Модель неслучайной мыши для фармакологической активации Mecp2 на неактивной х-хромосоме

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы описываем протокол для создания жизнеспособной женской модели Мурины с неслучайной инактивации х-хромосомы, т. е., унаследованная по наследству х-хромосома неактивна в 100% клеток. Мы также описываем протокол для проверки осуществимости, переносимости и безопасности фармакологической активации неактивной х-хромосомы в естественных условиях.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X-хромосома инактивации (XCI) является случайный глушителей одной х-хромосоме у женщин для достижения баланса гена дозировки между полами. В результате, все самки гетерозиготные для X-сцеженный экспрессии генов. Одним из ключевых регуляторов XCI является Xci, который имеет важное значение для инициирования и поддержания xci. Предыдущие исследования выявили 13 транс действующих факторов инактивации X хромосом (XCIFs), используя крупномасштабные, потери функции генетического экрана. Ингибирование XCIFs, таких как ACVR1 и PDPK1, используя короткую шпильку РНК или малых ингибиторов молекул, активирует X хромосома связаны генов в культивируемых клеток. Но осуществимость и переносимость повторного активации неактивной х-хромосомы в естественных условиях еще предстоит определить. К этой цели, модель мыши ксистδ: Mecp2/Xist: Mecp2-GFP была сгенерированный с non-случайным Xist из-за удаления Xist на одной X хромосоме. При использовании этой модели степень неактивного X реактивации была количественно в мозге мыши после лечения ингибиторами КСИФ. Недавно опубликованные результаты показывают, впервые, что Фармакологическое торможение XCIFs активирует Mecp2 из неактивной х-хромосомы в корковых нейронами мозга живого мыши.

Introduction

X-хромосома инактивации (XCI) является процесс дозировки компенсации, которая уравновешивает X-сцеженно экспрессии генов, глушителей одной копии х-хромосоме у самок1. В результате неактивная х-хромосома (XI) накапливает характерные особенности гетьхроматина, включая метилирование ДНК и ингибирующие гистоун модификации, такие как гистоун Н3-лизин 27 триметилирования (H3K27me3) и гистоун Н2А убиквителинация (H2Aub) 2. Мастер регулятор глушителей x-хромосомы является x-инактивации центр (XIC) область, вокруг 100 − 500 КБ, который контролирует подсчет и спаривание х-хромосом, случайный выбор х-хромосомы для инактивации, и инициирования и распространение глушителей по X хромосоме3. Процесс х инактивации инициируется X неактивные конкретные Стенограмма (Xist), что пальто XI в СНГ , чтобы посредничать хромосомы всей глушителей и переделывать трехмерную структуру х-хромосоме4. В последнее время несколько протеомических и генетических экранов выявили дополнительные регуляторы xci, такие как xci взаимодействующие белки5,6,7,8,9 , 10 , 11 , 12. Например, в предыдущем исследовании с использованием беспристрастного генома на экране РНК-интерференции были определены 13 трансдействующих факторов Xci (xcifs)12. Механистично, XCIFs регулирует Xist выражение и поэтому, вмешиваясь в функции xcifs вызывает ДЕФЕКТНЫЙ xci12. В совокупности недавние достижения в этой области обеспечили важное понимание молекулярного механизма, необходимого для инициирования и поддержания XCI.

Идентификация регуляторов xci и понимание их механизма в xci напрямую связаны с х-связанными заболеваниями человека, такими как синдром Ретта (RTT)13,14. RTT является редким нейроразвития расстройство вызвано гетерозиготной мутации в X-связанной метил-CpG связывающий белок 2 (MECP2), который затрагивает преимущественно девочек15. Потому что MECP2 находится на х-хромосоме, RTT девушки гетерозиготных для MECP2 дефицита с ~ 50% клеток, выражающих дикого типа и ~ 50% выражения мутант MECP2. Примечательно, что клетки мутанта RTT гавани спящие, но дикого типа копия Mecp2 на XI, обеспечивая источник функционального гена, который, если возобновлена, потенциально может облегчить симптомы болезни. В дополнение к RTT, есть несколько других х-связанных заболеваний человека, для которых реактивации XI представляет потенциальный терапевтический подход, таких как синдром DDX3X.

Ингибирование XCIFs, 3-фосфоиноситиде зависимых протеинкиназы-1 (PDPK1), и Активо рецептор типа 1 (ACVR1), либо короткой РНК-шпилька (Шрана), либо малых ингибиторов молекул, активирует XI-сцеживание генов12. Фармакологическая Реактивация XI связанных генов наблюдается в различных бывших моделях в естественных условиях, которые включают клеточные линии фиброза мыши, Взрослый корковых нейронов мыши, мышь эмбриональных фибробласты, и фиброза клеточных линий, полученных от пациента RTT12. Однако, является ли Фармакологическое возобновление XI связанных генов возможно в естественных условиях еще предстоит продемонстрировать. Одним из ограничивающих факторов является отсутствие эффективных моделей животных, позволяющих точно измерить экспрессию генов у активированным XI. К этой цели, ксистδ: Mecp2/Xist: Mecp2-GFP мышь модель была сгенерирована, что несет генетически помечены Mecp2 на XI во всех клетках из-за гетерозиготного удаления в Xist на материнской X хромосоме16. С помощью этой модели, выражение Mecp2 из XI было кванцирован после лечения ингибиторами XCIFs в мозге живых мышей. Здесь описывается генерация модели мыши ксистδ: Mecp2/Xist: Mecp2-GFP и методология Квантета Си реактивации в корковых нейронами с использованием метода иммунофлуоресцентного анализа.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Работа с участием мышей была одобрена университетом Вирджинии институциональных Комитета по уходу за животными и использования (ЯКУЦ; #4112).

1. генерировать Неслучайные XCI мышь модель с генетически помечены Mecp2 на XI

Примечание: Мыши штаммов, используемых в исследовании были следующие: Mecp2-GFP/Mecp2-GFP (Mecp2TM 3.1 птица, таблица материалов) и Xist/δксист (В6; 129-Xist < tm5Sado >; предоставляемые Антонио бедалов, Фред Онкологический центр Хатчинсона, Сиэтл). Селекция стратегии среди соответствующих штаммов были разработаны для расширения мыши колоний для каждого штамма.

  1. Выполните СР-Генотипирование на всех штаммов мышей и соответствующих нерадивых, полученных после размножения с использованием гена конкретных праймеров, перечисленных в таблице 1.

2. Разработка стратегии разведения мыши для генерации ксистδ: Mecp2/Xist: Mecp2-GFP

  1. Установите разведение пары жильем Mecp2-GFP/Y мужчин и Ксистδ-Mecp2/Xist-Mecp2 женского пола вместе (12 ч/12 ч: свет/темный цикл) (рис. 1A). В идеале, создать по крайней мере 5 гнездящихся пар в то время, с использованием жизнеспособных и плодородных мышей. После того, как беременная женщина рожает, позвольте ей поднять свой первый помет с мужчиной.
    Примечание: Потому что по отцовской Xist нокаут ухудшает ЗАПЕЧАТЛЕЛ Xist, дозировка компенсации, и дифференциация пути17, использование ксистδ-Mecp2/Y мышей в разведении не сможет производить детенышей женского пола с обязательным генотипом.
  2. После отъема помёта в послеродовой день 21 (P21), идентифицируют и помечать ксистδ: Mecp2/Xist: Mecp2-GFP щенков женского пола с использованием методом анализа генотипирования (Рисунок 1B).
    Примечание: С точки зрения количества животных, необходимых в группе, для результатов сообщили ниже, 5 гнездящихся пар были созданы, которые вызвали около 10 женщин ксистδ: Mecp2/Xist: Mecp2-GFP мышей.
  3. Используйте женские модели мышей для всех предлагаемых экспериментов.
    Примечание: Секс является важной биологической переменной для исследований XCI, и мужская модель не учитывает смешанные эффекты случайного XCI.
  4. Чтобы быть последовательными во всех исследованиях на животных и исключить любые последствия животного возраста, выполните все эксперименты в 5 − 8-недельного женского ксистδ: Mecp2/Xist: Mecp2-GFP мышей.

3. изолировать женский ксистδ: Mecp2/Xist: Mecp2-GFP мышь эмбриональные фибробласты (MEFS)

  1. Настройка приурочена спаривания между Mecp2-GFP/Y мужчины и ксистδ-Mecp2/Xist-Mecp2 женского пола. Установите по крайней мере 3 − 4 клетки спаривания, чтобы увеличить вероятность беременности.
  2. После подтверждения вагинальный плагин утром после спаривания, отдельные женщины и в этот день считается эмбриональный день 0,5 (E 0.5). Контролируйте увеличение веса предполагаемой беременной женщины и визуально осмотрите живот мышей для того чтобы подтвердить стельность. На е в. р. − в., усыпить беременных самок мышей через вывиха шейки матки.
  3. Под ламинара капюшон протрите живот беременной самки с 70% этанола. Используя стерильные ножницы, рассекают брюшную полость и удаляют рога матки, содержащие эмбрионы. При помощи щипцов осторожно выберите эмбрионы, отрезая оставшуюся брюшную ткань (обычно ожидается 6 − 12 эмбрионов).
  4. Поместите рога матки, содержащие эмбрионы в 10-миллиметровую ткань-блюдо культуры. Используя стерильные ножницы и щипцы, сделайте разрез вдоль рогов матки, чтобы изолировать отдельные мешочки, несущие эмбрион. Аккуратно поместите рога матки, содержащие остальные эмбрионы, в 30 мл сбалансированного солевого раствора стерильных Хэнкса (ГБСС) на льду.
  5. Аккуратно разрезать мешочек и изолировать эмбрион с помощью стерильных ножниц и щипцов. Удалить плаценту путем разрезания пуповины.
  6. Обезглавить эмбрион.
    Примечание: В то время как остальная часть эмбриональной ткани будет дополнительно обработаны, ткань из головы эмбриона будет использоваться для изоляции ДНК для генотипирования.
  7. Откройте живот, разрезав срединную линию эмбриона, используя стерильные ножницы и щипцы. Удалите висцеральные органы, такие как сердце, печень и легкие.
  8. Перенесите оставшуюся эмбриональную ткань в стерильный 60-мм тканевая плита и нарезать небольшими кусочками ножницами или лезвием бритвы. Чтобы сломать открыть ячейки сгустки, добавить 3 мл трипсина-ЭДТА (0,05%) и инкубировать при температуре 37 ° c в течение 15 мин.
  9. Нейтрализовать трипсин-ЭДТА, добавив 5 мл модифицированной среды орла Дульбекко (дмэм) с 10% фетальной бычьей сыворотки (ФПС) и 10 мкг/мл пенициллин/стрептомицина (ручка/стрептококк) к пластине и отделить ткани повторяющимися пипеткой (приблизительно 20 − 30 раз).
  10. Спин вниз клеток на 300 x g в течение 5 мин и повторно приостановить ячейки гранул в 4 мл ДМЕ с 10% ФБС и 10 мкг/мл пера/стрептококк. Пластина клетки на 60 mm культуры блюдо, и культура клеток при 37 ° c в присутствии 5% CO2.
  11. Выполните шаги 3.5 − 3.10 для каждого эмбриона.
  12. Культура MEFs получена в шаге 3,11 в течение не менее 3 − 4 дней.
    Примечание: На этом этапе MEFs также могут быть криоконсервированными для будущих экспериментов.
  13. Для определения пола и генотипа каждого эмбриона, проводить Генотипирование-ЦР с использованием ДНК изолированы от голов эмбрионов с использованием праймеров и ЦР-состояний, перечисленных в таблице 1.

4. подтверждают отсутствие зеленого флуоресцентного белка (GFP) выражение в головном мозге ксистδ: Mecp2/Xist: Mecp2-GFP мышей с использованием Флуорошение активированной ячейки сортировки основе анализа

  1. Использование ножниц, отделить кору головного мозга от остальной части полушарий, и поместить в 1 мл льда-холодных ядер изолятора (Нима) буфер, содержащий 250 mM сахароза, 25 мм хлорид калия (KCl), 5 мм магния хлорида (MgCl2), 10 мм рис-CL, дополнено 2% параформальдегидом (ФА) и 0,1% нонионическим сурфактантом (таблица материалов).
  2. Гомогенизации с использованием ледяной стекла гогонизации.
  3. Спин вниз однородно ткани на 600 х г, 4 °c за 5 мин.
  4. Удалите супернатант и ресуспензируем гранулы в 1 мл 25% ййкханола в растворе Нима.
  5. Добавить 1 мл 29% лодикханола в раствор Нима в 4 мл трубки ультраentrifuge (хранить на льду, пока образцы не будут готовы) и тщательно слой 1 мл образца (в 25% ледикханол).
  6. Центрифуга при 9 000 х г, 4 °c за 10 мин в ультраэнтрифуге.
  7. Аспирин супернатант и ресуспензируем гранулы в 500 мкл флуоресцентного сортировки активированной ячейки (FACS) буфера (фосфат-буфер физиологического раствора [PBS], дополненный 1 мм ЭДТА, 0,05% натрия азид, и 2% бычий сывороточный альбумин [БСА]).
    Примечание: Образцы могут храниться при температуре 4 ° c или до 1 недели.
  8. Добавить 5 мкл 7-амино-актиномицин D (7-ад; 50 мг/мл) в течение 5 минут при комнатной температуре, чтобы пятно ДНК.
  9. Проанализируйте образцы для 7-Аад и зеленого флуоресцентного белка (GFP) сигнала с использованием потока цитометрии.

5. определить целесообразность ксистδ: Mecp2/Xist: Mecp2-GFP мышь модель для XI реактивации

  1. Семя 1 x 105 клеток/мл женский ксистδ: Mecp2/Xist: Mecp2-GFP MEFS, Mecp2/Mecp2-GFP и Xist-Mecp2/Y MEFS получены в шаге 3,12 в формате 6-хорошо и в КАМЕРНЫХ слайдах, в дмэм с 10% ФПС и 10 мкг/мл ручка/стрептококк, при 37 °c в присутствии 5% CO2.
    Примечание: Mecp2/Mecp2-GFP и Xist-Mecp2/Y MEFS используются в качестве положительных и отрицательных элементов управления в экспериментах.
  2. Добавьте свежую среду в клетки после 24 ч. Для ксистδ: Mecp2/Xist: Mecp2-GFP MEFS, добавить средний дополненный ингибиторы XCIFs (например, 0,5 мкм LDN193189 и 2,5 мкм GSK650394), или транспортное средство в одиночку. Замените средство, дополненное свежим ингибитором или транспортным средством, только каждые 2 дня. Для Mecp2/Mecp2-GFP и Xist-Mecp2/Y MEFS добавляйте свежую среду каждые 2 дня.
  3. После 1 недели лечения ингибитора, урожай MEFs либо для изоляции РНК (6-хорошо пластины) или исправить клетки для иммунофлуоресценции (камерные слайды). Использование MEFs изолировано от эмбрионов Mecp2/Mecp2-GFP в качестве положительных и Xist-Mecp2/Y эмбрионов в качестве отрицательного контроля соответственно.
    1. Для изоляции РНК, изолировать общую РНК на основе guanidиния тианцианата базе РНК экстракции извлечения, и обратный транскрибировать с помощью обратной транскриптазы. Измерение экспрессии Mecp2-GFP путем количественного обратной транскриптазы-ЦР (QRT-ЦР) с использованием Mecp2-Вт и Mecp2-GFP, и праймеров, перечисленных в таблице 1, как описано ранее12.
    2. Для иммунофлуоресценции, пятно MEFS с анти-GFP первичных антител (1:100), как описано ранее12,16. Измерение интенсивности GFP за счет количественного иммунофлуоресценции при лечении препаратом ксистδ: Mecp2/Xist: Mecp2-GFP MEFS, как описано ранее18.

6. продемонстрировать фармакологические XI реактивации в головном мозге ксистδ: Mecp2/Xist: Mecp2-GFP мышь модель

  1. Подготовка лекарственных средств и управления транспортным средством.
    1. Подготовить свежее, стерильное решение транспортного средства (0,9% нав, 0,5% метилцеллюлозы, 4,5% диметилсульфоксид [ДДСО]) для инъекции мозга.
    2. Подготовка химических ингибиторов в том числе 1,5 mM LDN193189 (малый ингибитор молекулы ACVR1) и 1,6 mM GSK650394 (малый ингибитор молекулы SGK1, нисходящий эффектор PDPK1) повторно приостановлено в транспортном средстве (0,9% нав, 0,5% метилцеллюлозы, 4,5% ДДСО), или транспортного средства Один. Общий объем химических ингибиторов или транспортного средства вводится 10 мкл на дозу на одного животного.
  2. Подготовьте животное для инъекции мозга.
    1. Подготовьте хирургическую область, вытирая скамью и грелку с дезинфицирующим средством (10% раствора гипохлорита натрия).
    2. Обезболивание 4-недельной мыши с интраперитонеальная инъекцией кетамина/ксилазинового смеси в дозе 140 мг/кг и 10 мг/кг соответственно. Используйте рефлекс снятия педали, чтобы определить уровень анестезии.
    3. Применение офтальмологической мазь для глаз после индукции анестезии, чтобы предотвратить роговичной сушки.
    4. Сбрить мех от шеи до верхней части головы мыши.
    5. Положение мыши в стереотаксической платформе, зацепив резчик зубов мыши в баре укуса рыла и ужесточение носа зажим над мордой, гарантируя, что голова мыши находится на уровне плоскости.
    6. Отрегулируйте высоту баров уха, по мере необходимости, для достижения хвостовой части слухового прохода, обеспечивая их таким образом, что голова мыши находится в плоскости уровня и иммобилизованным на палец ощупь.
    7. Дезинфицировать головку мыши с чередованием салфеток актуальных антисептика, таких как Povidone-йод и 70% этанола.
  3. Вводить наркотики.
    1. Использование стерильного скальпеля, сделать 0,75 cm горизонтальный разрез в середине головы.
    2. С помощью 0,45-миллиметрового заусенца просверлите два симметричных отверстия над правым и левым корковым полушарием (2 мм от сагиттальной шва и 2 мм от ламдоидного шва, примерно посередине теменной кости).
    3. Прикрепите 10 мкл шприц к стереотаксической платформе прочно.
    4. Смешайте раствор химических ингибиторов и нарисуйте 10 мкл раствора в шприц. Избегайте пузырьков воздуха в шприце.
    5. Заранее шприц иглы в отверстие заусенца поддержание иглы перпендикулярно (90 °) к черепу. Когда игла пересекает череп, ноль координат на стереотаксической цифровой дисплей, а затем заранее кончик иглы, пока не достигнет глубины 2,5 мм.
    6. Вывести иглу 0,5 мм на глубину на 2 мм.
    7. Медленно впрыснуть 10 мкл раствора (~ 1 мин). После инъекции в комплекте, оставьте иглу в головном мозге на ~ 1 мин, а затем вывести иглу.
    8. Повторите инъекции для второго полушария (транспортное средство только контроль).
    9. При помощи швов или «кожный клей» закройте кожу мыши (если рана > 0,5 см как швы, так и «клей для кожи»).
    10. Ослабить ухо баров и удалить мышь из стереотаксической аппарата.
    11. Администрирование анальгетиков (бупренорфин SR 0,5 мг/кг IP) и поместить мышь на грелку установлен на 37 ° c до тех пор, пока животное приходит в сознание.
    12. После того, как мышь оповещения и отзывчивый, перенести животное обратно в свою первоначальную клетку.
    13. Повторите процедуру каждые 2 дня в течение 20 дней. Повторное бурение области не требуется для последующих инъекций.
  4. Изолируйте мозг мыши.
    1. После завершения режима дозы, усыпляем мышь в камере CO2 .
    2. Обездвижить мышь на поверхности с помощью игл.
    3. Сделайте боковой разрез через полость и брюшную стенку прямо под грудной клеткой, используя ножницы и щипцы. Тщательно отделить печень от диафрагмы.
    4. С помощью ножниц, вырезать диафрагму и продолжить резки по всей длине грудной клетки, чтобы разоблачить плевральную полость.
    5. С помощью ножниц сделайте разрез на заднем конце левого желудочка.
    6. Немедленно, Начните впрыскивать правую камеру сердца с ~ 15 mL PBS над ~ 2 min. изменение цвета печени от красного до бледно-розового свидетельствует о хорошей перфузии.
    7. Введите правую камеру сердца мыши с ~ 10 мл 4% параформальдегида в PBS более ~ 2 мин.
    8. Обезглавить мышь, и использовать ножницы, чтобы сделать срединный разрез кожи головы, чтобы разоблачить череп.
    9. Поместите один кончик ножницы в отверстие Магнум, и вырезать сбоку в череп к глазу. Повторите это упражнение для другой стороны. Старайтесь держать в конце ножницы, как поверхностные, как можно избежать травм головного мозга.
    10. Используйте ножницы, чтобы вырезать область между глазами и над носом мыши.
    11. Используйте щипцы, чтобы аккуратно очистить кости черепа от полушарий головного мозга.
    12. Поднимите мозг шпателем, и использовать ножницы, чтобы тщательно рассекать черепных нервных волокон, которые фиксируют его на череп.
    13. Поместите мозг на пластиковом блюде, вырезать мозжечок и обонятельные луковицы, и поместить мозг в 15 мл трубки заполнены 4% Фа является PBS.
  5. Крио-Секция мыши мозга.
    1. Fix мозга в 4% параформальдегид в PBS при температуре 4 °C в одночасье.
    2. Промыть мозг с PBS на 4 ° c по крайней мере 3x за 5 мин каждый.
    3. Маркировать одноразовые формы для кривого резервирования тканей.
    4. Вырезать передней части головного мозга с помощью ножниц и щипцов (начать делать ~ 5 мм разделы из инъекций сайтов).
    5. Перенесите мозг в криостарый с передней части мозга вниз для получения корональных разделов. Погрузите форму, содержащую мозг в оптимальной температуре резки соединения (Окт).
    6. Налейте жидкий азот в 10 мм пластиковой чашке Петри и поместите мозг в крио-формы в азот.
      Примечание: Важно ориентировать ткань как описано в шаге 6.5.5 для того чтобы направить секционирование мозга.
    7. Когда Окт является твердой белой, поместите замороженного мозга в-80 ° c морозильник для хранения.
    8. Equilibrate мозг до-20 ° c, по крайней мере 30 минут до секционирования с криостатом и криосекция (толщина 5 − 6 мкм) головного мозга, монтаж 2 − 3 секции на слайде. Слайды можно хранить при температуре-80 ° c для последующего использования.
  6. Определение XI реактивации с использованием подхода, основанного на иммунофлуоресценции.
    1. Перед началом процедуры окрашивания, сухие отделы мозга на ночь при температуре 4 ° c.
    2. Погрузите слайды в раствор для извлечения антигена (0,1 M лимонная кислота, 0,1 M рис-основание, pH = 6,0) на тепловой блок 100 °C в течение 5 мин.
    3. Вымойте слайды 4X с 1x PBS в течение 5 минут каждый при комнатной температуре.
    4. Погрузите слайды в блокирующий раствор (0,1 м в. н.4CL/PBS/0,2% желатин/0% нонионического сурфактанта) на 20 мин при комнатной температуре.
    5. Вымойте слайды 3x с мытья буфера (PBS/0,2% желатин) при комнатной температуре в течение 5 мин каждый.
    6. Пятна мозга разделы с анти-GFP-AlexaFluor647 (1:100) и анти-MAP2 (1:1000) антитела в среде инкубации (PBS/0,2% желатин/1% БСА) и инкубировать при 4 °C ночь.
    7. Собирают первичные антитела (могут быть повторно использованы). Вымойте слайды 4X с мытья буфера в общей сложности 30 мин при комнатной температуре.
    8. Инкубировать разделы мозга с козьим анти-куриный Фторессеин изоотионациана (FITC)-помечены вторичные антитела (1:1000) в инкубационной среде и инкубировать 1 − 2 ч при комнатной температуре в темноте.
    9. Вымойте слайды 4X с мытья буфера в общей сложности 30 мин при комнатной температуре.
    10. Поместите каплю монтажа среды с 4 ', 6-диамидино-2-фенилиндоле (DAPI) на 22 мм x 50 mm комбинезон, затем инвертировать покрывало на слайд, охватывающий все ткани разделов.
    11. Изображение на микроскопе и настроить изображения для контраста и яркости. Захват изображений и количественное число ГФФ-положительных клеток для лечения и медикаментозного лечение и транспортных средств, обработанных ксистδ: Mecp2/Xist: Mecp2-GFP мышь полушария мозга.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Для демонстрации целесообразности ксистδ: Mecp2/Xist: Mecp2-GFP модель мыши для XI реактивации исследования, ИНГИБИТОР xкиф-опосредованной активации XI связанных Mecp2-GFP был протестирован в эмбриональных фибробласты мыши (MEFS). Женский MEFs были изолированы от дня 15,5 ксистδ: Mecp2/Xist: Mecp2-GFP эмбрионов, как описано в разделе 3 (рис. 1a). Генотипы женского ксистδ: Mecp2/Xist: Mecp2-GFP MEFS были подтверждены ГЕНОТИПИРОВАНИЯ-ЦР, как описано ранее19 (рис. 1b), и FACS-анализ на основе (рис. 1b). MEFs лечились либо ДМСО, либо два препарата LDN193189 и GSK650394 (0,5 мкм и 2,5 мкм соответственно) в течение 7 дней. После медикаментозного лечения выражение Mecp2-GFP Отслежито QRT-СР. Как показано на рисунке 1D, медикаментозное лечение, но не ДДСО, возобновленные выражения XI-Mecp2-GFP. Затем была проведена количественная иммунофлуоресценция, чтобы определить степень экспрессии XI-Mecp2-GFP в индивидуальных MEFS, как описано в шаге 5.3.2. Сигнал от отрицательных-контроль MEFs изолированные от мужских эмбрионов (Mecp2/Y) был установлен в качестве фона, и ~ 66% от положительного контроля Mecp2-GFP/Mecp2 MEFS был ядерный сигнал GFP. Как и ожидалось, ксистδ: Mecp2/Xist: Mecp2-GFP MEFS, получавших ДМСО, имел очень низкий уровень ядерного ГПС (~ 3%). В отличие от этого, ~ 31% от наркотиков обработанных ксистδ: Mecp2/Xist: Mecp2 MEFS были позитивными для ядерного GFP (рис. 1E). Вместе эти результаты показывают, что ингибиторы КСИФ повторно активировать XI связанных Mecp2 в MEFS, но степень XI реактивации варьируется в популяции клеток.

Для оценки целесообразности фармакологического XI реактивации на основе подхода в естественных условиях, будь то лечение препаратом активизирует XI-связанных Mecp2 в головном мозге ксистδ: Mecp2/Xist: Mecp2-GFP женщин мышей была исследована. 10 мкл транспортного средства или 10 мкл ингибиторов КСИФ (1,5 мм LDN193189 и 1,6 мм GSK650394) вводили в противоположных полушариях головного мозга 4-недельных женских мышей XI-Mecp2-GFP с помощью внутримозговой инъекции с использованием стереотаксической хирургической процедуры ( Фигура 2A , B). Процедуру повторяли каждый второй день (рис. 2C), а через три недели животных усыпляли, и мозги были изолированы. Одно подмножество использовалось для qRT-ЦР, а другое было проанализировано иммуногистохимии. Экспрессия дикого типа Mecp2 и XI-Mecp2-GFP в полушариях транспортного средства и наркотиков определялась QRT-ЦР (последовательности праймеров, перечисленных в таблице 1). Как показано на рисунке 2D, медикаментозное лечение возобновленные XI-Mecp2-GFP в ~ 30% клеток в лекарственно проникнуты полушария головного мозга, в то время как XI- Mecp2-GFP не был обнаружен в автомобиле проникнуты полушария. Большое количество MAP2, нейрональных маркер, позитивные нейроны были также GFP положительный (~ 45%) в полушарии, обработочной наркотиками, что указывает на выражение XI-Mecp2-GFP . Приблизительно 20% из MAP2 отрицательных клеток головного мозга выразили GFP, подтверждая реактивации XI-Mecp2-GFP в non-нейрональных клетках (Диаграмма 2e).

Figure 1
Рисунок 1: Генерация и валидации XI-Mecp2 мышь модель. А) схема стратегии разведения для генерации Ксистδ: Mecp2/Xist: Mecp2-GFP мышей. (B) КЦР генотипирования Xist: Mecp2-GFP/Y, Ксистδ: Mecp2/Xist: Mecp2 и Ксистδ: Mecp2/Xist: Mecp2-GFP мышей. Мыши были проверены на наличие Mecp2-GFP, Mecp2 и секс-определяющего региона Y (SRY). (C) поток цитометрии анализ ядер, выделенных из коры мыши. Mecp2/Mecp2-GFP кора мыши показать ~ 50% от GFP-положительных ядер в то время как ксистδ: Mecp2/Xist: Mecp2-GFP не показывает GFP-положительных ядер. D) анализ QRT-ЦР, отслеживая экспрессию Mecp2-GFP и Mecp2 транскриптов дикого типа в женском Ксистδ: Mecp2/Xist: Mecp2-GFP MEFS после лечения ДМСО или препаратом (LDN193189 и GSK650394). «Гагдх» отслеживается как контроль погрузки. E) количественная иммунофлуоресцентная мониторинг интенсивности ГПС в женском ксистδ: Mecp2/Xist: Mecp2-GFP MEFS после лечения ДМСО или LDN193189 и GSK650394. MEFs изолированные от Mecp2/Y или Mecp2/Mecp2-GFP мышей были использованы в качестве отрицательного и положительного контроля, соответственно. Каждая точка представляет собой ФОСС, а пунктирная линия указывает максимальный фоновый сигнал , полученный в Mecp2/Y, который был установлен на 1. Нижняя панель показывает репрезентативные изображения ядер. Эта цифра была изменена с Prзановски et al.16. Пожалуйста, нажмите здесь, чтобы посмотреть увеличенном варианте этой фигуры.

Figure 2
Рисунок 2: Фармакологическое возобновление X-связанных Mecp2 в мозговых корковых нейронами живых мышей. (A) схема черепа мыши и (B) мозг, показывающий место инъекции для транспортного средства или наркотиков в левом или правом полушариях головного мозга. (C) схема лекарственного режима. (D) представитель иммунофлуоресцентного изображения с указанием эндогенного сигнала GFP (зеленый) в корональных участках мозга от транспортных средств или наркотиков, обработанных полушариями. Окрашивание DAPI показано синим цветом. E) репрезентативные иммунофлуоресцентных изображения участков головного мозга, мониторинг экспрессии GFP (анти-GFP; красный) и MAP2 (зеленый) в лекарственно-обработанных полушариях. Окрашивание DAPI показано синим цветом. Эта цифра была изменена с Prзановски et al.16. Пожалуйста, нажмите здесь, чтобы посмотреть увеличенном варианте этой фигуры.

Обратный грунт (5 '-> 3 ') Анилинг температура/ЦР длина продукта
Ggcatggactgtggggggggggt 60 °C/87 БП
ГТГААКТГГГГТТА 62 °C/137 БП
TGTCAGAGCCCTACCCATAAG 62 °C/140 БП
ГКАКАКККЦКЦГТГТА 62 °C/
ГКАКАКККЦКЦГТГТА 62 °C/250 БП
AATTGCCCTAACGAGCACAC 62 °C/436 BP
ГААЦТЧАГГГТЦУТТГК 62 °C/350 БП
КЦКТТСГТГАЦКТАЦККАЦККГА 66 °C/270 БП

Таблица 1: перечень праймеров, используемых для генотипирования и количественного анализа в реальном времени (RT-СР).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ранее, XCIFs, которые выборочно необходимы для глушителей XI связанных генов в млекопитающих женских клеток были выявлены12. Мы дополнительно оптимизированы мощные малые ингибиторы молекул целевой XCIFs, таких, как ACVR1 и вниз по течению эффекторы PDPK1, который эффективно активировать XI связанных Mecp2 в мыши фиброзы клеточных линий, мышь корковых нейронов, и человека фибровзрыва ячейки линии, полученной от пациента RTT. Эти результаты предполагают, что XI реактивации является правдоподобным терапевтический подход, чтобы спасти дефицит гена в X-связанных пациентов болезни; Тем не менее, в естественных условиях осуществимость еще предстоит определить. В последнее время ингибиторы КСИФ были показаны, чтобы активировать XI-связанные Mecp2 в естественных условиях, для которых непроизвольные ксистδ: Mecp2/xcif: модель мыши Mecp2-GFP была сгенерирован.

Привлекательной особенностью модели ксистδ: Mecp2/Xist: Mecp2-GFP является то, что она позволяет точно Квантации Mecp2 реактивации, связанной с XI, по нескольким причинам. Во-первых, из-за удаления Xist на материнской X хромосоме, ксистδ: Mecp2/Xist: Mecp2-GFP мышь имеет неслучайный Xist. В результате, генетически маркированные Mecp2 молчит в 100% клеток (рис. 1c), в отличие от ожидаемого 50:50 выражение X-сцепированных генов в случайных xci мышей моделей, таких как Xci: Mecp2/Xci: Mecp2-GFP. Таким образом, результаты не исключены из мозаичного выражения GFP, и 100% ячейки несут Mecp2-GFP на XI в модели Ксистδ: Mecp2/Xist: Mecp2-GFP . Во-вторых, генетическая маркировка Mecp2 позволяет непосредственно визуализировать индивидуальные нейроны с ВОЗОБНОВЛЕН GFP, тем самым сводя к минимуму экспериментальные манипуляции в нейрональных анализа.

Недавнее исследование показало, что внутримозговая инъекция ингибиторов КСИФ в полушарии мозга мыши активизирует XI-связанные Mecp2 с использованием иммунофлуоресцентного анализа мозга мыши16. Важно отметить, что медикаментозного лечения не оказывает негативного влияния на общее состояние здоровья, такие как вес, уход, или мобильность16. Кроме того, нет токсичности, обнаруженного при медикаментозного лечения в печени или селезенке. Вместе, это исследование обеспечивает существенное доказательство принципа, чтобы продемонстрировать, что вмешательство в функции XCIFs приводит к де-подавления XI в естественных условиях.

Таким образом, для оценки реактивации XI можно использовать чувствительную модель мыши. Это животное модель дизайна также может быть адаптирована для создания улучшенной модели мыши RTT, что порты Mecp2 мутации (вероятно, менее симптоматическое) на активной х-хромосоме и дикого типа Mecp2 на XI во всех клетках. Из-за неслучайного XCI, в то время как фенотипические симптомы могут быть более выраженными, ожидается, что эта модель также позволит для лучшей оценки и точной оценки разворота симптомов из-за Си реактивации. Кроме того, ксистδ: Mecp2/Xist: Mecp2-GFP также может быть изменен для изучения XI реактивации в других х-связанных моделей заболеваний, таких как DDX3X синдром.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Авторы благодарят Антонио Бедалов за предоставление реагентов; Университет Вирджинии ткань гистологии ядро для криосекционирования; Университет Вирджинии поток Цитометрическая основа для анализа потока цитометрии; Кристиан Блю и Салони Сингх за техническую помощь в генотипирования. Эта работа была поддержана Грант двойного Ху исследований в З.З., и Пилотная программа премии проекта от Университета Вирджинии-Вирджиния Tech семенной фонд премии и Хартвелл фонда индивидуальные биомедицинских исследований премии С.Б.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics