HOX Loci fokuserad CRISPR/sgRNA bibliotek Screening identifiera kritiska SAP gränser

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

CRISPR/sgRNA bibliotek har tillämpats på förhör protein-kodande gener. Genomförbarheten av ett sgRNA-bibliotek för att avslöja funktionen av en SAP gräns i genreglering är dock fortfarande outforskat. Här beskriver vi ett HOX loci specifika sgRNA bibliotek för att belysa funktionen av SAP gränser i HOX loci.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Luo, H., Sobh, A., Vulpe, C. D., Brewer, E., Dovat, S., Qiu, Y., Huang, S. HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries. J. Vis. Exp. (145), e59382, doi:10.3791/59382 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CCCTC-bindande faktor (SAP)-medierad stabil topologically associera domäner (TADs) spelar en avgörande roll i Begränsningsaspekten interaktioner av DNA-element som finns i angränsande TADs. SAP spelar en viktig roll i regleringen av det rumsliga och tidsmässiga uttrycket för HOX gener som styr Embryonalutvecklingen, kroppen mallning, blodbildning och leukemogenesis. Det är dock fortfarande till stor del okända huruvida och hur HOX loci associerade SAP gränser reglera kromatin organisation och HOX genuttryck. I det nuvarande protokollet, har en specifik sgRNA poolade bibliotek inriktning alla SAP bindningsställen i de HOXA/B/C/D -lokus genererats för att undersöka effekterna av störa SAP-associerade kromatin gränser på TAD bildandet och HOX gener uttryck. Genom CRISPR-Cas9 har genetisk screening, SAP bindande platsen ligger mellan HOXA7/HOXA9 gener (CBS7/9) identifierats som en kritisk regulator av onkogena kromatin domän, som är viktiga för att upprätthålla ektopisk HOX gener uttrycksmönster i MLL-omordnats akut myeloisk leukemi (AML). Således, detta sgRNA bibliotek screening strategi ger nya insikter i SAP medierad genome organisation i specifik gen loci och ger också en grund för funktionell karakterisering av de kommenterad genetiska regulatoriska element, både kodning och icke-kodande, under normala biologiska processer i den efter mänskliga genomet projektet eran.

Introduction

Senaste genomet interaktionsstudier visade att formulären nukleära humangenomet stabil topologically förbindande domäner (TADs) som bevaras över celltyper och arter. Organisationen av genomet in i separata domäner underlättar och begränsar interaktioner mellan reglerande element (t.ex. förstärkare och initiativtagare). Den CCCTC-bindande faktorn (SAP) binder till TAD gränser och spelar en avgörande roll i Begränsningsaspekten interaktioner av DNA-element som finns i angränsande TADs1. Genome wide SAP bindande data visade dock att även om SAP interagerar mest med samma DNA-platser i olika celltyper, fungerar det ofta som en kromatin barriär på en specifik plats i en celltyp men inte det andra, vilket tyder på att SAP-funktioner tillsammans med andra aktiviteter i bildandet av kromatin gränser2. Vad förblir okänd är huruvida gränsen elementen (SAP-bindande platser) är direkt kopplade till den biologiska funktionen av SAP, och hur dessa länkar inträffa. Därför hypotes vi att specifika SAP bindningsställen i genomet direkt reglerar bildandet av TADs och kontroll Promotorn/förstärkare interaktioner inom dessa domäner eller mellan närliggande domäner. Slutförandet av den mänskliga och mus genomet sekvensering projekt och efterföljande epigenetiska analyser har upptäckt nya molekylära och genetiska signaturer av genomet. Rollen av särskilda signaturer eller ändringar i genreglering och cellulär funktion, samt deras molekylära mekanismerna, har dock ännu inte förstås fullt.

Flera rader av bevis som stöder att de SAP-medierad TADs utgör funktionella kromatin domäner3,4,5. Även om SAP interagerar mest med samma DNA-platser i olika celltyper, visade genome bred SAP ChIP-seq data att SAP ofta fungerar som en barriär av kromatin i en celltyp men inte i de andra2. SAP spelar en viktig roll under utvecklingen av medla genome organisation4,6,7. Störningar av SAP gränser nedsatt förstärkare/arrangören interaktioner och genuttryck, leder till utvecklingsmässiga blockering. Detta tyder på att SAP medierad TADs är inte bara strukturella komponenter, men också rättsliga enheter som krävs för korrekt enhancer action och gen transkription5,8,9.

HOX gener spelar viktiga roller under fosterutvecklingen och de är temporally och rumsligt begränsade i deras uttrycksmönster. Det HOXA locus bildar två stabila TADs avskilja främre och bakre gener av en SAP-associerade gränsen element i både hESCs och IMR90 celler1. Senaste rapporter visat att HoxBlinc, en HoxB locus associerade lncRNA, förmedlar bildandet av SAP riktad TADs och förstärkare/arrangören interaktioner i det HOXB locus. Detta leder till främre HOXB gen aktivering under ESC engagemang och differentiering10. Dessutom på specifik gen loci inklusive det HOXA -locus, ändring av SAP medierad TAD domäner ändras härstamning specifik gen uttryck profiler och var förknippad med utvecklingen av sjukdomen har11,12. Bevis som stöder en primär funktion för SAP samordna transkription av gener och att fastställa cellidentiteten genom att organisera genomet i funktionella domäner.

Trots dess roll i embryonala utvecklingen, under blodbildning, reglera HOX gener hematopoetiska stamceller och stamceller cell (HS/PC)-funktion. Detta görs genom att kontrollera balansen mellan proliferation och differentiering10,13,14,15. Uttrycket av HOX gener är hårt reglerad i hela specifikationen och differentiering av hematopoetiska celler, med högsta uttryck i HS / PCs. HOX genuttryck minskar gradvis under mognad, med dess lägsta nivåer förekommer i differentierade hematopoetiska celler16. HOX gener Dysreglering är en dominerande mekanismen av leukemiska transformation genom dysregulating självförnyelse och differentiering egenskaper HS/St leder till leukemiska omvandling17,18. Mekanismen för att etablera och upprätthålla normal vs. onkogena uttrycksmönster HOX gener samt associerade regleringsnät är dock fortfarande oklart.

CRISPR-Cas9 sgRNA bibliotek screening har använts att förhöra protein-kodande gener19 som väl som icke-kodande gener, såsom lncRNA20 och miRNA21 i olika arter. Kostnaden för att använda CRISPR-Cas9 sgRNA biblioteket för att identifiera nya genomiska mål kvarstår dock hög, eftersom hög genomströmning Genomsekvensering används ofta för att kontrollera sgRNA bibliotek screening. Våra sgRNA screening system är fokuserad på de specifika genomet loci och utvärderar den inriktning sgRNAs genom one-step RT-PCR enligt det markör genuttrycket, såsom HOXA9. Dessutom kan Sanger sekvensering bekräftade att sgRNA integrerades i genomet och ditsatta mutationer upptäckas för att identifiera den sgRNA inriktning webbplats. Genom lokus-specifika CRISPR-Cas9 genetisk screening, har CBS7/9 kromatin gränsen identifierats som en kritisk regulator för att etablera onkogena kromatin domän och upprätthålla ektopisk HOX gen uttrycksmönster i AML patogenes 12. metoden kan tillämpas allmänt för att identifiera inte bara specifika funktionen av SAP gräns i embryonal utveckling, blodbildning, leukemogenesis, men också SAP gräns som potentiella terapeutiska mål för framtida epigenetiska terapi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. SAP sgRNALibrary Design med hjälp av ett onlineverktyg

  1. Design den sgRNA inriktning SAP bindningsställen i de mänskliga HOX loci med hjälp av genetisk störning plattform (GPP) designer verktyget (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design).
  2. Syntetisera sammanlagt 1 070 sgRNAs bestående av sgRNAs inriktning 303 slumpmässiga inriktning gener, 60 positiva kontroller, 500 icke-mänskliga-targeting kontroller, och 207 SAP element eller lncRNA inriktning gener (figur 1, tabell 1). Varje inriktning DNA-element är riktad av 5-10 olika sgRNAs.

2. sgRNA bibliotek kloning

  1. Klona de syntetiserade oligonukleotider till CRISPR lentiviral ryggraden vektorn (lentiCRISPRv2).
    1. Smälta LentiCRISPRv2 vektorn med BsmBI restriktionsenzym vid 37 ° C i 2 h.
    2. Leta efter förekomsten av större bandet (omkring 12.873 bp) på gel efter BsmBI matsmältning, och sedan rena det med gel utvinning kit.
      Obs: En 2 kb liten filler bit är också närvarande på gelen efter matsmältningen, men detta bör ignoreras.
    3. Ligera de syntetiserade oligonukleotider och smält LentiCRISPR vector med 150 ng av smält LentiCRISPR DNA, 1 µL 10 µM oligos, 2 µL 10 x T4 ligase buffert, 1 µL T4 ligase, och sedan Inkubera dem vid 16 ° C över natten.
  2. Omvandla lentiviral CRISPR/sgRNA biblioteket till electro-kompetenta celler för förstärkning.
    1. Förbereda electroporator på 1,8 kV, 200 Ω och 25 µF. Sedan före varm återvinning SOC media i 37 ° C vattenbad och värm före LB ampicillin antibiotika plattorna vid 37 ° C.
    2. Tina de behöriga cellerna på is i 10 min.
    3. Förbered 1,5 mL mikro-centrifugrör och 1 mm elektroporation kyvetter på is.
    4. Blanda 1 µL av en 10 ng/µL bibliotek plasmid DNA in 25 µL av behöriga celler i ett 1,5 mL mikro-centrifugrör och blanda försiktigt genom att bläddra till botten av röret några gånger manuellt.
    5. När kyvetten är tillräckligt kallt, överföra DNA/behöriga cell blandningen till den. Tryck två gånger på bänkskivan och torka några vattendroppar från utsidan av kyvetten med ett läskpapper. Sedan placera kyvetten i modulen elektroporation och tryck pulse.
    6. Tillsätt omedelbart 975 µL av 37 ° C före värmde SOC media. Mix av pipettering upp och ner och överföring till en 15 mL tub.
    7. Rotera och inkubera vid 37 ° C i 1 h.
    8. Späd 100 µL celler in 900 µL av SOC media och placera 100 µL på en agarplatta för LB ampicillin antibiotika. Inkubera över natten vid 37 ° C.
  3. Extrahera plasmiden DNA från de kombinerade kolonier som använder en maxi-prep kolumn som beskrivs i tillverkarens protokollet.
    1. Skrapa alla kolonierna från LB agarplattan och Inokulera en förrätt kultur av 2 mL LB ampicillin antibiotika medium och inkubera över natten vid 37 ° C med kraftig skakning (~ 200 x g).
    2. Späd den förrätt kultur 1: 500 till 100 mL LB ampicillin medium och inkubera vid 37 ° C i 12-16 h med kraftig skakning (~ 200 x g).
    3. Skörda den bakteriella cellpelleten genom centrifugering vid 6000 x g i 15 minuter vid 4 ° C.
    4. Re centrifugerade bakteriell i 10 mL suspension buffert.
    5. Lysera det uppslammade koncentrerade extraktet med 10 mL av lyseringsbuffert och kraftfullt Invertera 4 - 6 gånger. Inkubera den lysate för 5 min i rumstemperatur.
    6. Neutralisera den lysate med 10 mL kylt neutralisering buffert. Blanda genom att försiktigt vända rören 4 - 6 gånger och inkubera det i 20 min på is.
    7. Snurra ner vid 13.500 x g under 30 minuter vid 4 ° C. Utan dröjsmål överför supernatanten innehållande plasmiden DNA till en ny tub.
    8. Upprepa steg 2.3.7 och utan dröjsmål överför supernatanten innehållande plasmiden DNA till en ny tub.
    9. Jämvikta kolonnen genom att tillämpa 10 mL Jämviktstiden buffert och tillåta kolumnen att tömma genom gravitation flöde.
    10. Lägg till supernatanten till kolumnen och gör det möjligt att ange kådan av gravitation flöde.
    11. Tvätta kolonnen med 2 x 30 mL tvätt buffert.
    12. Eluera DNA med 15 mL eluering buffert.
    13. Fällningen DNA med 10,5 mL rumstempererat isopropanol eluerade DNA. Mix och spinn ner omedelbart vid 15 000 x g i 30 minuter vid 4 ° C, och Dekantera försiktigt supernatanten.
    14. Tvätta DNA pelleten med 5 mL 70% etanol, Centrifugera DNA pelleten vid 15 000 x g i 10 min och släng klara supernatanten.
    15. Upprepa steg 2.5.14 dubbelt mer.
    16. Centrifugera DNA pelleten vid 15 000 x g i 10 min, och försiktigt Dekantera supernatanten utan att störa DNA pelleten.
    17. Lufttorka pelleten för 5-10 min och upplösa DNA i en volym som krävs av buffert (TE buffert, pH 8,0).

3. hög Titer sgRNA bibliotek Lentivirus Generation

  1. Cell förberedelse: kultur HEK293T celler i Dulbeccos modifierade Eagle Medium (DMEM) kompletteras med 10% (vol/vol) fetalt bovint serum (FBS) och 1% (vol/vol) penicillin-streptomycin (PS) antibiotikum i T-25 kolvar. Placera dem i inkubatorn vid 37 ° C och 5% CO2.
  2. Paketet lentivirus: co transfect HEK293T celler med 20 µg av renat bibliotek vektorer från steg 2, 15 µg av paketet plasmiden (psPAX2) och 10 µg av kuvert plasmiden (pMD2.G) för 48 h före skörd virusen.
  3. Virus samling: efter 48 h, collectthe virus supernatanten och filtrera supernatanten genom ett 0,45 µm låg protein bindande PVDF membran viruset.
  4. Virus koncentration: koncentrera lentiviral supernatanten med 50-faldig koncentratorn och testa viruset MOI i steg 5.
  5. Virus-lagring: alikvot koncentrerat virus och förvaras i-80 ° C.

4. optimerad Puromycin koncentration

  1. Leukemi cellkultur: kultur MOLM13 AML celler i RPMI 1640 kompletteras med 10% (vol/vol) fetalt bovint serum (FBS) och 1 x penicillin-streptomycin (PS) antibiotika i en T-125 kolv. Placera dem i en inkubator på 37 ° C och 5% CO2.
    Obs: Celler överförs vanligtvis varje 4-5 d på en split förhållandet 1:4 eller 1:6, att aldrig låta celler att nå mer än 70% konfluens.
  2. Ställa in MOLM13 celler i en 12-well platta med en densitet på 1,0 x 104 cell/mL, vid en total volym på 2 mL per brunn (2,0 x 104 celler).
  3. Tidsförlopp assay: behandla MOLM13 celler med puromycin i 7 dagar till ökande koncentrationer (0.1 µg/mL, 0,2 µg/mL, 0,5 µg/mL, 1,0 µg/mL och 2,0 µg/mL)
    1. Ställ in MOLM13 celler utan puromycin behandling på dag 0 och ställa in 3 replikera brunnar utan puromycin behandling som en kontroll från dag 0 till dag 7.
    2. Behandla MOLM13 celler med 0.1 µg/mL, 0,2 µg/mL, 0,5 µg/mL, 1,0 µg/mL och 2,0 µg/mL, separat, replikera med varje experimentella villkor som innehåller 3 brunnar.
    3. Räkna förhållandet levande cell och göra en överlevnad kurva från dag 0 till dag 7 innehåller alla villkor.
  4. Survival kurvan: fläcken celler med Trypan blå och räkna lönsamhet dagligen att erhålla överlevnadskurvor för varje puromycin koncentration.
  5. Optimera minimal puromycin koncentration: bestämma den minimal puromycin koncentrering genom Trypan blå färgning, i vilken alla MOLM13 celler dödas mellan 5-7 dagar.

5. titrering av Lentiviral bibliotek i MOLM13 leukemiceller

  1. AML celler förberedelse: samla MOLM13 AML-celler med det transduktion mediet (RPMI 1640, 10% FBS, 1% PS och 8,0 µg/mL beläggning medium) med en täthet av 1,5 x 106 celler/ml.
  2. Placera MOLM13 celler i 12-väl plattan med 1,5 x 106 celler i varje brunn.
  3. Tina lentivirus: ta bort den koncentrerade lentivirus från-80 ° C frysen och Tina den på is.
  4. Blanda MOLM13 celler med en annan dos av den koncentrerade lentivirus i separata brunnar, inklusive 0, 1, 2,5, 5, 7,5 och 10 µL (totalt 6 grupper).
  5. Omedelbart Centrifugera dessa blandningar vid 1 000 x g för 2 h på 33 ° C och överföra 12-väl plattorna tillbaka till inkubatorn vid 37 ° C och 5% CO2 för 4 h.
  6. Efter 4 h, snurra ner de infektera cellerna vid 400 x g under 5 minuter i rumstemperatur.
  7. Försiktigt aspirera supernatanten utan att störa cellpelleten, återsuspendering transduced cellerna med färska media (RPMI 1640, 10% FBS och 1% PS), och sedan överföra dem till T-25 kolvar och inkubera vid 37 ° C för 48 h utan puromycin.
  8. Efter 48 h, dela dessa celler i 2 flaskor (2 grupper): en experimentell gruppen som behandlades med 1 µg/mL puromycin för 5 dagar, och en kontrollgrupp utan puromycin behandling i 5 dagar.
  9. Utföra puromycin urval i 5 dagar med 1 µg/mL puromycin enligt steg 4 tills alla icke-sensorik kontroll celler är döda. Exchange för färska media varje 2 dagar.
  10. Mäta optimerad MOI värdet för transduktion genom att dividera antalet levande celler behandlas med puromycin med antalet celler utan puromycin behandling.

6. transduktion av poolade CRISPR-Cas9 KO biblioteket

  1. Transduktion med lentivirus: infektera 1,5 x 106 MOLM13 celler med 0.3 MOI av sgRNA poolade lentivirus i medium (RPMI 1640, 10% FBS, 1% PS och 8 µg/mL beläggning medium) i 6-väl plattan och använda cellerna utan lentivirus infektionen som en kontroll.
  2. Omedelbart Centrifugera 6-väl plattan vid 1 000 x g för 2 h vid 33 ° C till spinfect cellerna och överföra plattorna tillbaka till inkubatorn vid 37 ° C och 5% CO2 för 4 h.
  3. Snurra ner de infektera cellerna vid 400 x g under 5 minuter i rumstemperatur.
  4. Försiktigt aspirera supernatanten utan att störa cellpelleten, återsuspendering transduced cellerna med färska media (RPMI 1640, 10% FBS och 1% PS), och sedan överföra dem till T-25 kolvar och inkubera vid 37 ° C för 48 h utan puromycin.
  5. Efter 48 h, behandla celler med 1 µg/mL puromycin för 5 dagar. Exchange för färska media efter 2 dagar och hålla en optimal cell densiteten.
  6. Frö den enda klonen i 96 brunnar med att begränsa utspädning metoder och inkubera dessa enda kloner vid 37 ° C och 5% CO2. Kultur dem i 3-4 veckor.
  7. Efter en enda cell växer upp i en befolkning, överföra hälften av cellerna i 24 brunnar för ytterligare kultur under puromycin urval och kontrollera dessa kloner i nästa steg. Hålla resten av cellerna.

7. screening av poolade CRISPR-Cas9 KO biblioteket med One-step RT-qPCR

  1. Avgöra effektiviteten hos sgRNA integrerade klonen screening genom att utvärdera uttrycket av genen markör HOXA9 med ett steg transkriptas polymeras-kedjereaktion (one-step Rtqpcr).
    Obs: HOXA9 uttrycks mycket i MOLM13 AML celler i leukemogenesis22,23.
  2. Räkna sgRNA integrerade MOLM13 cellen och överföring 1 x 104 celler per brunn till en PCR-plattan med 96 brunnar.
  3. Centrifugera röret vid 1 000 x g i 5 min, och sedan noggrant avlägsna och Kassera supernatanten med en Pipettera utan att störa cellpelleten.
  4. Tvätta cellerna med 125 µL av PBS-bufferten och centrifugera röret vid 1 000 x g i 5 min. Sedan bort 120 μl av supernatanten med pipett och behålla ca 5 µL av PBS i varje brunn.
  5. Tillsätt 50 µL av den cell lysis master mix som innehåller 48 µL av cell lyseringsbuffert, 1 µL proteinas K lösning (10 mg/mL) och 1 µL DNAS lösning (1 mg/mL) till varje brunn. Sedan Pipettera upp och ner 5 gånger för återsuspendering cellpelleten.
  6. Inkubera mixen i 10 min i rumstemperatur, följt av 5 min vid 37 ° C, och sedan 75 ° C i 5 min.
  7. Lagra cellen lysate vid-80 ° C frys.
  8. Beredning av one-step Rtqpcr reaktion: Tina one-step reaktion mixen och andra reaktion komponenter till 4 ° C. Snurra sedan ner kort samla lösningar på botten av rören och placera på isen utan ljus. Blanda och snurra försiktigt.
  9. Tillsätt 1 µL cell lysate i PCR-brunnarna med RT-qPCR reaktion mixen, inklusive 1 µL genen markör framåt primer (300 nM) och reverse primer (300 nM), 0,125 µL av omvänt transkriptas (10 U/µL) och 5 µL one-step reaktionsblandning (2 x).
  10. Täta brunnarna med optiskt genomskinlig film och försiktigt vortex och blanda reaktion komponenterna.
  11. Placera den PCR-plattan med 96 brunnar på en realtids PCR-instrumentet.
  12. Köra omvänd transkription reaktionen i 10 min vid 50 ° C, följt av polymeras inaktivering och DNA denaturering för 1 min på 95 ° C.
  13. Utföra RT-PCR med 40 cykler av PCR-reaktionen: denaturering för 15 s vid 95 ° C, glödgning/förlängning och plattan fluorescens läsning för 20 s vid 60 ° C, och sedan smälta kurva analys på 65-95 ° C via 0,5 ° C steg på 2-5 s/steg.
  14. Ställa in uppreglerad, nedreglerade och ingen förändring grupper enligt nivåerna av HOXA9 gen i jämförelse till kontrollen, separat. Använd β-aktin genen som städning gen kontroll.

8. verifiering av integrerade sgRNAs positiva kloner genom genotypning och Sanger sekvens

  1. Verifierar HOXA9 minskat uttryck klonerna genom Sanger sekvensering och utför PCR med 50-100 ng MOLM13 arvsmassa DNA, 5 µL polymeras reaktion buffert (10 x), 1 µL framåt primer (10 µM) (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) och 1 µL omvänd primer (10 µM) (TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG), 1 µL dNTP (10mM), 1 enhet polymeras (5 U/µl). Utför PCR-reaktionen med den inledande denaturering vid 94 ° C för 30 s, och sedan mer denaturering vid 94 ° C i 20 s, glödgning vid 56 ° C i 20 s, förlängning vid 68 ° C för 20 s (totalt 30 cykler), slutliga förlängning vid 68 ° C i 10 min , och sedan hålla vid 4 ° C.
  2. Extrahera och rena PCR-produkterna (storlek 285 bp) med en PCR-rening Kit.
  3. Ligera renat PCR-produkterna i de T vektorn med 2 µL T4 ligering buffert (10 x), 50 ng T vektor-DNA (50 ng/µL), 25 ng renat PCR DNA (285 bp), 1 µL T4 ligase (3 enheter/µL), och placera ligering blanda i en inkubator på 16 ° C över natten.
  4. Överföra ligering mixen i DH5α behöriga cell, växer på en LB ampicillin antibiotika agarplatta och inkubera över natten vid 37 ° C.
  5. Plocka de enda klonerna från LB plattan och kontrollera dem genom genotypning och Sanger sekvensering.

9. detektion av sgRNAs inducerad ditsatta Mutation av Nuclease matsmältningen Assay

  1. Upptäcka sgRNA integrerade enda klonen inducerad ditsatta priser av en nuclease test test.
  2. Separat Förbered PCR-amplikoner med 50-100 ng ditsatta mutant (test) och vildtyp (WT, referens) DNA som PCR mall, 5 µL polymeras reaktion buffert (10 x), 1 µL dNTP (10mM), 1 enhet polymeras (5 U/µL), 1 µL framåt primer (10 µM) (5'-GAGATGGCGGCGCGGAAG-3'), och 1 µ L reverse primer (10 µM) (5'-AAATATAGGGCGGCTGTTCACT-3'). PCR-reaktionen utfördes med inledande denaturering vid 98 ° C i 30 s och sedan denaturering på 98 ° C för 20 s, glödgning vid 56 ° C i 20 s, förlängning på 72 ° C under 30 s (totalt 30 cykler) och sista förlängning vid 72 ° C i 10 min , och hålla vid 4 ° C.
  3. Ställa in gruppen heteroduplex blandning med 200 ng av den ”referensen” (20 ng/µL) och 200 ng i ”test” (20 ng/µL) PCR-amplikoner i 0,2 mL PCR-rör, och gruppen homoduplex blandning med bara 400 ng av ”referens” PCR-amplikoner som kontroll.
  4. Separat Inkubera heteroduplex och homoduplex blandningen vid 95 ° C under 5 minuter i en 1 L bägare fylld med 800 mL vatten och därefter svalna gradvis till rumstemperatur att glödga och bilda heteroduplex eller homoduplexer.
  5. Separat digest 400 ng av glödgad heteroduplex och homoduplex blandningen med 1 µL ditsatta mutation upptäckt nuclease (2,5 U/µL) och 2 µL nuclease reaktion buffert (10 x) vid 42 ° C i 60 min.
  6. Analysera de smälta proverna med agaros gel-elektrofores, heteroduplex blandning DNA bör skäras i små fragment (70-250 bp), och homoduplex DNA (320 bp) bör inte klippas.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

CRISPR-Cas9-teknik är en kraftfull forskningsverktyg för funktionella genetiska studier. Det ersätter snabbt konventionella gen redigering tekniker och har hög verktyg för både genome-wide och individuell gen-inriktade program. Här, första individuellt klonade loci-specifika CRISPR-Cas9-klädd sgRNA biblioteket innehåller 1 070 sgRNAs bestående av sgRNAs inriktning 303 slumpmässiga inriktning gener, 60 positiva kontroller, 500 icke-mänskliga-targeting kontroller, och 207 SAP element eller lncRNA inriktning gener i fyra HOX loci (figur 1, tabell 1). Biblioteket riktar alla SAP core bindande motiv, HOX gener associerade lncRNAs, känd reglerande element och flera HOX gener som positiva kontroller i de HOX loci. Den innehåller också sgRNAs inriktning slumpmässiga icke -HOX gener, icke-mänskliga gener och intergenic regioner som negativa kontroller. För att förbättra effektiviteten och specificitet av SAP webbplats knock-out (KO) genom lentiCRISPR transduktion, innehåller varje inriktning plats 5-10 sgRNAs (tabell 1). I protokollet som beskrivs här, är sgRNA bibliotek utformade enligt SAP bindningsställen på HOXA/B/C/D loci och lncRNAs i dessa lokus, som bygger på Broad Institute sgRNA verktyg (figur 1, figur 2). Efter transduktion på en låg multiplicity av infektion med en MOI på 0,3 i MOLM13 celler bär MLL-AF9 fusion, infektion är mindre än en sgRNA/cell följt av puromycin urval, och sedan de resistenta kloner vuxit från seedade enda cell var screenas för nedskrivningar av HOXA9 genuttryck.

Arbetsflöde för sgRNA bibliotek screening var kortfattat beskrivs (figur 3). Det första genererades virus innehållande sgRNA biblioteket i HEK293T celler med hjälp av två vektorer (psPAX2 och pMD2.G). sgRNA poolade bibliotek lentiviruses var koncentrerad och sensorik i MOLM13 AML celler med polybrane (8,0 µg/mL). Efter en 48 h transduktion behandlades celler med den optimala koncentrationen av puromycin. Efter 5 dagar, cellerna var seedad en cell per brunn i plattor med 96 brunnar och enda klonerna genererades i närvaro av puromycin. Slutligen sgRNA enda kloner integreras i genomet identifierades av one-step RT-PCR, Sanger sekvensering och ditsatta mutation detektion (figur 3). Puromycin resistenta enda klonerna identifieras genom one-step droplet digital RT-qPCR (RT-ddqPCR) enligt att ändra uttrycket av HOXA9 onkogen (figur 4). Genotypning och Sanger sekvens utfördes för sgRNA bibliotek konstruktion och verifiering (figur 2, figur 4).

sgRNA inriktning MOLM13 positiva kloner i en PCR-plattan med 96 brunnar bekräftades ytterligare med RT-qPCR-metoden baserat påuttrycksnivåerna för HOXA9 gener genom jämförelse med kontroll celler. Ur de 528 överlevande kloner screening, 10 kloner uppvisade mer än 50% reduktion av HOXA9 nivåer (figur 4A). sgRNAs integreras med den HOXA9-minskas, HOXA9-oförändrad, och HOXA9-ökad kloner bekräftades ytterligare av PCR-amplifiering av de sgRNA sekvenser med beledsagande vektor primers. De rena PCR-produkterna var sammanskrivna in i T vector systemet genom T4 ligase och skickas ut för identifiering av Sanger sekvens (se steg 8). Sekvens uppgifterna visade att 21 kloner av 30 kloner sekvenserade, ingår enda sgRNA (tabell 2). Kategorierna av sgRNA var identifieras och analyseras enligt HOXA9 uttrycksnivåerna. Sex av tio kloner visar en minskning i HOXA9 nivåer innehöll sgRNAs inriktning webbplatsen CBS7/9, men inte i de icke-mänskliga generna, slumpmässiga mänskliga gener och andra SAP webbplats kontroller (figur 4 och tabell 2).

sgRNA integrerade positiva enda klon-inducerad ditsatta mutationer bestäms av PCR-baserad genotypning och nuclease matsmältningen baserat på nuclease analysen (figur 5). Nuclease matsmältningen analysen har utförts för att identifiera ditsatta mutationer påträffades i CBS7/9 gränsen i den representativa HOXA9-minskas, HOXA9 -oförändrad och HOXA9 -ökad kloner. Resultaten visade att CBS7/9 mutationen har hittats i 4 av de 6 HOXA9-minskad kloner: kloner #5, 6, 28 och 121, men inte i kloner #15 och #31 (figur 5). Men klon #15 innehöll den sgRNA inriktning HOTTIP lncRNA webbplats, medan klon #31 innehöll flera sgRNAs inriktning HOAIRM1 lncRNA, HOTAIR lncRNA och HOXD9/10 SAP bindningsstället (siffror 4B, 5 och tabell 2).

Figure 1
Figur 1 : Schematiskt diagram visar SAP bindningsställen och lncRNAs i fyra HOX gen loci. Varje inriktning DNA-element innehåller 5-10 olika sgRNAs. SAP ChIP-seq datamängd hämtades från GEO (GSM1335528) och visualiseras med integrerad genomisk Viewer (IGV). SgRNA inriktning SAP platser i HOX loci var märkt med orange sax. Klicka här för att se en större version av denna siffra. 

Figure 2
Figur 2 : Schematiskt diagram som representerar delen av att integrera sgRNA vector sekvens och PCR-amplifiering primers. PCR-amplifiering primers utformades enligt Tom sekvens av sgRNA lentiviral vektorn. Framåt primern (P1) lyftes i gult, reverse primer (P2) lyftes i rött, och sgRNA var markerats med grönt i sgRNA lentiviral vektorn. Klicka här för att se en större version av denna siffra. 

Figure 3
Figur 3 : Schematiskt diagram som representerar arbetsflödet för sgRNAs bibliotek design, konstruktion och verifiering. Arbetsflödet är som följer. Först sgRNA biblioteket ritades och klonade in en lentiviral CRISPR vektor, och sedan lentivirus levererades tillsammans med de sgRNA bibliotek lentiviral vector, psPAX2 och pMD2.G vektorerna i HEK293T celler. Nästa, MOLM13 celler var infekterade med en låg MOI (0,3) virus och dessa celler genomgick puromycin urval. Den enda klonen var då, seedade i en plattan med 96 brunnar. Slutligen identifierades sgRNA enda klonerna integreras i en genomet av one-step RT-qPCR, Sanger sekvens och ditsatta mutation upptäckt. Klicka här för att se en större version av denna siffra. 

Figure 4
Figur 4 : Poolade CRISPR-Cas9 KO bibliotek screening identifieras med one-step RT-qPCR och Sanger sekvens. (A) ett steg RT-droplet PCR biografvisning av HOXA9 uttrycket i enda kloner infekterade med lentivirus som innehåller sgRNA biblioteket. Screening av 528 sgRNA bibliotek infekterade kloner för HOXA9 uttrycksnivåerna visas (528 prickar). Tio av 528 kloner uppvisade mer än 50% reduktion av HOXA9 nivåer (lila pilarna). Den röda linjen betecknar gränsen för en 2-faldig minskning förändring genom att jämföra med de kontroll cellerna; den blå linjen betecknar gränsen för en 2-faldig ökning förändring. (B) sex kloner #5, 6, 28, 121, 207 och 420 var måltavla för den CBS7/9 särskilda sgRNA genom Sanger sekvens (gröna pilar). (C), RT-ddqPCR analys av HOXA9 nivåer i WT MOLM13 och 21 kloner som innehåller enstaka riktade sgRNA. HOXA9 uttrycket data grupperades i fem grupper i enlighet med kategorierna av sgRNA sekvenser: HOXA7/9 SAP plats, icke-mänskliga mål, andra SAP platser i de HOX loci, HOX associerade lncRNAs, och andra mänskliga mål. Denna siffra har ändrats från Luo et al.12. För statistik representerades denna data som den medelvärde ± SD från tre oberoende experiment med Students t-test. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 : Ditsatta mutationer av integrerade sgRNAs positiva klon bekräftade med PCR-baserad genotypning och nuclease analys. (A)  Genomiskt DNA isolerades från de representativa CRISPR-Cas9 KO bibliotek skärmad kloner som uppvisade minskad, oförändrad eller ökad HOXA9 uttrycksnivåerna. Heterozygot strykningen av SAP platsen ligger mellan HOXA7 och HOXA9 gener (CBS7/9 gräns) identifierades av PCR-baserad genotypning. Den HOXA9-minskade kloner #5, 6, 28 och 121 uppvisade radering på CBS7/9 gräns plats (svarta pilar). (B) The ditsatta mutationer i webbplatsen CBS7/9 analyserades av nuclease matsmältningen analysen från representativa klonerna som uppvisade minskad (röda linjen), oförändrad (blå linje) eller ökade (lila linje) HOXA9 uttryck nivåer. Den HOXA9-minskade kloner #5, 6, 28 och 121 uppvisade mutationer i CBS7/9 gräns platsen (orange pilar). Denna siffra har ändrats från Luo et al.12Klicka här för att se en större version av denna siffra. 

Tabell 1: sgRNAs biljard bibliotek målobjektet information. Informationen är från Luo et al.12Vänligen klicka här för att hämta tabellen.

Tabell 2: Sanger sekvensering resultaten av sgRNAs som presenteras i den valda HOXA9 -minskade, HOXA9 -oförändrad, och HOXA9 -ökade kloner. HOXA9-minskad, oförändrad och ökad kloner är markerade i rött, blått och lila, separat. Informationen är från Luo et al.12Vänligen klicka här för att hämta tabellen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protein-kodning gen relaterade sgRNA bibliotek har tillämpat en funktionell screening system för att identifiera gener och nätverk som reglerar specifika cellulära funktioner genom sgRNA anrikning24,25,26 ,27,28. Flera icke-kodande regionen relaterade sgRNA bibliotek visades också i gen-specifika funktionella skärmar för distala och proximala reglerar element, inklusive BCL11A, Tdgf1a och läkemedelsresistens reglerar gener28, 29,30. Alla dessa sgRNA bibliotek genererades av en detaljerad bioinformatik design, oligonukleotid syntes och sub kloning av oligonukleotiden felskydd till vektorer. Metoden hela genome-wide screening är mycket kraftfull och användbar men kräver computational expertis för genome-wide sgRNA design och konsekvent finansiering för dyra syntes; Därför är det fortfarande svårt för de flesta laboratorier. Men är vårt loci-specifika sgRNA bibliotek screening strategi både praktiskt och effektivt att identifiera de specifika DNA-elementet såsom SAP bindningsstället inblandade i kromatin organisation och Transkriptionsreglering (figur 1 (och figur 2). Genom att rikta SAP gränserna, tillämpat vi en one-step RT-PCR för att utvärdera sgRNA riktade kloner enligt nivån uttryck av en specifik markörgen, HOXA9. Dessutom vi utfört Sanger sekvensering att bekräfta dessa positiva integrerade sgRNAs kloner (figur 2 och figur 4). Funktionellt bekräfta dessa positiva sgRNAs riktade kloner, genomförde vi en PCR-baserad genotypning och mutation detection test för att avgöra huruvida sgRNA inducerar target webbplats infoga eller radering mutationer (figur 5). Detta ger oss en lovande metod att rikta specifika icke-kodande DNA-element och utvärdera deras biologiska funktion i däggdjursceller.

I våra protokoll, nämnde vi att en specifik oligonukleotiden design kommer att säkerställa effektivare sub kloning i lentiCRIPSRV2 vektorer och mer tillförlitligt generera en korrekt sgRNA bibliotek (steg 1 – 2). För att erhålla en hög titer sgRNA bibliotek lentivirus, bör lentiviral supernatanten koncentreras 50-fold använder Platskoncentratorn efter protokollet (steg 3), och lagras i-80 ° C frys i flera alikvoter (steg 3.1 – 3.5). En ytterligare fråga är att hitta det optimala MOI värdet för transduktion. Om MOI är för låg, kommer antalet infekterade blodkroppar minska och leda till sgRNA screening misslyckande. Om MOI är för hög, det kommer att integrera mer än en sgRNA i en enda cell, och det kommer störa sgRNA biblioteket screening genom one-step RT-PCR och ditsatta mutation upptäckt. Därför före screening, att hitta den optimala MOI för varje grupp av celler genom titrering av lentiviral biblioteket är ett viktigt steg. Titrering av lentiviral biblioteket i MOLM13 leukemiceller och utvärdering av MOI kommer att genomföras i protokollet (steg 5.1 – 5.10). Dessutom kan en grundlig lyseringslösning av celler för omvänd transkription säkerställa framgångsrika one-step RT-PCR. Detta kan göras genom att öka inkubationstiden för Lys alla skeden temperatur i protokollet (steg 7,5 – 7,6). Därför, för att öka den effektiva för screening av poolade CRISPR-Cas9 KO biblioteket, grundlig cell lysis och omvänd transkription spelar en avgörande roll vid fastställandet av den one-step RT-qPCR (steg 7,1 – 7.14). Dessutom kan ökar kvaliteten på PCR-produkter säkerställa framgångsrika ditsatta mutation upptäckt, eftersom låg kvalitet PCR-produkter kommer att påverka heteroduplex/homoduplex generation processen (steg 9,1 –.6).

Dessutom kan metoden användas för att identifiera SAP roll i HOX genreglering i tidig embryonal utveckling och vissa leukemi med avvikande HOX gener signatur. Till exempel HOX gener spelar viktiga roller under fosterutvecklingen och alla fyra kluster av HOX gens begränsas temporally och rumsligt i deras uttrycksmönster i embryonal utveckling. NPM1 mutationer är dessutom bland det vanligaste genetiska avvikelsen i AML och står för 30% av AML patienter med normala cytogenetiska Karyotyp31. Denna delmängd av AML uppvisar en avvikande HOXA och HOXB gen signatur, som blir en dominerande mekanismen av leukemiska omvandling17. Det är viktigt att belysa hur HOX gener regleras i normala utveckling och dysreglerad under leukemogenesis. Vi och andra har visat att SAP spelar en viktig roll i kromatin organisation och gen transkription i HOX loci9,12. Således, HOX loci fokuserade sgRNA bibliotek screening ger ett bekvämt sätt att förveckla den specifika funktionen av SAP bindningsstället i HOX genreglering vid utveckling och hematopoetiska maligniteter. En begränsning i metoden är dock svårigheten att hitta en användbar markör för hög genomströmning nästa generations sekvensering. En av de framtida forskning mål blir att hitta en mycket selektiv markör och genomföra genome-wide nästa generations sekvensering för att se i markörens effekter. Därför använder en specifik fluorescerande markör-taggade gen som spårning reporter kommer att bli ett avgörande verktyg i framtiden forskningsplaner.

Enhancers spela en mängd kritiska roller i regleringen av promotorn funktion och gen uttryck. Men det kan också aktivera arrangören aktivitet från långa avstånd i en position och orientering oberoende sätt och Smakförstärkare reglerar ofta genuttryck i trans orientering. Således det svårt att peka ut enhancer(s) för specifika gener, särskilt i postgenomisk eran. Traditionella reporter analyser och korrelat funktionella analyser (t.ex. kromatin immunoprecipitation och DNaseI överkänsliga analyser) har använts att undersöka enhancer funktion32,33. Små skalade locus-fokuserad filmvisningar tillämpades på samma sätt också för att utforska distala och proximala reglerande element för specifika gener34verksamhet. Nyligen, den poolade sgRNA-KO-Biblioteksstrategi som mål icke-kodande reglerande element i de HOX gener loci framgångsrikt identifierat en SAP bindningsställe ligger mellan HOXA7 och HOXA9 gener, liksom en HOTTIP lncRNA som är kritiska för att kontrollera bakre HOXA kromatin domän organisation, som driver ektopisk HOXA genuttryck i akut myeloisk leukemi (AML)12. Dessa studier visade att poolade sgRNA-KO bibliotek screening är också en kraftfull genetik metod att identifiera och utvärdera biologisk funktion av icke-kodande element i vår arvsmassa som är på plats.

SAP, spelar som en kromatin isolator protein, en viktig roll i genome organisation genom att definiera kromatin stadsdelar för specifik gen uttrycksmönster i viss cell typ11,35. Ändring av topologically associerade domänstruktur (TAD) ändrar förstärkare/arrangören interaktioner, vilket resulterar i en diseased state5,11. SAP är starkt bevarad i metazoan och är berikad på TAD gränserna. Det är dock oklart om och hur SAP bidrar till att upprätthålla gränsen kromatinstruktur och TAD bildandet. Även om poolade SAP sgRNA-knockout bibliotek screening var inriktad på de fyra HOX -lokus, visade det sig vara en kraftfull metod för att identifiera och dissekera SAP gränser och definiera TAD domän samt förstärkare/arrangören interaktion och transkription inom TAD domän12. Dessutom kan denna metod användas effektivt för att identifiera lncRNA element och transkriptionsfaktorer som förmedlar kromatin konformation och tillgänglighet aktivitet i HOX loci. Vi försöker också att utforska CRISPR/sgRNA biblioteket som innehåller genome-wide SAP webbplatser genom nästa generations sekvensering identifiering enligt den SAP ChIP-seq och ChIA-PET data i framtida forskning. Denna strategi kan således förlängas till en hel kromosom eller ens hela genomet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Vi har inga intressekonflikter som relaterade till detta betänkande.

Acknowledgments

Författarna också tacka Nicholas Cesari för redigering manuskriptet. Arbetet har finansierats genom bidrag från National Institute of Health (S.H., R01DK110108, R01CA204044).

Materials

Name Company Catalog Number Comments
Lipofectamine 3000 reagent Thermo Fisher Scientific L3000-008
Proteinase K Thermo Fisher Scientific 25530049
Puromycin Thermo Fisher Scientific A1113802
Stbl3 cells  Life Technologies  C737303
HEK293T ATCC CRL-3216
MOLM-13 DSMZ ACC 554
lentiCRISPRv2 Addgene 52961
pMD2.G Addgene 12259
psPAX2 Addgene 12260
pGEM®-T Easy Vector Systems  Promega A137A
T4 ligase  New England Biolabs  M0202S
QIAquick Gel Extract kit QIAGEN 28706
QIAuick PCR purification kit QIAGEN 28106
SingleShot™ SYBR® Green One-Step Kit Bio-Rad Laboratories 1725095
QIAGEN Plasmid Maxi Kit QIAGEN 12163
Dulbecco’s Modified Eagle Medium  Thermo Fisher Scientific  11965084
RPMI 1640  Thermo Fisher Scientific 11875093
Fetal bovine serum (FBS)  Thermo Fisher Scientific 10-082-147
Penicillin/streptomycin/L-glutamine  Life Technologies  10378016
Lenti-X Concentrator  Clontech 631232
Trypan Blue Solution Thermo Fisher Scientific 15250061
Polybrene Santa Cruz Biotechnology sc-134220
Phosphate Buffered Saline (PBS)  Genessee Scientific  25-507
TAE buffer  Thermo Fisher Scientific  FERB49
Surveyor® Mutation Detection Kits Integrated DNA Technologies 706020
Biorad Universal Hood II Gel Doc System Bio-Rad 170-8126
Centrifuge 5424 R Eppendorf 5404000138
Digital Dry Baths/Block Heaters Thermo Fisher Scientific 88870002
TSX Series Ultra-Low Freezers Thermo Fisher Scientific TSX40086V
Forma™ Steri-Cult™ CO2 Incubators Thermo Fisher Scientific 3308
Herasafe™ KS, Class II Biological Safety Cabinet Thermo Fisher Scientific 51022484
Sorvall™ Legend™ XT/XF Centrifuge Series Thermo Fisher Scientific 75004506
Fisherbrand™ Isotemp™ Water Baths Thermo Fisher Scientific FSGPD02
Thermo Scientific™ Locator™ Plus Rack and Box Systems Thermo Fisher Scientific 13-762-353
CFX96 Touch Real-Time PCR Detection System Bio-Rad 1855195
MiniAmp™ Thermal Cycler Applied Biosystems technology A37834
Thermo Scientific™ Owl™ EC300XL2 Compact Power Supply Thermo Fisher Scientific 7217581
Thermo Scientific™ Owl™ EasyCast™ B1 Mini Gel Electrophoresis Systems Thermo Fisher Scientific 09-528-178
VWR® Tube Rotator and Rotisseries VWR International 10136-084
VWR® Incubating Mini Shaker VWR International 12620-942
Analytical Balance MS104TS/00 METTLER TOLEDO 30133522
DS-11 FX and DS-11 FX+ Spectrophotometer DeNovix Inc. DS-11 FX

DOWNLOAD MATERIALS LIST

References

  1. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  2. Cuddapah, S., et al. Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome research. 19, (1), 24-32 (2009).
  3. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137, (7), 1194-1211 (2009).
  4. Tang, Z., et al. CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription. Cell. 163, (7), 1611-1627 (2015).
  5. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, (5), 1012-1025 (2015).
  6. Dowen, J. M., et al. Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes. Cell. 159, (2), 374-387 (2014).
  7. Phillips-Cremins, J. E., et al. Architectural protein subclasses shape 3D organization of genomes during lineage commitment. Cell. 153, (6), 1281-1295 (2013).
  8. Narendra, V., Bulajic, M., Dekker, J., Mazzoni, E. O., Reinberg, D. CTCF-mediated topological boundaries during development foster appropriate gene regulation. Genes & Development. 30, (24), 2657-2662 (2016).
  9. Narendra, V., et al. CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. Science. 347, (6225), 1017-1021 (2015).
  10. Deng, C., et al. HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development. Cell Reports. 14, (1), 103-114 (2016).
  11. Patel, B., et al. Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia. Leukemia. 28, (2), 349-361 (2014).
  12. Luo, H., et al. CTCF boundary remodels chromatin domain and drives aberrant HOX gene transcription in acute myeloid leukemia. Blood. 132, (8), 837-848 (2018).
  13. Dou, D. R., et al. Medial HOXA genes demarcate haematopoietic stem cell fate during human development. Nature Cell Biology. 18, (6), 595-606 (2016).
  14. Lawrence, H. J., et al. Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood. 106, (12), 3988-3994 (2005).
  15. Deng, C., et al. USF1 and hSET1A mediated epigenetic modifications regulate lineage differentiation and HoxB4 transcription. PLOS Genetics. 9, (6), e1003524 (2013).
  16. Rawat, V. P., Humphries, R. K., Buske, C. Beyond Hox: the role of ParaHox genes in normal and malignant hematopoiesis. Blood. 120, (3), 519-527 (2012).
  17. Alharbi, R. A., Pettengell, R., Pandha, H. S., Morgan, R. The role of HOX genes in normal hematopoiesis and acute leukemia. Leukemia. 27, (5), 1000-1008 (2013).
  18. Rice, K. L., Licht, J. D. HOX deregulation in acute myeloid leukemia. Journal of Clinical Investigation. 117, (4), 865-868 (2007).
  19. Bassett, A. R., Kong, L., Liu, J. L. A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells. Journal of Genetics and Genomics. 42, (6), 301-309 (2015).
  20. Zhu, S., et al. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nature Biotechnology. 34, (12), 1279-1286 (2016).
  21. Kurata, J. S., Lin, R. J. MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs. RNA. 24, (7), 966-981 (2018).
  22. Collins, C. T., Hess, J. L. Role of HOXA9 in leukemia: dysregulation, cofactors and essential targets. Oncogene. 35, (9), 1090-1098 (2016).
  23. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., Sauvageau, G. NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. The EMBO Journal. 20, (3), 350-361 (2001).
  24. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology. 32, (3), 267-273 (2014).
  25. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  26. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  27. Zhou, J., et al. Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting. The FEBS Journal. 281, (7), 1717-1725 (2014).
  28. Sanjana, N. E., et al. High-resolution interrogation of functional elements in the noncoding genome. Science. 353, (6307), 1545-1549 (2016).
  29. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, (2), 167-174 (2016).
  30. Korkmaz, G., et al. Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9. Nature Biotechnology. 34, (2), 192-198 (2016).
  31. Rezaei, N., et al. FMS-Like Tyrosine Kinase 3 (FLT3) and Nucleophosmin 1 (NPM1) in Iranian Adult Acute Myeloid Leukemia Patients with Normal Karyotypes: Mutation Status and Clinical and Laboratory Characteristics. Turkish Journal of Haematology. 34, (4), 300-306 (2017).
  32. Yaragatti, M., Basilico, C., Dailey, L. Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions. Genome Research. 18, (6), 930-938 (2008).
  33. Wilken, M. S., et al. DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements. Epigenetics Chromatin. 8, 8 (2015).
  34. Narlikar, L., Ovcharenko, I. Identifying regulatory elements in eukaryotic genomes. Briefings in Functional Genomics and Proteomics. 8, (4), 215-230 (2009).
  35. Hnisz, D., et al. Activation of proto-oncogenes by disruption of chromosome neighborhoods. Science. 351, (6280), 1454-1458 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics