HOX לוקוסים Focused CRISPR/sgRNA ספריית הקרנת זיהוי קריטי CTCF גבולות

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

ספרייה CRISPR/sgRNA הוחל כדי לחקור חלבונים. עם זאת, הכדאיות של ספרייה sgRNA לחשוף את הפונקציה של גבול CTCF ב הכונה נשאר נחקרו. כאן, אנו מתארים ספרייה ספציפית sgRNA לוקוסים HOX התירי את הפונקציה של גבולות CTCF HOX לוקוסים.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Luo, H., Sobh, A., Vulpe, C. D., Brewer, E., Dovat, S., Qiu, Y., Huang, S. HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries. J. Vis. Exp. (145), e59382, doi:10.3791/59382 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

גורם מחייב CCCTC (CTCF)-מתווכת יציב topologically שיוך תחומים (TADs) לשחק תפקיד קריטי באינטראקציות מגבילה של רכיבי ה-DNA הממוקמים שכנות TADs. CTCF תפקיד חשוב בוויסות יכולות הביטוי של גנים HOX השולטים התפתחות, גוף המתבנת, hematopoiesis ו- leukemogenesis. עם זאת, הוא נשאר ברובו לא ידוע אם וכיצד HOX לוקוסים הקשורים CTCF גבולות לווסת כרומטין הארגון ואת ביטוי גנים HOX . בפרוטוקול הנוכחי, ספרייה במאגר ספציפי sgRNA מיקוד CTCF כל האתרים מחייב לוקוסים HOXA/B/C/D נוצר כדי לבחון את ההשפעה של שיבוש כרומטין הקשורים CTCF גבולות על היווצרות טד, גנים HOX ביטוי. דרך CRISPR-Cas9 בדיקה גנטית, באתר איגוד CTCF ממוקם בין גנים HOXA7/HOXA9 (CBS7/9) התגלתה הרגולטור קריטי של כרומטין oncogenic תחום, כמו גם להיות חשוב לשמירה על גנים HOX חוץ רחמי הביטוי דפוסים לסידור מחדש MLL לוקמיה מיאלואידית חריפה (AML). לפיכך, לספריה זו sgRNA הקרנת הגישה מספק תובנות הרומן ארגון הגנום CTCF מתווכת גנים ספציפיים לוקוסים ואת מספקת גם בסיס אפיון פונקציונלי המבואר מרכיבים רגולטוריות גנטיים, שניהם קידוד ו noncoding, במהלך רגיל תהליכים ביולוגיים בעידן פרוייקט הגנום האנושי פוסט.

Introduction

מחקרים אחרונים של אינטראקציה עם הגנום חשף הטפסים גנום גרעינית יציבה תחומים שיוך topologically (TADs) שאינם נשמרים על פני סוגי תאים ו מינים. הארגון של הגנום לתחומים נפרדים מקלה ומגביל את האינטראקציות בין גורמים רגולטוריים (למשל, משפרי ואת היזמים). הגורם מחייב CCCTC (CTCF) נקשר טד גבולות ומשחק תפקיד קריטי באינטראקציות מגבילה של רכיבי ה-DNA ממוקמים TADs שכנים1. עם זאת, נתוני איגוד CTCF רחב של הגנום חשף למרות CTCF בעיקר אינטראקציה עם ה-DNA זהה-האתרים סוגי תאים שונים, הוא לעתים קרובות מתפקד כמחסום כרומטין באתר מסוים בסוג תא אחד אבל לא ביד השנייה, רומז כי פונקציות CTCF יחד עם פעילויות אחרות להיווצרות של כרומטין גבולות2. מה נותר עלום היא האלמנטים גבול (מחייב CTCF אתרים) קשורים ישירות לתפקוד הביולוגי של CTCF, איך קישורים אלה להתרחש. לכן, אנו משערים כי אתרי קישור CTCF ספציפיים בגנום ישירות לווסת את היווצרות של TADs, לשלוט יזם/משפר אינטראקציות בתוך תחומים אלה או בין תחומים סמוכים. השלמת האדם ואת העכבר הגנום רצפי פרויקטים וניתוחים epigenetic עוקבות חשפו חתימות המולקולריים והגנטיים חדשות של הגנום. עם זאת, תפקידו של חתימות/שינויים ספציפיים הכונה תפקוד התאים, כמו גם mechanism(s) המולקולרי שלהם, טרם להבין עד הסוף.

שורות מרובות של ראיות תומכות כי TADs בתיווך CTCF מייצגים כרומטין פונקציונלי תחומים3,4,5. למרות CTCF בעיקר אינטראקציה עם ה-DNA זהה-האתרים סוגי תאים שונים, נתונים CTCF שבב-seq רחב הגנום חשף כי CTCF לעיתים קרובות באמנות משמש חיץ כרומטין סוג תא אחד אך לא את שאר2. CTCF ממלא תפקיד חיוני במהלך הפיתוח על ידי מתווכים הגנום הארגוני4,6,7. שיבוש CTCF גבולות לקוי משפר/מקדם אינטראקציות, ביטוי גנים, שמוביל חסימה התפתחותית. הדבר מצביע על כך CTCF מתווכת TADs הם לא רק רכיבים מבניים, אלא גם יחידות רגולטוריות הדרושות משפר נאות פעולה וג'ין שעתוק5,8,9.

גנים HOX לשחק תפקידים חיוניים במהלך התפתחות עובריים, הם חנותם והמרגשים מוגבלים בדפוסי הביטוי שלהם. מיקומה HOXA טפסים שני TADs יציב הפרדת גנים anterior ואת אחורי על ידי יסוד הקשורים CTCF גבול hESCs והן תאים IMR901. דיווחים אחרונים הראו כי HoxBlinc, lncRNA לוקוס הקשורים HoxB , ומתווך היווצרות של CTCF ביים TADs משפר/יזם באינטראקציה לוקוס HOXB . זה מוביל הקדמי הפעלת גנים HOXB במהלך ESC מחויבות ובידול10. יתר על כן, לוקוסים גנים ספציפיים לרבות מיקומה HOXA , שינוי של CTCF מתווכת ביטוי גנים ספציפיים טד תחומים השתנה שושלת היוחסין פרופילים, היה קשור עם התפתחות המחלה הברית11,12. הראיות תומך בפונקציה הראשית עבור CTCF תיאום שעתוק גנים, קביעת זהות תא על-ידי ארגון הגנום לתחומים פונקציונלי.

למרות תפקידו בפיתוח עובריים, במהלך hematopoiesis, גנים HOX לווסת את תפקוד התא (HS/PC) hematopoietic של גזע, קדמון. פעולה זו מתבצעת על-ידי שליטה על האיזון בין התפשטות ובידול10,13,14,15. הביטוי של גנים HOX מוסדר בחוזקה ברחבי מפרט התמיינות של תאים hematopoietic, עם הביטוי הגבוהה ביותר ב- HS / ביטוי גנים מחשבים HOX פוחתת בהדרגה במהלך ההבשלה, עם רמות הנמוך שלו המתרחשים הבדיל תאים hematopoietic16. Dysregulation גנים HOX הוא מנגנון הדומיננטי של לוקמיה השינוי לפי dysregulating התחדשות עצמית ובידול מאפייני HS/מחשבים שמוביל שינוי לוקמיה17,18. עם זאת, המנגנון של ביסוס ושמירה על רגיל לעומת דפוסים oncogenic ביטוי של גנים HOX , כמו גם רשתות בקרה רגולטריות המשויך עדיין לא ברור.

CRISPR-Cas9 sgRNA ספריית ההקרנה כבר בשימוש נרחב לחקור חלבונים הגנים19 כמו גנים היטב גם ללא קידוד, כגון lncRNA20 ו- miRNA21 מינים שונים. עם זאת, עלות השימוש בספריה sgRNA CRISPR-Cas9 כדי לזהות מטרות חדשות גנומית נותרת גבוהה, כי רצף הגנום תפוקה גבוהה מוחל לעיתים קרובות כדי לוודא ההקרנה ספריית sgRNA. שלנו sgRNA מערכת הסינון מתמקדת לוקוסים הגנום ספציפיים, ערך את sgRNAs מיקוד דרך בשלב אחד RT-PCR על פי בביטוי הגן סמן, כגון HOXA9. בנוסף, ניתן להבחין סנגר רצף אישר sgRNA היה משולב לתוך הגנום, ויאסין מוטציות כדי לזהות את sgRNA מיקוד באתר. דרך ההקרנה CRISPR-Cas9 לוקוסים ספציפיים גנטי, הגבול כרומטין CBS7/9 זוהתה כרגולטור קריטי הקמת תחום כרומטין oncogenic ולשמירה על דפוסי ביטוי גנים HOX חוץ רחמי ב- AML פתוגנזה 12. השיטה יכול להיות מיושם באופן נרחב כדי לזהות לא רק התפקוד המסוים של גבול CTCF של התפתחות עוברית, hematopoiesis, leukemogenesis, אבל גם CTCF גבול כמטרות טיפוליות אפשריות לטיפול epigenetic בעתיד.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. CTCF sgRNALibrary עיצוב באמצעות כלי מקוון

  1. לעצב את sgRNA מיקוד CTCF אתרים מחייב לוקוסים HOX האנושי באמצעות ההפרעות גנטיות פלטפורמה (GPP) מעצב הכלי (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design).
  2. לסנתז סך של 1,070 sgRNAs המורכב sgRNAs מיקוד 303 גנים מיקוד אקראי, פקדים חיובי 60, פקדים שאינם האדם-פילוח 500, ו- 207 אלמנטים CTCF ' או lncRNA מיקוד גנים (איור 1, טבלה 1). כל אלמנט דנ א מיקוד מכוון על ידי 5-10 sgRNAs שונים.

2. sgRNA ספריית שיבוט

  1. לשכפל את oligonucleotides מסונתז לתוך הווקטור המרכזי (backbone) lentiviral CRISPR (lentiCRISPRv2).
    1. לעכל את הווקטור LentiCRISPRv2 עם BsmBI אנזים הגבלה ב 37 מעלות צלזיוס במשך שעתיים.
    2. לחפש את הנוכחות של הלהקה גדול יותר (בסביבות 12,873 bp) על הג'ל לאחר עיכול BsmBI, ולאחר מכן לטהרו עם ערכת חילוץ ג'ל.
      הערה: קטע קטן מלוי kb 2 קיים גם בג'ל לאחר עיכול, אבל זה מומלץ להתעלם.
    3. מאתרים ומפסיקים את oligonucleotides מסונתז, מתעכל וקטור LentiCRISPR עם 150 ng של ה-DNA LentiCRISPR, 1 µL של 10 מיקרומטר oligos, 2 µL 10 מאגר ליגאז x T4, 1 µL של T4 ליגאז, מתעכל ואז דגירה אותם ב 16 מעלות צלזיוס למשך הלילה.
  2. להפוך את הספריה CRISPR/sgRNA lentiviral תאים אלקטרו-המוסמכים עבור הגברה.
    1. להכין את electroporator 1.8 kV, Ω 200 ו- 25 µF. לחמם את ההתאוששות SOC מדיה באמבט מים 37 ° C, ואז לחמם צלחות לאנטיביוטיקה אמפיצילין LB-37 מעלות צלזיוס.
    2. להפשיר את התאים המוסמכת על קרח למשך 10 דקות.
    3. להכין 1.5 mL מיקרו-צנטריפוגה צינורות 1 מ"מ אלקטרופורציה וואקום על קרח.
    4. לערבב 1 µL של פלסמיד ספריית 10 ng/µL DNA לתוך 25 µL של תאים המוסמכת בשפופרת 1.5 mL מיקרו-צנטריפוגה ומערבבים בעדינות על ידי מצליף בתחתית הצינורית כמה פעמים באופן ידני.
    5. לאחר cuvette קר מספיק, להעביר אליו את התערובת תא כשיר/ה-DNA. הקש פעמיים על השיש, כל טיפות מים מן הצד החיצוני של cuvette עם נייר טישו לנגב. לאחר מכן מניחים את cuvette המודול אלקטרופורציה ולחץ על הדופק.
    6. מיד להוסיף µL 975 של 37 ° C מראש ומחוממת SOC מדיה. מיקס על ידי pipetting למעלה ולמטה, העברת צינור 15 מ"ל.
    7. לסובב, דגירה ב 37 ° C עבור 1 h.
    8. לדלל 100 תאים µL לתוך µL 900 של מדיה SOC ומניחים 100 µL על צלחת אגר לאנטיביוטיקה אמפיצילין ליברות. דגירה בין לילה ב 37 º C.
  3. לחלץ את פלסמיד ה-DNA מ המושבות משולב באמצעות עמודה מקסי-הכנה כמפורט בפרוטוקול של היצרן.
    1. לגרד כל המושבות מהצלחת אגר LB לחסן תרבות starter של 2 מ ל LB בינוני לאנטיביוטיקה אמפיצילין, דגירה בין לילה ב 37 ° C עם טלטול נמרץ (x ~ 200 גר').
    2. לדלל את שבערך תרבות starter לתוך 100 מ ל LB אמפיצילין בינוני, דגירה ב 37 מעלות צלזיוס במשך 12-16 קמ"ש עם טלטול נמרץ (x ~ 200 גר').
    3. הקציר בגדר תא החיידק על ידי צנטריפוגה ב x 6,000 g למשך 15 דקות ב 4 º C.
    4. מחדש להשעות בגדר חיידקי ב 10 מ"ל של מאגר ההשעיה.
    5. Lyse בגדר תנאי עם 10 מ"ל של המאגר פירוק, נמרצות היפוך 4 - 6 פעמים. דגירה של lysate עבור 5 דקות בטמפרטורת החדר.
    6. לנטרל את lysate עם 10 מ"ל מאגר ניטרול צוננת. לערבב על-ידי היפוך בעדינות הצינורות 4 - 6 פעמים, דגירה זה במשך 20 דקות על קרח.
    7. ספין למטה ב x 13,500 g למשך 30 דקות ב 4 º C. להעביר מיד את תגובת שיקוע המכיל את פלסמיד דנ א כדי צינור חדש.
    8. חזור על שלב 2.3.7, ולהעביר מיד את תגובת שיקוע המכיל את פלסמיד דנ א כדי צינור חדש.
    9. Equilibrate את העמודה על-ידי החלת 10 מ"ל equilibration מאגר ולאפשר את העמודה ריק על ידי זרימת הכבידה.
    10. הוסף את תגובת שיקוע לעמודה ולאפשר כניסה השרף על ידי זרימת הכבידה.
    11. לשטוף את העמודה עם 2 x 30 מ"ל לרחוץ את המאגר.
    12. Elute ה-DNA עם 15 מ"ל • תנאי המאגר.
    13. לזרז את ה-DNA עם 10.5 מ ל אלכוהול איזופרופיל בטמפרטורת החדר ל- DNA eluted. מיקס ספין למטה מיד ב x 15,000 g למשך 30 דקות ב 4 ° C ו decant בעדינות את תגובת שיקוע.
    14. לשטוף בגדר DNA עם 5 מ של 70% אתנול, צנטריפוגה צניפה DNA ב x 15,000 g 10 דקות וזורקים את תגובת שיקוע ברורה.
    15. חזור על שלב 2.5.14 עוד פעמיים.
    16. צנטריפוגה צניפה DNA ב x 15,000 g למשך 10 דקות, decant בעדינות את תגובת שיקוע מבלי להפריע בגדר ה-DNA.
    17. מילה נהדרת בגדר למשך 5-10 דקות, לפזר את ה-DNA באמצעי אחסון נדרש מאגר (מאגר טה, pH 8.0).

3. sgRNA כייל נוגדנים גבוה ספריית Lentivirus דור

  1. תא הכנה: תרבות HEK293T תאים של Dulbecco ששינה נשר בינוני (DMEM) בתוספת 10% (vol/כרך) העובר סרום שור (FBS) ו- 1% (vol/כרך) פניצילין-סטרפטומיצין (PS) לאנטיביוטיקה T-25 המבחנות. למקם אותם בחממה ב CO 37 ° C ו-5%2.
  2. חבילת lentivirus: שיתוף transfect תאים HEK293T עם µg 20 של ספריית מטוהרים וקטורים משלב 2, 15 µg של פלסמיד החבילה (psPAX2) ו- µg 10 של פלסמיד מעטפה (pMD2.G) במשך 48 שעות לפני הקציר וירוסים.
  3. אוסף וירוס: לאחר 48 שעות, collectthe וירוס supernatant ולסנן את הוירוס supernatant באמצעות מיקרומטר 0.45 חלבון נמוכה קשירה PVDF קרום.
  4. וירוס ריכוז: לרכז את תגובת שיקוע lentiviral באמצעות 50-fold במסוע ולבדוק את הוירוס MOI בשלב 5.
  5. וירוס אחסון: Aliquot מרוכז וירוסים וחנות במקפיא-80 ° C.

4. אופטימיזציה Puromycin ריכוז

  1. תרבית תאים לוקמיה: תרבות MOLM13 AML בתאים RPMI 1640 בתוספת 10% (vol/כרך) העובר סרום שור (FBS) ו- 1 x האנטיביוטיקה פניצילין-סטרפטומיצין (PS) בבקבוקון T-125. למקם אותם בתוך אינקובטור-CO 37 ° C ו-5%2.
    הערה: תאים מועברים בדרך כלל כל 4-5 d-פיצול יחס של 1:4 או 1:6, ומאפשר אף פעם לא התאים להגיע יותר מ- 70% confluency.
  2. להגדיר את MOLM13 תאים בצלחת 12-ובכן עם צפיפות של 1.0 x 104 תאים למ"ל, על הנפח הכולל של 2 מ לכל טוב (2.0 x 104 תאים).
  3. זמן-קורס assay: לטפל MOLM13 תאים עם puromycin במשך 7 ימים להגדיל את ריכוז (0.1 µg/mL, 0.2 µg/mL, 0.5 µg/mL, 1.0 µg/mL, 2.0 µg/mL)
    1. הגדרת MOLM13 תאים ללא טיפול puromycin ביום 0 ולהגדיר 3 בארות שכפל ללא טיפול puromycin כפקד מיום 0 ליום 7.
    2. פינוק תאים MOLM13 עם 0.1 µg/mL, 0.2 µg/mL, 0.5 µg/mL, 1.0 µg/mL, 2.0 µg/mL, בנפרד, עם כל תנאי הניסוי המכיל 3 לשכפל בארות.
    3. לספור את היחס תא חי ולעשות עקומת הישרדות מיום 0 ליום 7 המכיל את כל התנאים.
  4. עקומת הישרדות: כתם תאים Trypan blue ו- count פנוי מדי יום כדי להשיג. את עקומות הישרדות בכל ריכוז puromycin.
  5. אופטימיזציה של ריכוז puromycin מינימלי: לקבוע את ריכוז מינימלי puromycin דרך Trypan blue מכתים, ב- MOLM13 כל אילו תאים נהרגים בין 5-7 ימים.

5. טיטור של ספריית Lentiviral בתאי לוקמיה MOLM13

  1. AML תאים הכנה: לאסוף MOLM13 AML תאים עם המדיום התמרה חושית (RPMI 1640, 10% FBS, PS 1% ו- 8.0 בינוני ציפוי µg/mL)-צפיפות של 1.5 x 106 תאים /mL.
  2. המקום MOLM13 תאים בצלחת 12-ובכן עם 1.5 x 106 תאים כל היטב.
  3. להפשיר את lentivirus: להסיר את lentivirus מרוכז מהמקפיא-80 ° C, להפשיר את זה על קרח.
  4. מיקס MOLM13 תאים עם מנה שונה של lentivirus מרוכז בבארות נפרדים, כולל 0, 1, 2.5, 5, µL 7.5 ו- 10 (סה כ 6 קבוצות).
  5. מיד centrifuge אלה תערובות ב x 1000 g עבור 2 h ב 33 ° C ולהעביר את הצלחות 12-. טוב לחזור החממה ב 37 ° C ו- 5% CO2 במשך 4 שעות.
  6. לאחר 4 שעות, ספין למטה התאים הנגועים ב x 400 g למשך 5 דקות בטמפרטורת החדר.
  7. בעדינות וארוקן את תגובת שיקוע מבלי להפריע בגדר תא, מחדש להשעות את התאים transduced עם מדיה טריים (RPMI 1640, 10% FBS ו- 1% PS), ולא להעביר אותם ל T-25 המבחנות ואז דגירה ב 37 מעלות צלזיוס במשך 48 שעות בלי puromycin.
  8. לאחר 48 שעות, לפצל תאים אלה 2 מבחנות (2 קבוצות): קבוצת הניסוי שטופלו 1 puromycin µg/mL במשך 5 ימים, וקבוצת בקרה ללא טיפול puromycin במשך 5 ימים.
  9. לבצע את הבחירה puromycin במשך 5 ימים עם 1 puromycin µg/mL לפי שלב 4 עד כל התאים בקרה שאינם transduced ימותו. המרת מדיה טריים כל יומיים.
  10. למדוד את הערך MOI ממוטב עבור התמרה חושית על ידי חלוקת מספר תאים חיים שטופלו puromycin עם מספר התאים ללא טיפול puromycin.

6. התמרה חושית של הספרייה KO CRISPR במאגר-Cas9

  1. התמרה חושית עם lentivirus: להדביק 1.5 x 10 תאים6 MOLM13 עם MOI 0.3 של lentivirus sgRNA איחדו בינוני (RPMI 1640, 10% FBS, PS 1% ו- 8 בינוני ציפוי µg/mL) בצלחת 6-ובכן ולהשתמש התאים ללא הזיהום lentivirus בתור פקד.
  2. מיד centrifuge הצלחת 6-ובכן-1,000 x g עבור 2 h ב- 33 מעלות כדי spinfect את התאים ולהעביר את הצלחות בחזרה ל החממה-37 מעלות צלזיוס ו-5% CO2 במשך 4 שעות.
  3. ספין למטה התאים הנגועים ב x 400 g למשך 5 דקות בטמפרטורת החדר.
  4. בעדינות תשאף תגובת שיקוע מבלי להפריע בגדר תא, מחדש להשעות את התאים transduced עם מדיה טריים (RPMI 1640, 10% FBS ו- 1% PS), ולא להעביר אותם ל T-25 המבחנות ואז דגירה ב 37 מעלות צלזיוס במשך 48 שעות בלי puromycin.
  5. לאחר 48 שעות, יטפל בתאים עם 1 puromycin µg/mL במשך 5 ימים. חילופי עבור מדיה טריים לאחר יומיים ולשמור על צפיפות האופטימלית תא.
  6. זרע שיבוט יחיד ב 96-ובכן צלחות עם הגבלת דילול שיטות, דגירה אלה שיבוטים יחיד-CO 37 ° C ו-5%2. תרבות אותם 3-4 שבועות.
  7. לאחר תא בודד גדל לתוך אוכלוסיה, העברת מחצית התאים לוחות 24-ובכן לתרבות נוספת תחת בחירת puromycin ואמת אלה שיבוטים בשלב הבא. נשאיר את שאר התאים.

7. ההקרנה של הספרייה KO CRISPR במאגר-Cas9 עם צעד אחד RT-qPCR

  1. לקבוע את היעילות של sgRNA השיבוט משולבת הקרנת המעריכה את הביטוי של הגן סמן HOXA9 עם תגובת שרשרת של פולימראז צעד אחד-טרנסקריפטאז (בשלב אחד RT-qPCR).
    הערה: HOXA9 גבוהה מבוטאים בתאים MOLM13 AML22,leukemogenesis23.
  2. הרוזן sgRNA משולב MOLM13 תא ותאים4 העברה עונה 1 פרק 10 לכל טוב צלחת PCR 96-ובכן.
  3. Centrifuge את הצינור ב x 1000 g למשך 5 דקות, ביסודיות להסיר ואז למחוק את תגובת שיקוע עם pipet מבלי להפריע בגדר התא.
  4. לשטוף תאים עם 125 µL מאגר PBS, centrifuge את הצינור ב x 1000 g למשך 5 דקות. לאחר מכן להסיר את µL 120 של תגובת שיקוע באמצעות פיפטה של, שומרים על 5 µL של PBS היטב בכל.
  5. להוסיף 50 µL של מיקס מאסטר פירוק תא המכיל 48 µL של המאגר פירוק התא, µL 1 של פתרון proteinase K (10 mg/mL) µL 1 של פתרון DNase (1 מ"ג/מ"ל) כל טוב. . ואז pipet למעלה ולמטה 5 פעמים להשעות מחדש בגדר תא...
  6. דגירה המיקס 10 דקות בטמפרטורת החדר, ואחריו 5 דקות ב 37 מעלות צלזיוס, ולאחר מכן 75 º C למשך 5 דקות.
  7. אחסן את התא lysate ב-80 מעלות צלזיוס מקפיא.
  8. הכנת התגובה RT-qPCR בשלב אחד: להפשיר את תערובת התגובה בשלב אחד ורכיבים אחרים התגובה עד 4 ° C. ואז לסובב למטה בקצרה כדי לאסוף את פתרונות בחלק התחתון של צינורות, ומניחים על קרח בלי אור. לערבב, ספין בעדינות.
  9. להוסיף 1 µL של תא lysate הבארות PCR עם התערובת התגובה RT-qPCR כולל µL 1 של פריימר לפנים ג'ין סמן (300 ננומטר) ולהפוך פריימר (300 ננומטר), µL 0.125 של רוורס טרנסקריפטאז (10 U µL), µL 5 של תערובת התגובה בשלב אחד (2x).
  10. חותם וולס עם סרט שקוף אופטית, ובעדינות מערבולת ומערבבים את רכיבי התגובה.
  11. מניחים את הצלחת ה-PCR 96-ובכן על מכשיר PCR בזמן אמת.
  12. להפעיל את תגובת שעתוק במהופך למשך 10 דקות ב 50 מעלות צלזיוס, ואחריו פולימראז איון ו DNA דנטורציה עבור 1 דקות ב- 95 מעלות צלזיוס.
  13. לבצע RT-PCR עם 40 מחזורי של תגובת ה-PCR: דנטורציה עבור 15 s ב 95 ° C, חישול/הרחבה וצלחת פלורסצנטיות קריאה עבור 20 s-60 ° C, ואז להמיס העקומה האנליזה 65-95 ° C ויה בהפרשים קבועים של 0.5 ° C 2-5 s/צעד.
  14. להגדיר את upregulated, downregulated וקבוצות ללא שינוי על פי רמות הביטוי של ג'ין HOXA9 השוואה הפקד, בנפרד. השתמש הגן β-אקטין כפקד ג'ין משק בית.

8. אימות של sgRNAs משולב שיבוטים חיובית דרך Genotyping, רצף סנגר

  1. ודא שיבוטים ביטוי HOXA9 ירד דרך סנגר רצף ולבצע PCR עם 50-100 ננוגרם MOLM13 גנום DNA, 5 µL פולימראז התגובה מאגר (10 x), פריימר לפנים µL 1 (10 מיקרומטר) (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) ו- 1 µL הפוכה תחל (10 מיקרומטר) (TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG), µL 1 dNTP (10 מ מ), יחידה 1 פולימראז (5 U /µL). לבצע את התגובה PCR עם דנטורציה הראשונית ב 94 ° C ל 30 s ולאחר מכן עוד דנטורציה ב 94 ° C עבור 20 s, חישול ב 56 ° C עבור 20 s, סיומת ב 68 מעלות צלזיוס במשך 20 s (סה כ 30 מחזורים), סיומת הסופי ב 68 מעלות צלזיוס למשך 10 דקות , ולאחר מכן החזקת ב 4 º C.
  2. תמצית ולטהר את המוצרים PCR (גודל 285 bp) עם ערכת טיהור PCR.
  3. מאתרים ומפסיקים את המוצרים PCR מטוהרים לתוך הווקטור T עם 2 µL T4 מצדו מאגר (10 x), ה-DNA וקטור ng T 50 (50 ng/µL), ה-DNA PCR ng מטוהרים 25 (285 bp), ליגאז T4 1 µL (3 יחידות/µL), והמקום מצדו לערבב בתוך אינקובטור ב 16 מעלות צלזיוס למשך הלילה.
  4. להעביר את התערובת מצדו לתא המוסמך DH5α גדלים על צלחת אגר לאנטיביוטיקה אמפיצילין ליברות, דגירה בין לילה ב 37 º C.
  5. לבחור שיבוטים יחיד מהצלחת LB ולאמת אותם על-ידי genotyping סנגר רצף.

9. גילוי של sgRNAs מוטציה ויאסין המושרה על ידי Assay עיכול נוקלאז

  1. לאתר את שהשכפול של sgRNA אחד המשולב שנגזרות ויאסין המחירים assay מבחן נוקלאז.
  2. להכין בנפרד PCR amplicons עם 50-100 ng ויאסין מוטציה (מבחן), פראי-סוג (WT, הפניה) DNA כתבנית PCR, 5 µL פולימראז התגובה מאגר (10 x), 1 µL dNTP (10 מ מ), פולימראז 1 יחידה (5 U µL), פריימר לפנים 1 µL (10 מיקרומטר) (5'-GAGATGGCGGCGCGGAAG-3'), ו- 1? L הפוכה פריימר (10 מיקרומטר) (5'-AAATATAGGGCGGCTGTTCACT-3'). התגובה PCR בוצעה עם דנטורציה הראשונית ב 98 ° C עבור 30 s ולאחר מכן דנטורציה ב 98 ° C עבור 20 s, חישול ב 56 ° C עבור 20 s, סיומת ב-72 מעלות עבור s 30 (סה כ 30 מחזורים), והסיומת הסופי ב-72 מעלות למשך 10 דקות , מחזיק ב 4 º C.
  3. הקבוצה תערובת heteroduplex עם 200 ng של "הכוונה" (20 ng/µL) ל- 200 ng של "מבחן" (20 ng/µL) amplicons ה-PCR בצינור PCR 0.2 מ"ל, וקבוצת homoduplex תערובת עם 400 היחיד ng של"אסמכתא"amplicons PCR כפקד.
  4. דגירה בנפרד את התערובת heteroduplex ו homoduplex ב 95 מעלות צלזיוס למשך 5 דקות בתוך 1 ליטר מלא 800 מ ל מים, ואז להתקרר בהדרגה לטמפרטורת החדר anneal, heteroduplex או homoduplexes.
  5. בנפרד תקציר 400 ננוגרם של תערובת heteroduplex ו- homoduplex annealed נוקלאז זיהוי המוטציה ויאסין µL 1 (U 2.5/µL), 2 µL נוקלאז התגובה מאגר (10 x) ב 42 מעלות צלזיוס למשך 60 דקות.
  6. לנתח את הדגימות מתעכל עם agarose בג'ל, ה-DNA של תערובת heteroduplex צריך לחתוך קטעים קטנים (70-250 bp), homoduplex את ה-DNA (320 bp) לא צריך להיות חתוך.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

טכנולוגיית CRISPR-Cas9 הוא כלי מחקר רב עוצמה עבור פונקציונליות גנומית מחקרים. זה במהירות מחליף ג'ין קונבנציונאלי טכניקות עריכה ויש לו השירות גבוהה ליישומים הגנום כולו והן בודדים ממוקדות ג'ין. כאן, הראשון משובטים בנפרד לוקוסים ספציפי CRISPR-Cas9-מסודר במערך sgRNA הספרייה מכילה sgRNAs 1,070 המורכב sgRNAs מיקוד 303 גנים מיקוד אקראי, פקדים חיובי 60, פקדים שאינם האדם-פילוח 500, ו- 207 אלמנטים CTCF ' או lncRNA פילוח גנים לוקוסים HOX ארבע (איור 1, טבלה 1). ספריה זו מטרות כל CTCF ליבה מחייבת מוטיבים, HOX גנים הקשורים lncRNAs, המכונה רכיבי תקינה ולאחר מספר גנים HOX הפקדים חיובית לוקוסים HOX . הוא מכיל גם sgRNAs מיקוד גנים אקראיים שאינם -HOX , אנושיות גנים ואזורי intergenic כפקדי שלילי. כדי לשפר את יעילות וספציפיות של CTCF אתר הנוק-אאוט (KO) על ידי lentiCRISPR התמרה חושית, כל אתר מיקוד מכיל 5-10 sgRNAs (טבלה 1). בפרוטוקול המתוארים כאן, sgRNA ספריות עוצבו על פי אתרי קישור CTCF HOXA/B/C/D לוקוסים, lncRNAs של אלה לוקוסים, אשר מבוססת על הכלים sgRNA במכון (איור 1, איור 2). לאחר התמרה חושית-ריבוי נמוך לזיהום עם MOI של 0.3 בתאים MOLM13 נושא המיזוג MLL-AF9, שיעור הזיהום הוא פחות מ- 2 sgRNA/תא ואחריו puromycin בחירה, ואז היו שיבוטים עמיד גדל מתא יחיד הזריעה איבחון לקות HOXA9 גנים.

זרימת העבודה להקרנה ספריית sgRNA היה בקצרה תיאר (איור 3). ראשית, הספרייה sgRNA המכיל וירוס נוצרו תאים HEK293T עם העזרה של שני וקטורים (psPAX2 ו- pMD2.G). sgRNA איחדו ספריית lentiviruses היו מרוכזים, transduced לתוך תאים לוקמיה מיאלואידית חריפה MOLM13 עם polybrane (8.0 µg/mL). לאחר התמרה חושית 48 שעות, תאים טופלו ריכוז אופטימלי של puromycin. לאחר 5 ימים, התאים היו נזרע תא/באר אחת לתוך צלחות 96-ובכן, שיבוטים יחיד נוצרו בנוכחות puromycin. לבסוף, sgRNA שיבוטים יחיד משולב לתוך הגנום זוהו על ידי צעד אחד RT-PCR, סנגר רצף וזיהוי מוטציה ויאסין (איור 3). שיבוטים יחיד puromycin עמיד מזוהים באמצעות droplet בשלב אחד דיגיטלי RT-qPCR (RT-ddqPCR) לפי שינוי בביטוי של HOXA9 אונקוגן (איור 4). Genotyping והרצף סנגר בוצעו עבור אימות (איור 2, איור 4) ובניה של ספריית sgRNA.

sgRNA מיקוד MOLM13 שיבוטים חיובי בצלחת PCR 96-ובכן אומתו נוסף עם השיטה RT-qPCR מבוסס על הגניםרמות הביטוי של HOXA9 באמצעות השוואה עם תאי בקרה. . 528 ששרדו שיבוטים מוקרן, 10 שיבוטים הפגינו יותר מ- 50% הפחתה ברמות HOXA9 (איור 4A). sgRNAs לשלב HOXA9-מופחת, HOXA9-ללא שינוי, ולא HOXA9-שיבוטים מוגברת בהמשך שאושרו על-ידי ה-PCR הגברה של הרצף sgRNA באמצעות תחל וקטור איגוף. המוצרים PCR מטוהרים היו מאתרים לתוך מערכת וקטור T באמצעות ליגאז T4 ו שנשלח לזיהוי על ידי רצף סנגר (ראה שלב 8). רצף הנתונים עולה כי מתוך שיבוטים 30 וסודרו, שיבוטים 21 כולל יחידה sgRNA (טבלה 2). בין הקטגוריות של sgRNA מזוהה, נותחו על פי רמות ביטוי HOXA9 . שש מתוך עשר שיבוטים מראה ירידה HOXA9 רמות הכילה sgRNAs מיקוד האתר CBS7/9, אך לא את הגנים אנושיות, גנים אנושיים אקראי, ופקדים אחרים CTCF האתר (איור 4 ו לטבלה 2).

sgRNA משולב חיובית מוטציות ויאסין הנוצרות על-ידי שיבוט יחיד נקבעים על-ידי מבוססי ה-PCR genotyping של נוקלאז עיכול בהתבסס על וזמינותו נוקלאז (איור 5). נוקלאז עיכול וזמינותו בוצע לזהות ויאסין מוטציות אירעה בגבול CBS7/9 ב נציג HOXA9-מופחת, HOXA9-ללא שינוי, והגדילה HOXA9 -שיבוטים. התוצאות עולה כי נמצאה המוטציה CBS7/9 ב 4 מתוך 6 HOXA9-מופחתת שיבוטים: שיבוטים #5, 6, 28 ו- 121, אבל לא בתוך שיבוטים #15 #31 (איור 5). עם זאת, שיבוט #15 הכיל את sgRNA מיקוד אתר lncRNA HOTTIP , בזמן שיבוט #31 הכיל מספר sgRNAs מיקוד HOAIRM1 lncRNA lncRNA אוויר חם , אתר קישור CTCF HOXD9/10 (דמויות 4B, 5 ו לטבלה 2).

Figure 1
איור 1 : תרשים סכמטי מציג אתרי קישור CTCF ו lncRNAs ב-4. HOX לוקוסים גן. כל אלמנט דנ א מיקוד מכיל 5-10 sgRNAs שונים. CTCF שבב-seq dataset שהורדו מגיאוגרפי (GSM1335528), דמיינו עם משולב גנומית הצופה (igv ב). אתרים SgRNA CTCF מיקוד HOX לוקוסים היו בלוחיות מספריים כתום. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת. 

Figure 2
איור 2 : תרשים סכמטי המייצג את החלק של שילוב רצף וקטור sgRNA ו- PCR הגברה תחל. תחל הגברה PCR עוצבו בהתאם לרצף ריק של וקטור lentiviral sgRNA. פריימר לפנים (P1) היה בצבע צהוב, ומהצמיגים הפוכה (P2) היה מסומן באדום, sgRNA היה מודגשים בירוק ב וקטור lentiviral sgRNA. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת. 

Figure 3
איור 3 : תרשים סכמטי המייצג את זרימת העבודה עבור sgRNAs ספריית עיצוב, בנייה, אימות. זרימת עבודה זו הוא כדלקמן. ראשית, הספרייה sgRNA היה מתוכנן, משובטים לתוך וקטור CRISPR lentiviral, ואז lentivirus היה ארוז עם sgRNA ספריית lentiviral וקטור, psPAX2, pMD2.G הווקטורים בתאים HEK293T. בשלב הבא, תאים MOLM13 נדבקו בווירוס MOI (0.3) נמוך ועברתי תאים אלה puromycin הבחירה. לאחר מכן, שיבוט יחיד היה נזרע בצלחת 96-ובכן. לבסוף, sgRNA שיבוטים יחיד משולב לתוך הגנום זוהו על ידי צעד אחד RT-qPCR, רצף סנגר וזיהוי ויאסין מוטציה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת. 

Figure 4
איור 4 : במאגר CRISPR-Cas9 קו ספריית הקרנת מזוהה עם צעד אחד RT-qPCR וסאנגר רצף. (א) אחד צעד RT-droplet דיגיטלי PCR ההקרנה של הביטוי HOXA9 ב שיבוטים יחיד נגוע lentivirus המכיל ספריית sgRNA. הקרנת הסרט 528 שיבוטים ספריית נגוע sgRNA עבור רמות הביטוי HOXA9 מוצג (528 נקודות). עשר של שיבוטים 528 הפגינו יותר מ- 50% ירידה HOXA9 רמות (חצים סגולים). הקו האדום מסמל את הגבול של שינוי ירידה 2-fold על-ידי השוואת התאים בקרה; הקו הכחול מסמל את הגבול של שינוי עלייה 2-fold. (B) 6 שיבוטים #5, 6, 28, 121, 207 ו- 420 היו מטרה ספציפית CBS7/9, sgRNA על דרך רצף סנגר (החצים הירוקים). (ג) ניתוח RT-ddqPCR של HOXA9 רמות ב WT MOLM13 ו- 21 של שיבוטים המכיל sgRNA יישוב בודד. הנתונים ביטוי HOXA9 קובצו לקבוצות חמש לפי הקטגוריות של רצפים sgRNA: אתר CTCF HOXA7/9 , מטרות אנושיות, אתרים נוספים CTCF לוקוסים HOX , HOX הקשורים lncRNAs, ו מטרות אנושיות נוספות. איור זה השתנה בין לואו et al.12. לסטטיסטיקה, נתונים אלה היה מיוצג זאת אומרת ± SD מ 3 ניסויים עצמאית עם מבחן t של הסטודנט. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5 : ויאסין מוטציות של שיבוט חיובי sgRNAs משולב אישר עם מבוססי ה-PCR genotyping של נוקלאז וזמינותו. (א)  דנ א גנומי הופרדה מרשת נציג CRISPR-Cas9 קו ספריית מוקרן שיבוטים זה הציג רמות הביטוי HOXA9 מופחתת, ללא שינוי או מוגבר. המחיקה משפחתית ולא משפחתית הטרוזיגוטיים של אתר CTCF ממוקם בין HOXA7 לבין HOXA9 גנים (גבול CBS7/9) זוהה על ידי genotyping מבוססי ה-PCR. HOXA9-ירד שיבוטים #5, 6, 28 ו- 121 הציג מחיקה במיקום הגבול CBS7/9 (חיצים שחורים). (B) ויאסין מוטציות באתר CBS7/9 נותחו על ידי נוקלאז עיכול וזמינותו של נציג שיבוטים זה הציג מופחתת (הקו האדום), ללא שינוי (קו כחול), או גדל רמות הביטוי HOXA9 (קו סגול). HOXA9-ירד שיבוטים #5, 6, 28 ו- 121 הציג מוטציות במיקום הגבול CBS7/9 (חיצים כתומים). איור זה השתנה בין לואו et al.12אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת. 

טבלה 1: sgRNAs מאגר מידע מיקוד. נתונים אלה הוא בין לואו et al.12אנא לחץ כאן כדי להוריד את השולחן הזה.

בטבלה 2: סאנגר רצף תוצאות sgRNAs הציג את הנבחרת HOXA9 -ירד, HOXA9 -ללא שינוי, ו HOXA9 -גדל שיבוטים. HOXA9-שיבוטים ירד, ללא שינוי, מוגברת מסומנים באדום, כחול וסגול, בנפרד. נתונים אלה הוא בין לואו et al.12אנא לחץ כאן כדי להוריד את השולחן הזה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

ג'ין חלבונים הקשורים sgRNA ספריות הוחלו במערכת הקרנה פונקציונלי לזיהוי גנים ורשתות ויסות פונקציות ספציפיות הסלולר דרך sgRNA העשרה24,25,26 ,27,28. מספר אזור ללא קידוד הקשורים sgRNA ספריות הוצגו גם במסכים פונקציונלי גנים ספציפיים עבור דיסטלי ו- proximal ויסות אלמנטים, כולל BCL11A, Tdgf1a ותרופתיים ויסות גנים28, 29,30. ספריות sgRNA אלה היו כל מה שנוצר על ידי ביואינפורמטיקה מפורט עיצוב, סינתזה oligonucleotide ו תת שיבוט של pool(s) oligonucleotide לתוך וקטורים. הגישה הקרנת כל הגנום כולו הוא מאוד חזק ושימושי אבל דורש מומחיות חישובית עבור עיצוב ברמת הגנום sgRNA ומימון עקבי לסינתזה יקר; לכן עדיין מאתגר עבור רוב מעבדות. אולם, לוקוסים ספציפי sgRNA הקרנת הגישה היא גם נוחה ויעילה כדי לזהות הרכיב ה-DNA ספציפיים כגון אתר איגוד CTCF מעורב בארגון כרומטין ורגולציה תעתיק (איור 1 ו איור 2). על ידי מיקוד את גבולות CTCF, והגשנו בקשה בשלב אחד RT-PCR להעריך שיבוטים sgRNA ממוקד על פי רמת ביטוי של גנים ספציפיים סמן, HOXA9. בנוסף, ביצענו סנגר רצף לאשר אלה שיבוטים sgRNAs משולב חיובית (איור 2 , איור 4). כדי לאשר באופן פונקציונלי שאלה sgRNAs חיובי ממוקד שיבוטים, אנחנו ביצעו המבוסס על ה-PCR genotyping, מוטציה זיהוי assay על מנת לקבוע אם sgRNA מעוררת את יעד האתר הוספה או מחיקה מוטציות (איור 5). זה נותן לנו שיטה מבטיחה היעד רכיבי ה-DNA ללא קידוד מסוימים ולהעריך את תפקידם הביולוגי בתאי יונקים.

בפרוטוקול שלנו, הזכרנו כי עיצוב ספציפי oligonucleotide יבטיח יעיל יותר משנה שיבוט לתוך lentiCRIPSRV2 וקטורים, יותר אמינה ליצור ספריה sgRNA מדויק (שלבים 1-2). על מנת לקבל את lentivirus ספריית sgRNA כייל נוגדנים גבוה, תגובת שיקוע lentiviral צריך להיות מרוכז 50-fold שימוש במסוע בעקבות הפרוטוקול (שלב 3), והם מאוחסנים בתוך מקרר-80 ° C aliquots מרובים (שלבים 3.1 – 3.5). חשש נוסף הוא מציאת הערך MOI אופטימלית עבור התמרה חושית. אם למשרד הפנים הוא נמוך מדי, מספר התאים הנגועים להקטין, להוביל sgRNA הקרנת כשל. אם למשרד הפנים הוא גבוה מדי, זה ישתלב sgRNA אחד או יותר לתא בודד, שהדבר יפריע הספרייה sgRNA הקרנת דרך בשלב אחד RT-PCR לזיהוי מוטציה ויאסין. לכן, לפני ההקרנה, מציאת MOI של האופטימלית עבור כל קבוצה של תאים באמצעות טיטור של הספרייה lentiviral היא צעד חשוב. טיטור של הספרייה lentiviral בתאי לוקמיה MOLM13 והערכת למשרד הפנים יבוצע בפרוטוקול (שלבים 5.1 – 5.10). יתר על כן, lysing יסודית של תאים עבור שעתוק במהופך יכול להבטיח בשלב אחד מוצלח RT-PCR. ניתן לבצע זאת על-ידי הגדלת זמן דגירה פירוק בכל שלבי טמפרטורה בפרוטוקול (שלבים 7.5 – 7.6). לכן, כדי להגדיל את יעיל להקרנה של הספרייה CRISPR-Cas9 קו במאגר, תא יסודית פירוק שעתוק במהופך לשחק תפקיד קריטי בקביעת בשלב אחד RT-qPCR (שלבים 7.1-7.14). בנוסף, הגדלת האיכות של ה-PCR תוכל להבטיח את זיהוי המוטציה ויאסין מוצלחת, כי איכות נמוכה PCR המוצרים ישפיע על תהליך יצירת heteroduplex/homoduplex (שלבים 9.1 –.6).

בנוסף, השיטה יכול לשמש כדי לזהות את התפקיד של CTCF בתקנה גנים HOX מסוימים לוקמיה בחתימה ג'ין aberrant HOX ונמצאים עובריים מוקדם. לדוגמה, גנים HOX לשחק תפקידים חיוניים במהלך התפתחות עובריים, כל ארבעה אשכולות של גנס HOX חנותם והמרגשים מוגבלים שלהם דפוסי ביטוי בהתפתחות עוברית. יתר על כן, מוטציות NPM1 הם בין סטייה גנטית הנפוץ ביותר ב- AML, חשבון עבור 30% מחולי AML קריוטיפ נורמלי cytogenetic31. זה משנה של AML תערוכות סוטה HOXA ו- HOXB ג'ין חתימה, אשר הופכת את מנגנון הדומיננטי של טרנספורמציה לוקמיה17. חשוב להבהיר כמה גנים HOX מוסדרים להתפתחות התקינה, dysregulated במהלך leukemogenesis. אנחנו ואחרים הראו כי CTCF ממלא תפקיד חיוני הארגון כרומטין שעתוק גנים HOX לוקוסים9,12. לפיכך, ההקרנה ספריית HOX sgRNA לוקוסים ממוקד מספק אמצעי נוח להיקשר אליו את התפקוד המסוים של אתר האיגוד CTCF בתקנה גנים HOX במהלך התפתחות מחלות ממאירות hematopoietic. אולם, מגבלה של הגישה היא הקושי במציאת סמן שימושי עבור רצף הדור הבא תפוקה גבוהה. אחת ממטרות המחקר העתידי יהיה למצוא סמן סלקטיבי מאוד ולבצע ברמת הגנום רצפי הדור הבא כדי לראות תופעות של דה מרקר. לכן, שימוש של גנים ספציפיים מתויג סמן פלורסנט כמו הכתבת מעקב יהפכו בעתיד הוא כלי מכריע תוכניות מחקר.

משפרי לשחק מספר רב של תפקידים חיוניים ברגולציה של ביטוי גנים ותפקוד יזם. עם זאת, זה יכול גם להפעיל את מקדם פעילות ממרחק רב בצורה עצמאית מיקום וכיוון, משפרי לווסת לעיתים קרובות ביטוי גנים בכיוון טרנסג'נדרים . לכן, זה מאתגר כדי לאתר במדויק את enhancer(s) עבור גנים ספציפיים, בעיקר בעידן הפוסט-גנומי. הכתב המסורתי מבחני וניתוחים פונקציונלי correlative (למשל, immunoprecipitation כרומטין, מבחני רגישות יתר DNaseI) שימשו כדי לבחון משפר תפקוד32,33. באופן דומה, הקרנות ממוקדות לוקוס קשקשים קטנים הוחלו גם לחקור את הפעילות של אלמנטים רגולטוריות דיסטלי של proximal עבור גנים ספציפיים34. האסטרטגיה ספריית sgRNA במאגר-קו מטרות ללא קידוד רגולטוריות רכיבים לוקוסים גנים HOX בהצלחה שזוהתה לאחרונה, אתר איגוד CTCF ממוקם בין הגנים HOXA7 ו HOXA9 , כמו גם של lncRNA HOTTIP זה חיוני לשליטה האחורי HOXA כרומטין תחום הארגון, אשר כוננים חוץ רחמי ביטוי גנים HOXA לוקמיה מיאלואידית חריפה (AML)12. מחקרים אלה הראו כי ההקרנה ספריית sgRNA במאגר-קו היא גם הגישה של גנטיקה עוצמה לזהות ולהעריך פונקציה ביולוגית של רכיבים ללא קידוד הגנום שלנו באתרו.

CTCF, כמו חלבון מבודד כרומטין, ממלא תפקיד חשוב בארגון הגנום על-ידי הגדרת שכונות כרומטין לחידושים ביטוי גנים ספציפיים תא ספציפי סוג11,35. שינוי של מבנה קבוצת המחשבים המשויכים topologically (טד) משנה את האינטראקציות משפר/יזם, וכתוצאה מכך5,המדינה חולה11. CTCF מאוד כולו ב- metazoan, מועשר לגבולות טד. עם זאת, זה עדיין לא ברור אם וכיצד CTCF תורם לשמירה על גבול הכרומטין ויצירת טד. למרות ההקרנה במאגר הספריה sgRNA-נוק אאוט CTCF היה ממוקד של לוקוסים HOX ארבע, הוא הוכיח להיות שיטה חזקה כדי לזהות ומנתחים גבולות CTCF, להגדיר תחום טד וכן משפר/יזם האינטראקציה של שעתוק בתוך תחום טד12. בנוסף, שיטה זו ניתן להחיל ביעילות כדי לזהות את הרכיבים lncRNA ואת גורמי שעתוק המתווכות כרומטין קונפורמציה ופעילות נגישות HOX לוקוסים. אנחנו גם מנסים לחקור את הספריה CRISPR/sgRNA המכילה את האתרים CTCF הגנום כולו באמצעות זיהוי רצף הדור הבא על-פי CTCF השבב-seq ומחקר דשא נתונים בעתיד. לכן, אסטרטגיה זו ניתן להרחיב את כרומוזום שלם או אפילו הגנום כולו.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

יש לנו שאין ניגודי אינטרסים הקשורים בדו ח זה.

Acknowledgments

המחברים מודים גם Cesari ניקולס על עריכת כתב היד. העבודה נתמכה על ידי מענקים מן המכון הלאומי לבריאות (תרגום, R01DK110108, R01CA204044).

Materials

Name Company Catalog Number Comments
Lipofectamine 3000 reagent Thermo Fisher Scientific L3000-008
Proteinase K Thermo Fisher Scientific 25530049
Puromycin Thermo Fisher Scientific A1113802
Stbl3 cells  Life Technologies  C737303
HEK293T ATCC CRL-3216
MOLM-13 DSMZ ACC 554
lentiCRISPRv2 Addgene 52961
pMD2.G Addgene 12259
psPAX2 Addgene 12260
pGEM®-T Easy Vector Systems  Promega A137A
T4 ligase  New England Biolabs  M0202S
QIAquick Gel Extract kit QIAGEN 28706
QIAuick PCR purification kit QIAGEN 28106
SingleShot™ SYBR® Green One-Step Kit Bio-Rad Laboratories 1725095
QIAGEN Plasmid Maxi Kit QIAGEN 12163
Dulbecco’s Modified Eagle Medium  Thermo Fisher Scientific  11965084
RPMI 1640  Thermo Fisher Scientific 11875093
Fetal bovine serum (FBS)  Thermo Fisher Scientific 10-082-147
Penicillin/streptomycin/L-glutamine  Life Technologies  10378016
Lenti-X Concentrator  Clontech 631232
Trypan Blue Solution Thermo Fisher Scientific 15250061
Polybrene Santa Cruz Biotechnology sc-134220
Phosphate Buffered Saline (PBS)  Genessee Scientific  25-507
TAE buffer  Thermo Fisher Scientific  FERB49
Surveyor® Mutation Detection Kits Integrated DNA Technologies 706020
Biorad Universal Hood II Gel Doc System Bio-Rad 170-8126
Centrifuge 5424 R Eppendorf 5404000138
Digital Dry Baths/Block Heaters Thermo Fisher Scientific 88870002
TSX Series Ultra-Low Freezers Thermo Fisher Scientific TSX40086V
Forma™ Steri-Cult™ CO2 Incubators Thermo Fisher Scientific 3308
Herasafe™ KS, Class II Biological Safety Cabinet Thermo Fisher Scientific 51022484
Sorvall™ Legend™ XT/XF Centrifuge Series Thermo Fisher Scientific 75004506
Fisherbrand™ Isotemp™ Water Baths Thermo Fisher Scientific FSGPD02
Thermo Scientific™ Locator™ Plus Rack and Box Systems Thermo Fisher Scientific 13-762-353
CFX96 Touch Real-Time PCR Detection System Bio-Rad 1855195
MiniAmp™ Thermal Cycler Applied Biosystems technology A37834
Thermo Scientific™ Owl™ EC300XL2 Compact Power Supply Thermo Fisher Scientific 7217581
Thermo Scientific™ Owl™ EasyCast™ B1 Mini Gel Electrophoresis Systems Thermo Fisher Scientific 09-528-178
VWR® Tube Rotator and Rotisseries VWR International 10136-084
VWR® Incubating Mini Shaker VWR International 12620-942
Analytical Balance MS104TS/00 METTLER TOLEDO 30133522
DS-11 FX and DS-11 FX+ Spectrophotometer DeNovix Inc. DS-11 FX

DOWNLOAD MATERIALS LIST

References

  1. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  2. Cuddapah, S., et al. Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome research. 19, (1), 24-32 (2009).
  3. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137, (7), 1194-1211 (2009).
  4. Tang, Z., et al. CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription. Cell. 163, (7), 1611-1627 (2015).
  5. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, (5), 1012-1025 (2015).
  6. Dowen, J. M., et al. Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes. Cell. 159, (2), 374-387 (2014).
  7. Phillips-Cremins, J. E., et al. Architectural protein subclasses shape 3D organization of genomes during lineage commitment. Cell. 153, (6), 1281-1295 (2013).
  8. Narendra, V., Bulajic, M., Dekker, J., Mazzoni, E. O., Reinberg, D. CTCF-mediated topological boundaries during development foster appropriate gene regulation. Genes & Development. 30, (24), 2657-2662 (2016).
  9. Narendra, V., et al. CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. Science. 347, (6225), 1017-1021 (2015).
  10. Deng, C., et al. HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development. Cell Reports. 14, (1), 103-114 (2016).
  11. Patel, B., et al. Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia. Leukemia. 28, (2), 349-361 (2014).
  12. Luo, H., et al. CTCF boundary remodels chromatin domain and drives aberrant HOX gene transcription in acute myeloid leukemia. Blood. 132, (8), 837-848 (2018).
  13. Dou, D. R., et al. Medial HOXA genes demarcate haematopoietic stem cell fate during human development. Nature Cell Biology. 18, (6), 595-606 (2016).
  14. Lawrence, H. J., et al. Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood. 106, (12), 3988-3994 (2005).
  15. Deng, C., et al. USF1 and hSET1A mediated epigenetic modifications regulate lineage differentiation and HoxB4 transcription. PLOS Genetics. 9, (6), e1003524 (2013).
  16. Rawat, V. P., Humphries, R. K., Buske, C. Beyond Hox: the role of ParaHox genes in normal and malignant hematopoiesis. Blood. 120, (3), 519-527 (2012).
  17. Alharbi, R. A., Pettengell, R., Pandha, H. S., Morgan, R. The role of HOX genes in normal hematopoiesis and acute leukemia. Leukemia. 27, (5), 1000-1008 (2013).
  18. Rice, K. L., Licht, J. D. HOX deregulation in acute myeloid leukemia. Journal of Clinical Investigation. 117, (4), 865-868 (2007).
  19. Bassett, A. R., Kong, L., Liu, J. L. A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells. Journal of Genetics and Genomics. 42, (6), 301-309 (2015).
  20. Zhu, S., et al. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nature Biotechnology. 34, (12), 1279-1286 (2016).
  21. Kurata, J. S., Lin, R. J. MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs. RNA. 24, (7), 966-981 (2018).
  22. Collins, C. T., Hess, J. L. Role of HOXA9 in leukemia: dysregulation, cofactors and essential targets. Oncogene. 35, (9), 1090-1098 (2016).
  23. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., Sauvageau, G. NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. The EMBO Journal. 20, (3), 350-361 (2001).
  24. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology. 32, (3), 267-273 (2014).
  25. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  26. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  27. Zhou, J., et al. Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting. The FEBS Journal. 281, (7), 1717-1725 (2014).
  28. Sanjana, N. E., et al. High-resolution interrogation of functional elements in the noncoding genome. Science. 353, (6307), 1545-1549 (2016).
  29. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, (2), 167-174 (2016).
  30. Korkmaz, G., et al. Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9. Nature Biotechnology. 34, (2), 192-198 (2016).
  31. Rezaei, N., et al. FMS-Like Tyrosine Kinase 3 (FLT3) and Nucleophosmin 1 (NPM1) in Iranian Adult Acute Myeloid Leukemia Patients with Normal Karyotypes: Mutation Status and Clinical and Laboratory Characteristics. Turkish Journal of Haematology. 34, (4), 300-306 (2017).
  32. Yaragatti, M., Basilico, C., Dailey, L. Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions. Genome Research. 18, (6), 930-938 (2008).
  33. Wilken, M. S., et al. DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements. Epigenetics Chromatin. 8, 8 (2015).
  34. Narlikar, L., Ovcharenko, I. Identifying regulatory elements in eukaryotic genomes. Briefings in Functional Genomics and Proteomics. 8, (4), 215-230 (2009).
  35. Hnisz, D., et al. Activation of proto-oncogenes by disruption of chromosome neighborhoods. Science. 351, (6280), 1454-1458 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics