinal og Cranial) med en bemærkelsesværdig grad af modning, som påvist ved evnen til at brand tog af action potentialer. Desuden kan et stort antal motoriske neuroner opnås uden rensning fra blandede populationer. iPSC-afledte spinal og kraniel motor neuroner kan bruges til in vitro modellering af amyotrofisk lateral sklerose og andre neurodegenerative sygdomme i motor neuron. Homogene motoriske neuron populationer kan repræsentere en vigtig ressource for celletype specifikke Drug screeninger.

Introduction

Motorisk neuron (MN) degeneration spiller en årsagssammenhæng rolle i menneskelige sygdomme som Amyotrofisk lateral sklerose (ALS) og spinal muskuløs atrofi (SMA). Etablering af egnede in vitro-celle modelsystemer, der oversigter kompleksiteten af det menneskelige MN, er et vigtigt skridt i retning af udvikling af nye terapeutiske tilgange. Induceret pluripotente stamceller (ipscs), som er udstyret med bemærkelsesværdige plurilineage differentiering egenskaber, er nu blevet afledt af en række patienter ramt af motoriske neuron sygdomme1,2. Yderligere iPSC linjer transporterer patogene mutationer forbundet til MN sygdomme er blevet genereret af genredigering, begyndende fra kontrol "sund" pluripotente stamceller3. Disse linjer repræsenterer nyttige værktøjer til in vitro-sygdoms modellering og lægemiddel screening, forudsat at der findes passende metoder til differentiering af iPSC i MNs. Rationalet bag udviklingen af denne metode er at give forskersamfundet, der er interesseret i MN-sygdomme, en hurtig og effektiv differentierings protokol, der giver anledning til modne funktionelle MNs. Den første fordel ved denne metode er dens tidsramme for udførelse. Et andet relevant punkt af styrke kommer fra fjernelsen af ethvert rensningstrin. Endelig kan protokollen bruges til at generere to forskellige populationer af motoriske neuroner.

Muligheden for at generere forskellige undertyper af MNs er særlig relevant for modellering af MN-sygdomme. Ikke alle MN-undertyper er lige så sårbare i ALS og SMA, og symptomdebut i forskellige motor enheder påvirker i høj grad prognosen. I ALS, spinal debut med symptomer, der starter i øvre og nedre lemmer fører til døden i omkring 3-5 år4. Omvendt, bulbar debut, begyndende med degeneration af kranielle MNs, har en værste prognose. Desuden er andelen af bulbar debut signifikant højere hos patienter med mutationer i RNA-bindende proteiner FUS og TDP-43 end hos personer med SOD1 mutationer5. Næsten alle alternative MN-differentierings protokoller er baseret på aktiviteten af retinoinsyre (RA), som giver en spinal karakter til at differentiere ipscs6,7,8. Dette begrænser muligheden for at studere iboende faktorer, som kan være beskyttende i specifikke MN undertyper9,10.

I overensstemmelse med en tidligere arbejde i mus embryonale stamceller11, har vi for nylig vist, at i human ipscs ektopic udtryk for Ngn2, Isl1 og Lhx3 (Nil) inducerer en spinal MN identitet, mens Ngn2 og Isl1 plus Phox2a (NIP) angive kranie mns12. Vi har derfor udviklet en effektiv protokol, der fører til produktion af menneskelige MNs udstyret med funktionelle egenskaber i en 12 dages turnaround. Formålet med denne metode er at opnå, inden for en kort tidsramme og uden behov for rensning (f. eks. ved FACS), cellepopulationer stærkt beriget for MNs med spinal eller kraniel identitet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. vedligeholdelse af humane iPSCs

  1. Fremstilling af matrix belagte plader
    1. Tø et 5 mL hætteglas med matrix (Se tabel over materialer) ved 4 °c om natten. De oprindelige matrixer stammer fra forskellige Stam koncentrationer, og der laves aliquoter i overensstemmelse med den fortyndingsfaktor, der er angivet på dataarket, specifikt for det enkelte parti. Det er vigtigt at holde hætteglasset og rørene iskold for at forhindre for tidlig gelerings af matricen. Der skal dispenseres i aliquoter i forkølede kryorør på is. Frys ubrugte aliquoter ved-20 °C.
    2. Anbring en alikvot is i ca. 2 timer for at tø.
    3. Den alikvote matrix fortyndes med 20 mL kold DMEM/F12 i et 50 mL konisk rør.
    4. Bland godt og dispenserer 1 mL fortyndet matrix i 35 mm retter (tilsvarende mængder pr. overfladeareal af andre retter).
    5. Opbevar retterne, der indeholder fortyndet matrix, i 1 time ved stuetemperatur for at tillade belægning.
      Bemærk: Tallerkener, forseglet med parafilm, kan opbevares ved 4 °C i op til 2 uger.
  2. Fremstilling af stamopløsningen (20 ml) og 1x arbejds aliquoter af det blide celle dissociations reagens (Se tabel over materialer).
    1. Pulveret opløses til 10 mg/mL i PBS (ca.2 +/mg2 + gratis).
    2. Filteret steriliseres gennem en 0,22 μm filter membran.
    3. Der tilberedes 20 aliquoter (1 mL hver) og opbevares ved-20 °C.
    4. Før brug fortyndes en alikvot PBS (ca.2 +/mg2 + gratis) til 1 mg/ml (1x Working Aliquots).
      Bemærk: 1x arbejds aliquoter kan opbevares ved 4 °c i op til 2 uger.
  3. Passage af menneskelige iPSCs.
    1. Før start: Hvis det opbevares ved 4 °C, skal de præ-varme matrix belagte plader i inkubatoren ved 37 °C i 20-30 min. pre-Warm ved stuetemperatur mængden af human iPSC medium (Se tabel over materialer) behov. Forvarm DMEM/F12.
    2. Aspirer kulturmedium.
    3. Skyl iPSCs med PBS (ca.2 +/mg2 + gratis).
    4. Tilsæt 1x blid dissociations opløsning (0,5 mL til en 35 mm skål). Der inkubieres ved 37 °C, indtil Koloniernes kanter begynder at løsne sig fra pladen, normalt 3-5 min.
    5. Aspirer den blide dissociations opløsning, og pas på ikke at løsne iPSC-kolonier.
    6. Vask cellerne med DMEM/F12 (2 mL for en 35 mm skål) og Aspirer til at passe på ikke at løsne cellerne. Gentag dette trin en gang til.
    7. Der tilsættes humant iPSC-medium (1 mL til en 35 mm skål).
    8. Løsnes forsigtigt kolonierne med en celle løfter og overføres til et 15 mL rør.
    9. Bryd forsigtigt celle klumper ved at pipette op og ned med en P1000 pipette 3-4 gange.
    10. Supernatanten aspirerer fra den (de) Matrix belagte plade (r).
    11. Frø cellerne i den relevante kultur volumen af human iPSC medium. Split ratio kan variere fra linje til linje og er omkring 1:4-1:8. Skift mediet dagligt.

2. produktion af NIL og NIP Inducible iPSC Lines

  1. Celle transfection.
    1. Skyl cellerne med PBS (ca2 +/mg2 + gratis).
    2. Tilsæt celle dissociations reagens (Se tabel over materialer) (0,35 ml for en 35 mm skål), og inkubere ved 37 °c, indtil enkelt cellerne adskilles (5-10 min).
    3. Komplet celle adskillelse forsigtigt ved pipettering op og ned med en P1000 pipette 3-4 gange.
    4. Opsamles i et 15 mL rør og tilsæt PBS (ca2 +/mg2 + gratis) til 10 ml. Tæl cellerne.
    5. Pellet 106 celler og resuspension i 100 μl af buffer R (inkluderet i celle elektroporationssættet, se tabel over materialer).
    6. Tilsæt plasmid-DNA til transfection: 4,5 μg føres vektor (EPB-BSD-TT-Nil eller EPB-BSD-TT-NIP12) og 0,5 μg af piggybac transposase plasmid13.
    7. Transfect med celle elektroporation system (Se tabel over materialer) i henhold til producentens anvisninger og som tidligere beskrevet3 med følgende parametre: 1.200 V spænding, 30 MS bredde, 1 puls. Frø cellerne i human iPSC medium suppleret med 10 μM Y-27632 (ROCK-hæmmer, se tabel over materialer) i en 6 mm matrix belagt skål.
  2. Udvælgelse med antibiotika.
    1. To dage efter transfection tilsættes 5 μg/mL blasticidin til dyrkningsmediet.
    2. De fleste af de ikke-transfected celler vil dø inden for 48 h af blasticidin udvælgelse. Opbevar cellerne i blasticidin i mindst 7-10 dage for at modvælge de celler, der ikke har integreret transgener i genomet.
    3. Vedligeholde stabilt transficeret celler som en blandet population, der består af celler med forskellige antal transgener og forskellige integrations steder, eller isolere enkelte kloner.
    4. Der tilberedes en ekstra skål til at kontrollere, om transgener er effektivt udtryk ved 1 μg/mL doxycyclininduktion, ved RT-PCR med transgen-specifikke primere til Ngn2 (fremad: TATGCACCTCACCTCCCCATAG; Bagside: GAAGGGAGGAGGGCTCGACT), som tidligere beskrevet12.
    5. På nuværende tidspunkt fryselagre af nye NIL-og NIP-iPSC linjer i fryse medium for human iPSCs (Se tabel over materialer).

3. motorisk neuron differentiering

  1. Dissocierer cellerne med celle dissociations reagens som beskrevet (trin 2.1.1.-2.1.3.). Saml dissocierede celler i et 15 mL rør og fortyndes med 5 bind af DMEM/F12. Pellet cellerne og resuspension i human iPSC medium suppleret med 10 μM ROCK-hæmmer. Tæl cellerne og frøene på matrix belagte retter med en densitet på 62.500 celler/cm2.
  2. Dagen efter udskiftes mediet med DMEM/F12, suppleret med 1x stabil L-glutamin analog, 1x ikke-essentiel aminosyre (NEAA) cellekultur supplement og 0,5 x penicillin/streptomycin, og indeholder 1 μg/mL doxycyclin. Dette betragtes som dag 0 af differentiering. På dag 1 skal du opdatere mediet og doxycyclilin.
  3. På dag 2, ændre medium til Neurobasal/B27 medium (Neuro basal medium suppleret med 1x B27, 1x stabil L-glutamin analog, 1x NEAA og 0,5 x penicillin/streptomycin), der indeholder 5 μM DAPT, 4 μM SU5402 og 1 μg/mL doxycyclin (Se tabel over materialer ). Opdater medium og doxycyclin hver dag indtil dag 5.
  4. Dag 5: celler afkobling med celle afkobling reagens (Se tabel over materialer).
    1. Skyl cellerne med PBS (ca2 +/mg2 + gratis).
    2. Tilsæt celle dissociations reagens (0,35 ml til en 35 mm skål), og inkubere ved 37 °c, indtil hele cellen enkeltlags adskilles fra skålen. Bemærk, at enkelte celler ikke vil blive adskilt under inkubationen.
    3. Der tilsættes 1 mL DMEM/F12, og cellerne opsamles i et 15 mL rør.
    4. Komplet celle adskillelse forsigtigt ved pipettering op og ned med en P1000 pipette 10-15 gange.
    5. Tilsæt 4 mL DMEM/F12, og Tæl cellerne.
    6. På dette stadium, fryse motor neuron forfædre i celle frysning medium (Se tabel over materialer), ifølge producentens anvisninger.
    7. Pellet cellerne og resuspension i neuronal medium (Neuro basal/B27 medium suppleret med 20 ng/mL BDNF, 10 ng/mL GDNF og 200 ng/mL L-ascorbinsyre, se tabel over materiales) suppleret med 10 μM rock hæmmer.
    8. Frø cellerne på poly-ornithin/Laminin-eller alternativt på matrix belagt understøtninger ved tætheden af 100.000 celler/cm2. Brug μ-slide plastik understøtninger med polymer dækglas (Se tabel over materialer) til immunofarvning analyse.
  5. På dag 6, ændre medium med frisk neuronal medium blottet for ROCK-hæmmer. På de næste dage, opdatere halvdelen af mediet hver 3 dage. Kulturmedium skal ændres meget omhyggeligt for at forhindre løsrivelse fra overfladen.

4. immunofarvnings analyse

  1. Celle fiksering. Skyl cellerne med PBS (med ca2 +/mg2 +) og inkube i 15 min i 4% PARAFORMALDEHYD i PBS (med ca2 +/mg2 +) ved stuetemperatur.
    Forsigtig: PARAFORMALDEHYD er giftigt og mistænkes for at fremkalde kræft. Undgå kontakt med hud og øjne og håndtag under en kemisk røg hætte.
  2. Permeabilize med PBS (med ca2 +/mg2 +) indeholdende 0,1% Triton X-100 i 5 minutter ved stuetemperatur.
  3. Inkubere i 30 minutter ved stuetemperatur i antistof blokerende opløsning (ABS: 3% BSA i PBS med ca2 +/mg2 +).
  4. Inkubere i 1 time ved stuetemperatur med primære antistoffer i ABS: anti-TUJ1 (1:1000; kanin) og anti-Oct4 (1:200; mus) eller anti-CHAT (anti-cholin acetyltransferase; 1:150; ged). Se tabel over materialer.
  5. Inkubere i 45 min ved stuetemperatur med passende æsel sekundære antistof par i ABS: anti-mus Alexa fluor 647 (1:250), anti-kanin Alexa fluor 594 (1:250) og anti-ged Alexa fluor 488 (1:250). Se tabel over materialer.
  6. Der inkurueres i 0,4 μg/mL DAPI i 5 minutter ved stuetemperatur for at mærke kerner.
  7. Monter cellerne med monterings medium (Se tabel over materialer) til billeddannelse med et fluorescens mikroskop.

5. funktionel karakterisering via patch-klemme optagelser

  1. Klargør HEPES-equilibrated ekstern opløsning (NES) som følger: 140 mM NaCl, 2,8 mM KCl, 2 mM CaCl2, 2 mm mgcl2, 10 mm Hepes og 10 mm glucose. Indstil osmolariteten mellem 290-300 mΩ. PH-værdien justeres til 7,3 ved brug af 1N NaOH, og opløsningen opbevares ved 4 °C.
  2. Klargør den indvendige opløsning: 140 mM K-gluconat, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mm Hepes, 2 mm mg-ATP, 0,3 mm na-GTP. Juster pH-værdien til 7,3 med 1M KOH, og kontrollér, at osmolariteten er indstillet til ca. 290 mΩ. Opløsningen fryses ved-20 °C i små portioner.
  3. Før forsøgene køres, Forvarm NES-opløsningen i et vandbad til ca. 28-30 °C.
  4. Træk nogle borosilicat-Mikropipetter (ID 0,86 mm; OD 1,5 mm) forsynet med en spids modstand: 5-6 MΩ og fyld med den intracellulære opløsning, før den monteres i pipette holderen.
    Bemærk: Husk at klorid sølv tråde af optage elektroden og reference elektroden i blegemiddel i mindst 30 minutter for at danne et ensartet lag af AgCl på trådoverfladen.
  5. Petri skålen overføres i optagelses kammeret, og kammeret med NES-opløsningen skal være på 1-2 mL/min. Lad strømmen passere gennem en inline varmelegeme indstillet ved temperaturer på 30 °C for at holde opløsningen varm.
  6. Anbring det elektrofysiologiske optagelses kammer under et opretstående mikroskop. Optag membran strømme med patch-klemme forstærkeren og få data med en passende software.
  7. Åbn forstærker styringssoftwaren, og Indstil signal Gain ved værdi 1 og Bessel-filteret ved 10 kHz. Sørg for, at Bessel-filteret er 2,5 gange lavere end prøvetagnings frekvensen.
  8. Indstil forsøgsprotokollerne for spændings klemmer og eksperimenter med strøm klemmer i optagelses softwaren.
  9. Sæt kryds i episodisk stimulerings tilstand i protokol indstillingen, og Indstil prøvetagnings frekvensen til 25 kHz. Flyt derefter til bølgeform fanen og skriv spænding eller nuværende skridt amplitude og længde som følger.
  10. For spændings baserede natrium strømme skal du bruge 15 spændings trin (50 MS varighed hver) fra-100 mV til + 40 mV (10 mV tilvækst). Køre protokollen efter at pålægge den lappet celle et Holding potentiale af-60 mV gennem forstærkeren. Tilsvarende er de spændings styrede kalium strømme fremkaldt af spændings trin (250 MS varighed hver) fra-30 mV til + 50 mV (10 mV tilvækst), der holder den indspillede celle til-40 mV.
  11. For at undersøge de fyring egenskaber af iPSC-afledte kraniel og spinal MNs, klemme celler, i strøm klemme tilstand, ved et membran potentiale af-70 mV og bruge 4 strøm impulser (1 s varighed hver) af stigende amplitude (fra + 20 pA til + 80 pA; 20 pA tilvækst).
  12. Erhverve for hver celle spænding-aktiverede strømme, fremkaldte fyring aktivitet og tre passive egenskaber som helcelle kapacitans (cm), celle membran resistens (RM) og hvilende membran potentiale (RMP).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En skematisk beskrivelse af differentierings metoden er vist i figur 1. Humane iPSCs (WT I linje3) blev transficeret med EPB-BSD-TT-Nil eller EPB-BSD-TT-NIP, genererer, efter blasticidin udvælgelse, stabile og inducerbare cellelinjer12, i det følgende benævnt IPSC-Nil og IPSC-NIP, hhv. Differentierende celler blev karakteriseret for udtrykket af pluripotens markør OCT4 og den pan-neuronal markør TUJ1. Immun farvning analyse viste ensartet udtryk for OCT4 i alle celler på dag 0, i fravær af TUJ1 positivitet (figur 2A). På dag 3 observerede vi et stærkt fald i antallet af OCT4-positive celler, som afspejledes af TUJ1 udtryk i et undersæt af differentierende iPSCs (figur 2B). På dag 5, ingen udtryk for OCT4 blev observeret i populationen, som viste konsekvent udtryk for TUJ1 og erhvervede en neuronal morfologi (figur 2C). Motoriske neuron progenitorer blev derefter dissocieret og re-belagt for yderligere modning. Efter 7 dage (12 dage siden dag 0), celler ensartet udtrykt TUJ1 og den modne motor neuron markør CHAT (figur 3). Tilsvarende resultater er opnået med to yderligere kommercielle iPSC-linjer (Se tabel over materialer) under anvendelse af de samme dyrknings-og differentierings betingelser (supplerende figur S1 og supplerende figur S2). På samme måde som nul-induceret motor neuroner fra mus ESCs11, humane ipscs INDUCERET med Nil og NIP udtrykt lave niveauer af hox transkription faktorer og kan være mønstret langs Rostro-caudal akse med retinsyre (supplerende figur S3 ).

Disse resultater blev opnået, når 62.500 celler/cm2 blev seedede i begyndelsen af differentieringen og induceret med 1 μM doxycyclir på dag 0. Dette resulterede i den optimale koncentration af doxycyclin for at opnå maksimal induktion af transgener uden tydelig toksicitet for cellerne (supplerende figur S4A). Ved fjernelse af doxycyclin på dag 5 blev ekspressionen af transgener bragt til tavshed (supplerende figur s4b). Vi har også gennemført pilotforsøg for at etablere den optimale tæthed af cellerne på dette tidspunkt i protokollen. Vi bemærkede, at varierende denne parameter i parallel differentiering eksperimenter givet forskellige resultater. Med Initial tæthed sænket til 31.250 celler/cm2, differentiering var tilsyneladende normal, som evalueret ved at observere cellernes morfologi. Vi bemærkede dog resistens over for afkobling på dag 5 (afsnit 3,4) og reducerede levedygtigheden i den efterfølgende modningsfase. Omvendt, når den oprindelige tæthed af cellerne blev hævet til 125.000 celler/cm2, vi observerede ineffektiv differentiering, som vurderet af manglende erhvervelse af den typiske neuron-lignende morfologi. Dette resulterede i en blandet population, der kun indeholdt en mindre brøkdel af MNs, hvilket ville have behov for yderligere rensning (f. eks. af FACS). Vi har derfor fastslået, at den optimale tæthed for at opnå en ren population af neuronale celler, i stand til at overleve i kultur i mere end to måneder, er 62.500 celler/cm2.

Vi vurderede derefter den funktionelle modning af de IPSC Nil-afledte spinal motor neuroner ved at karakterisere deres elektrofysiologiske egenskaber (figur 4), som tidligere rapporteret for IPSC NIP-afledte kranie motor neuroner12. Patch klemme optagelser, i enten spænding-og strøm-klemme modalitet, blev udført på dag 7 i MNs modnings trin i protokollen (Se figur 1; samlet tidspunkt for differentiering: 12 dage) (figur 4A). På dette tidspunkt viste iPSC NIL-afledte motor neuroner et lidt lavere hvile membran potentiale (-30 ± 2 mV; n = 24) og en tilsvarende celle kapacitans værdi (+ 25 ± 2 pF; n = 25) sammenlignet med tidligere rapporterede iPSC NIP-afledte MNs12. For dybere at karakterisere graden af modning af differentierede celler, undersøgte vi deres evne til at fremkalde natrium-og kalium strømme, når de blev stimuleret med en række spændings impulser. I disse eksperimenter viste IPSC Nil-afledte neuroner med succes spændings afhængige natrium strømme (figur 4B) og spændings afhængige kalium strømme (figur 4C), der nåede peak-amplitude, når den blev fastspændt ved en membran potentialet i nærheden af henholdsvis − 20 mV og + 50 mV. Ligevægts potentialerne for Na+ og K+, beregnet ved hjælp af Nernsts ligning (www.physiologyweb.com/Calculators/nernst_potential_calculator.html) med de tidligere rapporterede ekstracellulære og intracellulære opløsninger, henholdsvis + 110 mV og-102 mV. Desuden var de 80% af de iPSC NIL-afledte MNs, der var fastspændt i den nuværende klemme form, i stand til at udløse Spike tog, når de blev injiceret med en aktuel puls på + 60 pA eller mere (figur 4D). Den mindste strøm, der kræves for at fremkalde gentagne fyring i mere end 50% af de indspillede celler, var + 40 pA (15 ud af 18 celler; Figur 4 E). Spike tærskel var-37,6 ± 0,8 mv og gennemsnitlig fyring frekvens på + 40 PA var omkring 7,9 ± 2,2 Hz (n = 18; Figur 4 F).

Samlet set tyder disse data på, at på samme måde som tidligere rapporterede IPSC NIP-afledte kranie mns12, IPSC-Nil-afledte spinal mns har funktionelle egenskaber typisk for modne neuroner.

Figure 1
Figur 1 : Motor neuron differentiering protokol. Figuren viser en skematisk gengivelse af differentierings protokollen, fra generering af stabile iPSC-linjer med piggyBac-vektorer til tidspunktet for den funktionelle analyse, der rapporteres i teksten. Repræsentative fasekontrast billeder af cellerne på forskellige trin i protokollen vises. Skala stænger = 50 μm. Klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Repræsentativ immunofarvnings analyse af differentierende celler. iPSC-NIL-og iPSC-NIP-celler blev analyseret ved immun farvning for udtrykket af pluripotens markør OCT4 (lilla) og den pan-neuronale markør TUJ1 (rød) på dag 0 (a), dag 3 (B) og dag 5 (C). Nuclei blev kontra plettet med DAPI. Refleksionskonfokalmikroskopi billeder blev erhvervet ved Laserscanning confokale mikroskop (Se tabel over materialer) ved hjælp af en 20x na 0,75 mål med zoom 2x, 1024 x 1024 pixel, udstyret med 405 nm, 473 nm, 559 nm og 635 nm lasere. Filter indstilling for DAPI, Alexa fluor 594 og Alexa fluor 647 blev brugt. Skala stænger = 50 μm. Klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Repræsentativ immunofarvnings analyse af iPSC-afledte motor neuroner. iPSC-NIL og iPSC-NIP celler blev analyseret af immun farvning for udtrykket af den pan-neuronal markør TUJ1 (rød) og motor neuron markør CHAT (cholin acetyltransferase; grøn) på dag 12. Nuclei blev kontra plettet med DAPI. Confocal billeder blev erhvervet som beskrevet i figur 2 Legend. Skala stænger = 50 μm. Klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Funktionel analyse af spinal og kraniel motoriske neuroner. (A) lyse felt billede af helcelle patch klemme på IPSC Nil-afledt spinal motor neuron. B) repræsentativ i/V-kurve for Na+ Current, der er registreret i IPSC Nil-afledte mns som reaktion på en række stigende spændings trin (n = 26; Holding potentiale svarende til-60 mv). C) repræsentativ i/V-kurve for K+ , der er registreret i IPSC Nil-afledte mns som reaktion på en række stigende spændings trin (n = 23, Holding potentiale svarende til-40 mv). D) repræsentativ spor af et tog af aktionspotentialer fremkaldt som reaktion på en 1 s vedvarende strømtilførsel på + 60 PA. (E) histogram, der repræsenterer procentdelen af IPSC Nil-afledte mns, der fremkalder aktionspotentialer ved hver Aktuel puls (n = 18). (F) histogram, der viser den fremkaldte fyrings frekvens ved hver Aktuel puls (n = 18). Elektrofysiologisk optagelse blev udført under et opretstående mikroskop. Systemet til registrering af membran strømme er angivet i materiale oversigten. Klik her for at se en større version af dette tal.

Supplementary Figure 1
Supplerende figur S1: MN-differentiering ved hjælp af Episomal hiPSCs. (A) brightfield billeder af differentierer Episomal HIPSC-Nil (venstre) og Episomal HIPSC-NIP (højre) på de angivne tidspunkter. Skala stænger = 50 μm. (B) analyse af udtrykket af de indikerede markører ved differentiering af Episomal HIPSC-Nil (top) og Episomal HIPSC-NIP (nederst) celler ved real time QRT-PCR. For hver markør er tidspunktet med det højeste udtryk blevet anvendt som kalibratorprøve. Primers, der anvendes til ISL1, er specifikke for det endogene gen. (C) immunofarvning for den pan-neuronale markør TUJ1 (rød) og kranie MN markør PHOX2B (grøn) i differentieret (dag 6) episomal hipsc-Nil (venstre) og episomal hipsc-NIP (højre) celler. Nuclei er kontra plettet med DAPI. Skaleringsbar til alle paneler: 50 μm. (D) analyse af udtrykket HB9 og PHOX2B i differentiering af Episomal HIPSC-Nil (top) og Episomal HIPSC-NIP (nederst) celler ved real time QRT-PCR. Dag 0 er blevet brugt som kalibratorprøven. PCR-grundere og-metoder rapporteres i de Santis et al., 201812. Klik her for at se en større version af dette tal.

Supplementary Figure 2
Supplerende figur S2: MN-differentiering ved hjælp af DS2U iPSCs. (A) brightfield billeder af DIFFERENTIERENDE DS2U-Nil (venstre) og DS2U-NIP (højre) på de angivne tidspunkter. Skala stænger = 50 μm. (B) analyse af udtrykket af de indikerede markører ved DIFFERENTIERING af DS2U-Nil (top) og DS2U-NIP (nederst) celler ved real time QRT-PCR. For hver markør er tidspunktet med det højeste udtryk blevet anvendt som kalibratorprøve. Primers, der anvendes til ISL1, er specifikke for det endogene gen. (C) immunofarvning for den pan-neuronale markør TUJ1 (rød) og kranie MN-markør PHOX2B (grøn) i differentieret (dag 6) DS2U-Nil (venstre) og DS2U-NIP (højre) celler. Nuclei er kontra plettet med DAPI. Skala stænger = 50 μm. (D) analyse af udtrykket HB9 og PHOX2B i DIFFERENTIERING DS2U-Nil (top) og DS2U-NIP (nederst) celler ved real time QRT-PCR. Dag 0 er blevet brugt som kalibratorprøven. PCR-grundere og-metoder rapporteres i de Santis et al., 201812. Klik her for at se en større version af dette tal.

Supplementary Figure 3
Supplerende figur S3: HOX-genekspression. (A) analyse af udtrykket af fire forskellige hox-gener (Hox a2, Hox B1, Hox A4, Hox B5) efter 5 dages differentiering af IPSC-Nil-og IPSC-Nil + RA-celler ved real time QRT-PCR. IPSC-NIL på dag 0 er blevet anvendt som kalibratorprøve. (B) analyse af udtrykket af fire forskellige hox-gener (Hox a2, Hox B1, Hox A4, Hox B5) efter 5 dages differentiering af IPSC-NIP og IPSC-NIP + RA-celler ved real time QRT-PCR. IPSC-NIP på dag 0 er blevet anvendt som kalibratorprøven. (C) PCR-primer-par. Klik her for at se en større version af dette tal.

Supplementary Figure 4
Supplerende figur S4: induktions analyse af doxycyclin. (A) analyse ved realtids QRT-PCR af ekspressionen af eksogene Ngn2 i IPSC-Nil (top) og IPSC-NIP (nederst) celler ubehandlet eller kultiveret i 24 timer ved tilstedeværelse af doxycyclik i forskellige koncentrationer (0,5 μm, 1,0 μm, 2,0 μm). Ngn2 blev analyseret med primere specifikt for det eksogene muse-gen. Den forældre iPSC linje, blottet for NIL og NIP konstruktioner, er blevet medtaget i analysen som en kontrol. Ekspressionen af transgener i iPSC-NIL og iPSC-NIP var forsømt i fravær af doxycyclin. iPSC-NIL og iPSC-NIP på dag 0 er blevet anvendt som kalibratorprøver. (B) analyse ved real time QRT-PCR af ekspressionen af eksogene Ngn2 ved differentiering af IPSC-Nil (venstre) og IPSC-NIP (højre) celler på de angivne tidspunkter i protokollen. Ngn2 blev analyseret med primere specifikt for det eksogene muse-gen. iPSC-NIL og iPSC-NIP på dag 0 er blevet anvendt som kalibratorprøver. PCR-grundere og-metoder rapporteres i de Santis et al., 201812. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne protokol gør det muligt effektivt at konvertere humane iPSCs til spinal og kraniel motor neuroner takket være ektopic udtryk af Lineage-specifikke transkription faktorer. Disse transgener er inducerbare af doxycyclin og stabilt integreret i genomet takket være en transposon-baseret vektor med piggyBac. I en blandet population, en eller flere eksemplarer af piggyBac vektor vil blive tilfældigt integreret i genomet af de enkelte celler, øge risikoen for genomintegritet ændringer. Desuden kan en progressiv udvælgelse af iPSC subkloner forekomme over tid, med mulige konsekvenser for differentiering og for sammenlignende analyse af sygdom og kontrol cellelinjer. I alt vil iPSC-afledte MNs opnået med denne protokol være uegnet til regenerativ medicin. Men, vores metode kunne være særligt nyttige for in vitro motor neuron sygdom modellering. De vigtigste styrkepunkter er de ekstremt forenklede dyrkningsbetingelser, den hurtige MN-konvertering, den høje grad af modning af iPSC-afledte MNs og muligheden for at opnå både spinal-og kraniale MNs, som tidligere påvist ved analyse af specifikke markørgener udtryk12. Protokollens robusthed påvises ved dens reproducerbarhed. Indtil videre har vi med succes anvendt denne protokol mere end 30 gange for spinal-og/eller kranie MN-generation, hvor vi vurderede resultaterne af markør-og/eller funktionelle analyser. Vi har med succes opretholdt motor neuron kulturer i op til to måneder uden tydeligt fald i rentabiliteten. Desuden, når den stabilt transduceret iPSC linje er opnået, kan hvert eksperiment startes ved doxycyclininduktion uden behov for ny transfection. Virale vektorer er heller ikke påkrævet. De repræsentative resultater, der præsenteres her, er opnået ved elektroporerende iPSCs med det celle elektroporationsystem, der er angivet i materiale oversigten. Andre elektro porationmetoder kan dog repræsentere alternative muligheder. Omvendt, i vores erfaring, transfektering systemer baseret på lipofection er ikke en god mulighed for pluripotente stamceller12. Cellepopulationer, der er opnået ved processens afslutning, er næsten udelukkende sammensat af MNs og undgår behovet for yderligere rensning (f. eks. ved FACS). Som vi tidligere viste12, protokollen giver mulighed for at opnå 90% TUJ1-positive celler, hvoraf 95%, hvor også PHOX2B positive i NIP-afledte kulturer.

Vi kan forestille os nogle kritiske punkter, der skal tages nøje i betragtning. For det første er kvaliteten af den oprindelige population af iPSCs afgørende for at sikre en homogen og konsekvent omdannelse til MNs. kulturer, der indeholder en betydelig del af differentieringen (mere end 5-10%) skal undgås. Vi har oprettet protokollen ved hjælp af human iPSC medium beskrevet i tabellen af materialer som vedligeholdelse medium for udifferentierede iPSCs. Andre kommercielt tilgængelige definerede medier kan repræsentere gyldige alternative muligheder, selv om vi ikke har eksperimentet med dette punkt i det nuværende arbejde. Da mediernes sammensætning kan påvirke spredningen af startcelle populationen, kan tilpasningen af protokollen til andre vedligeholdelses medier kræve optimering af den oprindelige tæthed på dag 0. Efter transfection, er det vigtigt at holde cellerne under antibiotika udvælgelse i mindst 2 uger for at opnå stabile cellelinjer. Det kan være hensigtsmæssigt, at nogle programmer udleder klonede linjer efter integrationen af piggyBac for at opnå en mere homogen population med hensyn til niveauerne for transgen ekspression og bedre kontrol med integrations stederne. Tætheden af cellerne på dag 0, tidspunktet for doxycyclintilsætningen til mediet, er en afgørende parameter. Som nævnt i afsnittet repræsentative resultater vurderede vi en optimal celletæthed for at sikre reproducerbarhed. Vi kan ikke udelukke, at andre pluripotente stamcellelinjer kan kræve en anden start tæthed, som bør være empirisk fastlagt i pilotforsøg, da dobbelt satsen kan variere betydeligt mellem de enkelte linjer. Medium switch til Neurobasal/B27 skal forekomme efter 48 h siden doxycycliske induktion (afsnit 3,3): differentieringen kan medføre langsommere og mindre effektiv, hvis cellerne ikke opbevares i 2 hele dage i DMEM/F12-mediet. Dissociation ved dag 5 skal udføres uden at fremhæve differentierende celler. Inkubationstiden med celle dissociations reagensen (trin 3,4) kan afvige fra batch til batch og bør vurderes nøje i pilotforsøg. Ved inkubation med celle dissociations reagensen løsnede hele cellen enkeltlags fra pladen. Derefter skal den nøje adskilles ved pipettering, som beskrevet i punkt 3,4, for at bevare celle integriteten og undgå mekanisk belastning, som kan have en negativ indvirkning på vedligeholdelsen af cellekulturen ud over D5. Endelig har vi bemærket, at efter re-plating MNs overholde bedre på vævskultur plast end glas. Polymer dæksedler sikrer optimal celle vedhæftning og passende optiske egenskaber er en god mulighed for mikroskopi-baserede applikationer.

Vores metode repræsenterer en direkte "programmering" af pluripotente celler til en MN skæbne, og ikke rekapitulere de mellemliggende trin, hvorigennem embryonale celler erhverve en MN identitet under in vivo udvikling, såsom indledende specifikation til neurale ectoderm og mønster langs de dorso-ventral og Rostro-hale akser. Derfor ville det ikke være egnet til model Human MN specifikation in vitro til at studere, for eksempel, molekylære mekanismer underliggende differentiering. På den anden side, vores protokol tillader generering af en betydelig mængde af spinal eller kraniel MNs uden behov for yderligere rensning. Under hensyntagen til graden af modning opnået, dette er et nyttigt redskab til at studere molekyle basis af neurodegenerative sygdomme i motor neuron. Det videnskabelige samfund har i de seneste år fremstillet et konsistent antal iPSC-linjer med patogene mutationer i motoriske neuron sygdomsrelaterede gener. Samlinger af MN "programmerbare" iPSC-linjer kan derfor let genereres ved en stabil integration af NIL-og NIP-modulerne i de mutante iPSC-linjer. Vi kan forestille os, som en mulig fremtidig anvendelse af metoden, karakterisering af celle-autonome determinanter, der giver forskellig modtagelighed for individuelle MN-undertyper, ved at sammenligne side-by-side kranie og spinal mns opnået fra ipscs med samme genetiske baggrund. Desuden kan en effektiv omdannelse af iPSCs til MNs i forenklede kulturforhold, der kræver minimal manipulation (dvs. uden overgang gennem embryooide organer), og som let skalérbare, i høj grad lette automatiseret højt gennemløb screeningmetoder for motoriske neuron sygdomme. In vitro modellering af voksne-debut neurodegenerative sygdomme kan være udfordrende på grund af føtal-lignende karakter af iPSC-afledte neuroner14. Tidligere strategier udtænkt for at fremskynde aldring af mns afledt af konventionel differentiering af ipscs, såsom progerin overekspression15, kan kombineres med vores metode til at opnå bedre sygdomsmodeller.

Den metode, der er beskrevet her, er baseret på det inducerbare udtryk af transkription faktorer medieret af en piggyBac vektor, kan anvendes til andre inducerede celletyper. Vi har tidligere vist, at skeletmuskulatur celler kan fås fra humane iPSCs ved ekspression af BAF60c og Myod16. På samme måde kan vi forestille sig muligheden for at udvide metoden til andre celletyper af interesse, herunder andre neuronale undertyper og astrocytter, ved piggybac-medieret udtryk af passende sæt af programmering faktorer17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre

Acknowledgments

Forfatterne ønsker at takke Imaging Facility på Center for Life Nano Science, Istituto Italiano di tecnologia, for støtte og teknisk rådgivning. Vi er taknemmelige for medlemmer af Center for Life Nano Science for nyttige diskussioner. Dette arbejde blev delvist understøttet af et tilskud fra AriSLA (pilot tilskud 2016 "StressFUS") til AR.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics