نموذج ماوس غير عشوائي لأعاده تنشيط الدوائية من Mecp2 علي كروموسوم X غير نشط

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

هنا ، ونحن وصف بروتوكول لتوليد نموذج murine الإناث قابله للحياة مع غير عشوائية X كروموسوم التنشيط ، اي ، أمومي الموروثة X الكروموسوم غير نشط في 100 ٪ من الخلايا. ونحن أيضا وصف بروتوكول لاختبار الجدوى ، والتحمل ، وسلامه أعاده تنشيط الدوائية لكروموسوم X غير نشط في الجسم المجري.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X صبغ الكروموسوم (XCI) هو إسكات عشوائي لكروموسوم X واحد في الإناث لتحقيق توازن الجرعة الجينية بين الجنسين. ونتيجة لذلك ، فان جميع الإناث غير متجانسة بالنسبة للتعبير الجيني المرتبط بالعاشر. واحده من الجهات التنظيمية الرئيسية لل XCI هو Xci، وهو أمر ضروري لبدء وصيانة xci. وقد حددت الدراسات السابقة 13 من العوامل التي تعمل بالكروموسوم X بالانابه (XCIFs) باستخدام شاشه وراثيه واسعه النطاق لفقدان الوظائف. تثبيط XCIFs ، مثل ACVR1 و PDPK1 ، وذلك باستخدام قصيرة دبوس الشعر RNA أو مثبطات جزيء صغير ، يعيد تنشيط X الجينات المرتبطة كروموسوم في الخلايا المستزرعة. ولكن الجدوى والقابلية لأعاده تنشيط الكروموسوم X غير النشط في الجسم المجري لا يزال يتعين تحديده. نحو هذا الهدف ، xistδ: Mecp2/Xist: تم إنشاء نموذج الماوس Mecp2 Gfp مع xist غير عشوائية بسبب حذف xist علي كروموسوم X واحد. باستخدام هذا النموذج ، تم تحديد مدي أعاده تنشيط X غير نشط في الدماغ الماوس بعد العلاج مع مثبطات XCIF. تظهر النتائج المنشورة مؤخرا ، للمرة الاولي ، ان تثبيط الدوائية من XCIFs يعيد تنشيط Mecp2 من كروموسوم X غير نشط في الخلايا العصبية القشرية من الدماغ الماوس الحية.

Introduction

X صبغ الكروموسوم (XCI) هو عمليه التعويض الجرعة التي يوازن التعبير الجينات المرتبطة X عن طريق إسكات نسخه واحده من كروموسوم X في الإناث1. ونتيجة لذلك ، يتراكم الكروموسوم X غير النشط (Xi) السمات المميزة للهتروكروماتين بما في ذلك ميثيل الحمض النووي والتعديلات المثبطة للهخه ، مثل هيستون H3-يسين 27 ثلاثي ميثيل (H3K27me3) و هيستون H2A اوبيتاميوشن (H2Aub) 2. المنظم الرئيسي لإسكات الكروموسوم x هو مركز التنشيط العاشر (الأكسجين) المنطقة ، حوالي 100 − 500 كيلوبايت ، والتي تتحكم في العد والاقتران من الكروموسومات x ، واختيار عشوائي من كروموسوم x لعدم التنشيط ، والبدء و نشر من إسكات علي طول كروموسوم X3. يتم بدء عمليه التنشيط X بواسطة النسخة المحددة X غير النشطة (Xist) التي تغطي الحادي عشر في رابطه الدول المستقلة للتوسط في إسكات الكروموسومات وأعاده تشكيل البنية ثلاثية الابعاد لكروموسوم x4. في الاونه الاخيره ، وقد حددت العديد من الشاشات البروتينية والوراثية المنظمين اضافيه من xci ، مثل البروتينات المتفاعلة xci 5،6،7،8،9 , 10 , 11 , 12. علي سبيل المثال ، الدراسة السابقة باستخدام الجينوم علي نطاق واسع الجينات تداخل الحمض الريبي كشفت 13 العوامل العابرة لل Xci (xcifs)12. الميكانيكية ، XCIFs تنظيم التعبير Xist التالي ، التداخل مع الدالة xcifs يسبب عيب xci12. معا ، قدمت التطورات الاخيره في الميدان رؤى هامه في آلات الجزيئية المطلوبة لبدء والحفاظ علي XCI.

تحديد المنظمين xci وفهم آليتهم في xci ذات الصلة مباشره بالامراض البشرية المرتبطة ب X ، مثل متلازمة ريت (rtt)13،14. RTT هو اضطراب النمو العصبي النادرة الناجمة عن طفرة غير متجانسة في البروتين الربط العاشر الميثيل-CpG ملزمه 2 (MECP2) الذي يصيب الفتات في الغالب15. لان MECP2 يقع علي الكروموسوم X, الفتات rtt هي متغايرة لنقص MECP2 مع ~ 50% الخلايا التعبير عن نوع البرية و ~ 50% التعبير عن متحولة MECP2. ولا سيما ، RTT خلايا متحولة الميناء نسخه نائمه ولكن البرية من نوع من Mecp2 علي الحادي عشر ، وتوفير مصدر للجينات وظيفية ، والتي إذا أعيد تنشيطها ، يمكن ان تخفف من اعراض المرض. بالاضافه إلى RTT ، هناك العديد من الامراض البشرية الأخرى المرتبطة بالعاشر ، والتي تمثل أعاده تنشيط Xi نهجا علاجيا محتملا ، مثل متلازمة DDX3X.

تثبيط XCIFs ، 3-phosphoinositide البروتين المعتمدة كيناز-1 (PDPK1) ، و activin نوع مستقبلات 1 (ACVR1) ، اما عن طريق قصيرة الحمض الريبي النيبالي (شرانا) أو مثبطات جزيء صغير ، يعيد تنشيط الجينات المرتبطة Xi12. ولوحظ أعاده تنشيط الدوائية من الجينات المرتبطة Xi في مختلف النماذج الجسم السابق التي تشمل خطوط الخلايا الليفية الماوس, الكبار الخلايا العصبية القشرية الماوس, الخلايا الليفية الفئران الجنينية, وخطوط الخلية الليفية المستمدة من المريض RTT12. ومع ذلك ، ما إذا كان التنشيط الدوائي للجينات المرتبطة بالحادي عشر أمرا ممكنا في الجسم الذي لا يزال يتعين إثباته. أحد العوامل المقيدة هو عدم وجود نماذج حيوانيه فعاله لقياس تعبير الجينات بدقه عن أعاده تنشيط الحادي عشر. نحو هذا الهدف ، xistδ: Mecp2/Xist: تم إنشاء نموذج الماوس Mecp2 Gfp الذي يحمل المسمي وراثيا Mecp2 علي Xi في جميع الخلايا بسبب الحذف غير المتجانس في اكسيست علي الام X كروموسوم16. باستخدام هذا النموذج, التعبير عن Mecp2 من الحادي عشر وقد تم تكميمها بعد العلاج مع مثبطات XCIFs في الدماغ من الفئران الحية. هنا ، يتم وصف الجيل من xistδ: Mecp2/Xist: Mecp2-Gfp نموذج الماوس ومنهجيه لأعاده تحديد القيمة الحادي عشر في الخلايا العصبية القشرية باستخدام المقايسات القائمة علي المناعي.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

وتمت الموافقة علي العمل المتعلق بالفئران من قبل لجنه الرعاية المؤسسية للحيوانات واستخدامها التابعة لجامعه فرجينيا (IACUC ؛ #4112).

1. توليد نموذج ماوس XCI غير عشوائية مع المسمي وراثيا Mecp2 علي Xi

ملاحظه: وكانت سلالات الماوس المستخدمة في الدراسة علي النحو التالي: Mecp2/Mecp2 (Mecp2tm 3.1 الطيور، وجدول المواد) و xist/δxist (B6 ؛ 129-xist < tm5Sado >؛ المقدمة من أنطونيو بيدالوف ، فريد مركز هاتشينسون للسرطان ، سياتل). وقد تم تصميم استراتيجيات تربيه بين سلالات كل منها لتوسيع مستعمرات الماوس لكل سلاله.

  1. اجراء التنميط الجيني علي جميع سلالات الفئران والمولدات الخاصة التي تم الحصول عليها بعد التكاثر باستخدام الإشعال الجينات المحددة المدرجة في الجدول 1.

2. تصميم استراتيجية تربيه الفئران لتوليد xistδ: Mecp2/Xist: Mecp2-Gfp

  1. اعداد زوج تربيه من خلال إسكان Mecp2/Y الذكور و XistΔ-Mecp2/Xist-Mecp2 انثي معا (12 ح/12 ح: ضوء/الظلام دوره) (الشكل 1A). من الناحية المثالية ، قم باعداد ما لا يقل عن 5 أزواج تربيه في وقت استخدام الفئران القابلة للحياة والخصبة. وبعد ان تلد الأنثى الحامل ، تسمح لها برفع القمامة الاولي مع الذكر.
    ملاحظه: لان الأب Xist الضربة القاضية يضعف المطبوعة xist, تعويض الجرعة, ومسارات التمايز17, استخدام xistδ-Mecp2/Y الفئران في تربيه سوف تفشل في إنتاج الجراء الإناث مع النمط الجيني المطلوب.
  2. بعد الفطام القمامة في يوم ما بعد الولادة (P21) ، وتحديد ووسم xistδ: Mecp2/Xist: الجراء الإناث Mecp2 باستخدام فحص التنميط الجيني القائم علي PCR (الشكل1b).
    ملاحظه: من حيث عدد الماشية اللازمة لكل مجموعه ، للنتائج المذكورة أدناه ، تم إنشاء 5 أزواج تربيه التي ولدت ما يقرب من 10 الإناث xistδ: Mecp2/Xist: Mecp2-Gfp الفئران.
  3. استخدام نماذج الماوس الإناث لجميع التجارب المقترحة.
    ملاحظه: الجنس هو متغير بيولوجي مهم للدراسات XCI ، ونموذج الذكور لا تمثل اثار الخلط من XCI عشوائي.
  4. ان يكون متسقة طوال الدراسات حيوانيه ويستبعد اي تاثيرات من العمر حيوانيه, ينجز كل التجارب في 5 − 8-أسبوع- xistδ انثويه: Mecp2/[اكسيست]: [Mecp2-غب] فيران.

3. عزل الإناث xistδ: Mecp2/Xist: Mecp2 الخلايا الليفية الجنينية الماوس (mefs)

  1. اعداد التزاوج الموقوت بين Mecp2/Y الذكور و Xistδ- Mecp2/Xist-Mecp2 الإناث . اعداد ما لا يقل عن 3 − 4 أقفاص التزاوج لزيادة احتمال الحمل.
  2. بعد التاكد من المكونات المهبلية في الصباح بعد التزاوج ، افصل الأنثى ويعتبر هذا اليوم اليوم الجنيني 0.5 (E 0.5). رصد زيادة الوزن للإناث الحوامل المحتملين وبصريا فحص بطن الفئران لتاكيد الحمل. علي البريد 14.5 − 15.5 ، موت ببطء الإناث الحوامل الفئران عن طريق خلع عنق الرحم.
  3. تحت غطاء المحرك الرقائقي ، امسح بطن الأنثى الحامل ب70% الايثانول. باستخدام مقص معقم ، تشريح تجويف البطن وأزاله قرون الرحم التي تحتوي علي الاجنه. باستخدام الملقط ، اخرج الاجنه برفق بينما تقطع الانسجه البطنية المتبقية (عاده ما يكون من المتوقع ان تكون الاجنه 6 − 12).
  4. ضع أبواق الرحم التي تحتوي علي الاجنه في طبق الثقافة النسيجية 10 ملم. باستخدام مقص معقم وملقط ، اجراء شق علي طول قرون الرحم لعزل الحويصلات الفردية التي تحمل الجنين. بعناية ، ضع أبواق الرحم التي تحتوي علي بقية الاجنه في 30 مل من محلول الملح المعقم من هانكس (HBSS) علي الجليد.
  5. قطع برفق فتح الكيس وعزل الجنين باستخدام مقص معقمه وملقط. أزاله المشيمة عن طريق قطع الحبل السري.
  6. قطع رؤوس الجنين.
    ملاحظه: بينما سيتم معالجه بقية الانسجه الجنينية ، سيتم استخدام الانسجه من راس الجنين لعزل الحمض النووي لتنميط الجينات.
  7. فتح البطن عن طريق قطع الخط الأوسط من الجنين باستخدام مقص معقمه وملقط. أزاله أعضاء الأحشاء ، مثل القلب والكبد والرئتين.
  8. انقل الانسجه الجنينية المتبقية إلى صفيحه معقمه للانسجه النسيجية 60 ملم وتقطع إلى قطع صغيره باستخدام مقص أو شفره حلاقه. لكسر فتح كتل الخلية ، أضافه 3 مل من تريبسين-أدتا (0.05 ٪) واحتضان في 37 درجه مئوية لمده 15 دقيقه.
  9. تحييد تريبسين-أدتا عن طريق أضافه 5 مل من النسر المعدلة دولبيكو المتوسطة (DMEM) مع 10 ٪ الجنين البقري المصل (الدم) و 10 ميكروغرام/مل البنسلين/ستربتومايسين (القلم/العقديات) إلى لوحه وانفصال الانسجه عن طريق الأنابيب المتكررة (ما يقرب من 20 − 30 مرات).
  10. تدور الخلايا في 300 x g لمده 5 دقائق وأعاده تعليق بيليه الخلية في 4 مل من dmem مع 10 ٪ من البنادق و 10 ميكروغرام/مل القلم/بكتيريا. طبقت الخلايا علي 60 [م] ثقافة طبق, وثقافة الخلايا في 37 [ك] في الوجود من 5% [كو]2.
  11. نفذ الخطوات 3-5 − 3-10 لكل جنين.
  12. الثقافة MEFs الحصول عليها في الخطوة 3.11 لمده لا تقل عن 3 − 4 أيام.
    ملاحظه: في هذه المرحلة ، MEFs يمكن أيضا ان تكون بالتبريد للتجارب في المستقبل.
  13. لتحديد الجنس والنمط الجيني لكل جنين ، نفذ التنميط الجيني باستخدام الحمض النووي المعزول عن رؤوس الاجنه باستخدام الإشعال وشروط PCR المدرجة في الجدول 1.

4. تاكيد عدم وجود البروتين الفلوري الأخضر (GFP) التعبير في الدماغ من xistδ: Mecp2/Xist: Mecp2-Gfp الفئران باستخدام فلوريسسينسي خليه المنشط الفرز القائم علي الفحص

  1. باستخدام مقص ، فصل القشرة الدماغية من بقية نصفي الدماغ ، ومكان في 1 مل من الجليد الباردة نواه العزلة وسائل الاعلام (نيم) العازلة التي تحتوي علي 250 mM السكروز ، 25 ملم كلوريد البوتاسيوم (KCl) ، 5 مم كلوريد المغنيسيوم (MgCl2) ، 10 مم تريس-Cl ، تستكمل مع 2 ٪ بارافورمالدهيد (PFA) ، و 0.1 ٪ غير أيوني السطحي (جدول المواد).
  2. التجانس باستخدام الخالطون الزجاج الجليد الباردة.
  3. تدور الانسجه المتجانسة في 600 x g، 4 درجه مئوية لمده 5 دقائق.
  4. أزاله ماده طافي وأعاده التعليق بيليه في 1 مل من 25 ٪ إيوديكسانول في حل نيم.
  5. أضافه 1 مل من lodixanol 29 ٪ في الحل نيم إلى 4 مل اولتراسينتريفوجي أنبوب (مخزن علي الجليد حتى عينات جاهزه) وطبقه بعناية 1 مل من عينه (في 25 ٪ lodixanol).
  6. أجهزه الطرد المركزي في 9,000 x g، 4 درجه مئوية لمده 10 دقيقه في القصبة الطاردة.
  7. يستنشق ماده طافي وأعاده التعليق بيليه في 500 μl من مضان الخلية المنشطة الفرز (facs) العازلة (الفوسفات-مخزنه المالحة [التلفزيونية العامة] تستكمل مع 1 مم أدتا ، 0.05 ٪ الصوديوم أزيد ، و 2 ٪ الزلال مصل الأبقار [بوسني]).
    ملاحظه: يمكن تخزين العينات في 4 درجات مئوية أو حتى أسبوع واحد.
  8. أضافه 5 μL من 7-امينو-اكتينومايسين د (7-عاد ؛ 50 ملغ/مل) لمده 5 دقائق في درجه حرارة الغرفة إلى الحمض النووي وصمه عار.
  9. تحليل عينات للاشاره إلى البروتين الفلوري الأخضر (GFP) باستخدام قياس التدفق الخلوي بنسبه 7 عادات.

5. تحديد جدوى xistδ: Mecp2/Xist: Mecp2-Gfp نموذج الماوس لأعاده تنشيط Xi

  1. بذور 1 × 105 خلايا/مل انثي xistδ: Mecp2/Xist: Mecp2 Mefs ، Mecp2/Mecp2-gfp و xist-Mecp2/Y mefs الحصول عليها في الخطوة 3.12 في شكل 6-بئر وفي الشرائح الغرفة ، في dmem مع 10 ٪ والقلم 10 ميكروغرام/مل/بكتيريا ، في 37 درجه مئوية في وجود 5 ٪ CO2.
    ملاحظه: يتم استخدام Mecp2/Mecp2 و Xist Mecp2/Y mefs كعناصر تحكم ايجابيه وسلبيه في التجارب.
  2. أضافه المتوسطة الطازجة إلى الخلايا بعد 24 ساعة. ل xistδ: Mecp2/Xist: Mecp2-Gfp mefs ، أضافه متوسطه تستكمل مع مثبطات xcifs (علي سبيل المثال ، 0.5 μm LDN193189 و 2.5 μm GSK650394) ، أو السيارة وحدها. استبدال المتوسطة مع المثبط الطازجة أو السيارة وحدها كل 2 أيام. ل Mecp2/Mecp2 و Xist-Mecp2/Y mefs ، أضافه المتوسطة الطازجة كل 2 أيام.
  3. بعد 1 أسبوع من العلاج المثبط ، والحصاد MEFs اما للعزل RNA (6-بئر لوحه) أو إصلاح الخلايا للمناعة (الشرائح الغرفة). استخدام MEFs معزولة من Mecp2/Mecp2 الاجنه كما ايجابيه و Xist Mecp2/Y الاجنه كعناصر التحكم السلبية علي التوالي.
    1. لعزله الجيش النيبالي الريبي ، عزل الحمض الريبي النيبالي الإجمالي من قبل الحمض الريبي النيبالي guanidinium القائم علي استخراج الكاشف ، والنسخ العكسي باستخدام النسخ العكسي. القياس Mecp2 التعبير عن طريق النسخ العكسي الكمي-Pcr (qrt-pcr) باستخدام Mecp2-WT و Mecp2 ، والإشعال المدرجة في الجدول 1، كما هو موضح سابقا12.
    2. للحصول علي المناعي ، وصمه عار mefs مع مضاد لمكافحه gfp الأجسام الاساسيه (1:100) ، كما هو موضح سابقا12،16. قياس كثافة GFP عن طريق المناعي الكمي في المخدرات المعالجة xistδ: Mecp2/Xist: Mecp2-gfp mefs ، كما هو موضح سابقا18.

6. إظهار أعاده تنشيط الدوائية Xi في الدماغ من xistδ: Mecp2/Xist: Mecp2-Gfp نموذج الماوس

  1. اعداد المخدرات ومراقبه المركبات.
    1. اعداد الطازجة ، محلول معقم للسيارة (0.9 ٪ كلوريد الصوديوم ، 0.5 ٪ ميثيل سيلولوز ، 4.5 ٪ ثنائي ميثيل سلفوكسيد [dmso]) لحقن الدماغ.
    2. اعداد مثبطات كيميائية بما في ذلك 1.5 mM LDN193189 (المثبط جزيء صغير من ACVR1) و 1.6 mM GSK650394 (المثبط جزيء صغير من SGK1 ، المستجيب المصب من PDPK1) أعاده تعليق في السيارة (0.9 ٪ كلوريد الصوديوم ، 0.5 ٪ ميثيل سيلولوز ، 4.5 ٪ DMSO) ، أو مركبه وحدها. الحجم الإجمالي لمثبطات الكيميائية أو المركبة التي تم حقنها هو 10 μL لكل جرعه لكل الحيوانية.
  2. اعداد الحيوانية لحقن الدماغ.
    1. اعداد المنطقة الجراحية عن طريق مسح مقاعد البدلاء والتدفئة وساده مع مطهر (10 ٪ محلول هيبوكلوديوم الصوديوم).
    2. تخدير الفار البالغ من العمر 4 أسابيع مع حقنه داخل الصفاق من خليط الكيتامين/الاكزيازين بجرعة 140 ملغم/كغم و 10 ملغم/كغم علي التوالي. استخدام منعكس الانسحاب دواسة لتحديد مستوي التخدير.
    3. تطبيق مرهم العيون علي العينين بعد تحريض التخدير لمنع تجفيف القرنية.
    4. حلق قباله الفراء من الرقبة إلى الأعلى من راس الماوس.
    5. ضع الماوس في المنصة المجسمة عن طريق تركيب الأسنان القاطعة في الماوس في شريط اللدغة من الخطم وشد المشبك الأنفي علي الأنف مع ضمان ان راس الماوس علي مستوي مستو.
    6. ضبط ارتفاع قضبان الاذن ، حسب الضرورة ، للوصول إلى الجزء الذيليه من قناه الاذن ، وتامين لهم من هذا القبيل ان راس الماوس في مستوي الطائرة ويجمد علي لمسه اصبع.
    7. تطهير راس الماوس مع مناديل بالتناوب من مطهر موضعي ، مثل povidone-اليود و 70 ٪ الايثانول.
  3. أداره المخدرات.
    1. باستخدام مشرط معقم ، قم باجراء شق أفقي 0.75 سم في منتصف فروه الراس.
    2. باستخدام لدغ 0.45 mm ، حفر اثنين من الثقوب متناظرة فوق اليمين واليسار نصفي القشرية (2 مم من خياطه السهمي و 2 مم من خياطه لامي ، ما يقرب من منتصف العظام الجدارية).
    3. قم بتركيب حقنه بقوة 10 μL علي المنصة المجسمة بثبات.
    4. خلط الحل من المثبطات الكيميائية ، ورسم 10 μL من محلول في حقنه. تجنب اي فقاعات الهواء في الحقنه.
    5. تقدم ابره حقنه في ثقب لدغ الحفاظ علي الابره عمودي (90 درجه) إلى الجمجمة. عندما يخترق الابره الجمجمة ، صفر من الإحداثيات علي الشاشة الرقمية المجسمة ومن ثم تقدم غيض من الابره حتى تصل إلى عمق 2.5 ملم.
    6. سحب الابره 0.5 مم إلى عمق 2 ملم.
    7. ببطء حقن 10 μL من الحل (~ 1 دقيقه). بعد الحقن كامله ، وترك الابره في الدماغ ل ~ 1 دقيقه ثم سحب الابره.
    8. كرر الحقن لنصف الكره الثاني (تحكم السيارة فقط).
    9. باستخدام الغرز أو "الغراء الجلد" إغلاق الجلد من الماوس (إذا كان الجرح > 0.5 سنتيمتر علي حد سواء الغرز و "الغراء الجلد" ينبغي ان تستخدم).
    10. قم بتخفيف قضبان الاذن وأزاله الماوس من جهاز المجسم.
    11. أداره المسكنات (Buprenorphine SR 0.5 mg/kg IP) ووضع الماوس علي لوحه التدفئة تعيين إلى 37 درجه مئوية حتى يستعيد الحيوانية وعيه.
    12. مره واحده في الماوس هو تنبيه واستجابه ، ونقل الحيوانية مره أخرى إلى قفصها الأصلي.
    13. كرر الاجراء كل يومين لمده 20 يوما. لا يلزم تكرار الحفر في المنطقة للحقن اللاحقة.
  4. عزل الدماغ الماوس.
    1. بمجرد الانتهاء من نظام الجرعة, موت ببطء الماوس في غرفه2 CO.
    2. تعبئة الماوس علي سطح باستخدام الابر.
    3. اجراء شق الجانبي من خلال اهاب وجدار البطن فقط تحت القفص الصدري باستخدام مقص وملقط. افصل الكبد عن الحجاب الحاجز بعناية.
    4. باستخدام مقص ، وقطع الحجاب الحاجز ومواصله القطع علي طول طول القفص الصدري لفضح تجويف الجنبي.
    5. باستخدام المقص ، قم بعمل شق في الطرف الخلفي من البطين الأيسر.
    6. علي الفور ، بدء حقن غرفه القلب اليمني مع ~ 15 مل من التلفزيونية الخاصة أكثر من ~ 2 دقيقه. تغيير لون الكبد من الأحمر إلى الوردي الشاحب يدل علي الانصهار جيده.
    7. حقن الغرفة اليمني من قلب الماوس مع ~ 10 مل من 4 ٪ بارافورمالدهيد في الاذاعه التلفزيونية أكثر من ~ 2 دقيقه.
    8. قطع راس الماوس ، واستخدام مقص لجعل شق الخط الأوسط من فروه الراس لفضح الجمجمة.
    9. ضع طرفا واحدا من المقص في زجاجه الخمر ، وقطع أفقيا في الجمجمة نحو العين. كرر للجانب الآخر. في محاولة للحفاظ علي نهاية مقص سطحيه قدر الإمكان لتجنب أصابه الدماغ.
    10. استخدام مقص لقطع المنطقة بين العينين وفوق الأنف من الماوس.
    11. استخدم الملقط لتقشير عظام الجمجمة برفق من نصفي الدماغ.
    12. رفع الدماغ مع ملعقة ، واستخدام مقص لتشريح بعناية ألياف العصبية القحفيه التي إصلاحها إلى الجمجمة.
    13. وضع الدماغ علي طبق من البلاستيك ، وقطع المخيخ والمصابيح حاسة الشم ، ووضع الدماغ في أنبوب 15 مل مليئه بنسبه 4 ٪ PFA هو تلفزيوني.
  5. البرد-قسم الدماغ الماوس.
    1. إصلاح الدماغ في 4 ٪ بارافورمالدهيد في الاذاعه التلفزيونية في 4 °C بين عشيه وضحيها.
    2. شطف الدماغ مع تلفزيوني في 4 درجه مئوية علي الأقل 3x لمده 5 دقائق لكل منهما.
    3. تسميه قوالب القابل للتصرف للحصول علي الانسجه بالتبريد.
    4. قطع الجزء الامامي من الدماغ باستخدام مقص وملقط (بدء صنع ~ 5 أقسام مم من مواقع الحقن).
    5. نقل الدماغ إلى البرد مع الجزء الامامي من الدماغ التي تواجه وصولا إلى الحصول علي المقاطع الاكليليه. دمج العفن الذي يحتوي علي الدماغ في مركب درجه حرارة القطع الأمثل (OCT).
    6. صب النيتروجين السائل في طبق بتري البلاستيك 10 مم ووضع الدماغ في العفن التبريد في النيتروجين.
      ملاحظه: من المهم توجيه الانسجه كما هو موضح في الخطوة 6.5.5 لتوجيه التماس الدماغ.
    7. عندما يكون OCT ابيض صلب ، ضع الدماغ المجمد في الفريزر-80 درجه مئوية للتخزين.
    8. تتوازن الدماغ إلى-20 درجه مئوية لمده 30 دقيقه علي الأقل قبل القيام بالتشريح والتجميد (5 − 6 ميكرون سماكه) الدماغ ، وتصاعد 2 − 3 أقسام لكل شريحة. يمكن تخزين الشرائح في-80 درجه مئوية للاستخدام في وقت لاحق.
  6. تحديد أعاده تنشيط Xi باستخدام نهج قائم علي المناعة.
    1. قبل البدء في اجراء تلطيخ ، تجفيف أقسام الدماغ بين عشيه وضحيها في 4 درجه مئوية.
    2. تزج الشرائح في محلول استخراج مستضد (0.1 M حمض الستريك ، 0.1 M تريس-قاعده ، pH = 6.0) علي كتله حرارة 100 درجه مئوية لمده 5 دقائق.
    3. غسل الشرائح 4x مع 1x تلفزيوني لمده 5 دقائق كل في درجه حرارة الغرفة.
    4. تزج الشرائح في حل الحجب (0.1 M NH4CL/تلفزيوني/0.2 ٪ الجيلاتين/0.05 ٪ غير أيوني السطحي) لمده 20 دقيقه في درجه حرارة الغرفة.
    5. غسل الشرائح 3x مع غسل العازلة (تلفزيوني/0.2 ٪ الجيلاتين) في درجه حرارة الغرفة لمده 5 دقائق لكل منهما.
    6. أقسام الدماغ وصمه عار مع المضادة--GFP--AlexaFluor647 (1:100) والمضادة لMAP2 (1:1000) الأجسام المضادة في الحضانة المتوسطة (تلفزيوني/0.2 ٪ الجيلاتين/1 ٪ بوسني) واحتضان في 4 °C بين عشيه وضحيها.
    7. جمع الأجسام المضادة الاساسيه (يمكن أعاده استخدامها). غسل الشرائح 4x مع غسل العازلة لما مجموعه 30 دقيقه في درجه حرارة الغرفة.
    8. احتضان أقسام الدماغ مع الماعز المضادة للدجاج فلوريسئين ايزوثيسيانات (FITC)-المسمي الأجسام الثانوية (1:1000) في حضانة المتوسطة واحتضان 1 − 2 ح في درجه حرارة الغرفة في الظلام.
    9. غسل الشرائح 4x مع غسل العازلة لما مجموعه 30 دقيقه في درجه حرارة الغرفة.
    10. وضع قطره من المتوسطة المتصاعدة مع 4 ′, 6-diamidino-2-فينيلانديول (dapi) علي 22 مم x 50 mm كوفيرسليب, ثم عكس كوفيرسليب علي شريحة, تغطي جميع أقسام الانسجه.
    11. صوره علي المجهر وضبط الصور للتباين والسطوع. التقاط الصور وتحديد عدد الخلايا الايجابيه GFP لكل من معالجه المخدرات والمركبات المعالجة xistδ: Mecp2/Xist: Mecp2-Gfp الماوس الدماغ نصفي الكره.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

لإثبات جدوى xistδ: Mecp2/Xist: Mecp2-gfp نموذج الماوس للدراسات أعاده التنشيط xi ، تم اختبار xist المثبط الوساطة أعاده تنشيط المرتبطة بالحادي عشر Mecp2-gfp في الخلايا الليفية الجنينية الفئران (mefs). تم عزل الإناث MEFs من اليوم 15.5 xistδ: Mecp2/Xist: الاجنه Mecp2-Gfp كما هو موضح في القسم 3 (الشكل 1 ا). الأنماط الجينية للإناث xistδ: Mecp2/Xist: تم تاكيد Mecp2-Gfp mefs من قبل التنميط الجيني-PCR ، كما هو موضح سابقا19 (الشكل 1b) ، والفحص القائم علي Facs (الشكل1b). تم التعامل مع MEFs اما DMSO أو اثنين من المخدرات LDN193189 و GSK650394 (0.5 μM و 2.5 μM ، علي التوالي) لمده 7 أيام. وبعد العلاج من تعاطي المخدرات ، تم رصد التعبير عن Mecp2-Gfp بواسطة QRT-PCR. كما هو مبين في الشكل 1D، والعلاج المخدرات ، ولكن ليس dmso ، أعاده تنشيط التعبير عن الحادي عشر-Mecp2-gfp. بعد ذلك ، تم تنفيذ المناعي الكمي لتحديد مدي التعبيرMecp2-Gfp في mefs الفردية ، كما هو موضح في الخطوة 5.3.2. تم تعيين اشاره من MEFs التحكم السلبية المعزولة من الاجنه الذكور (Mecp2/Y) كخلفيه ، و ~ 66 ٪ من السيطرة الايجابيه Mecp2/Mecp2 mefs كان لها اشاره gfp النووية. كما هو متوقع ، xistδ: Mecp2/Xist: Mecp2-gfp mefs تعامل مع dmso كان مستوي منخفض جدا من gfp النووية (~ 3 ٪). علي النقيض من ذلك ، ~ 31 ٪ من Xistδ معالجه المخدرات : Mecp2/Xist: Mecp2 mefs كانت ايجابيه لل gfp النووية (الشكل 1e). معا, هذه النتائج تثبت ان مثبطات XCIF أعاده تنشيط Mecp2 المرتبطة Xi في mefs, ولكن مدي أعاده تنشيط xi يختلف في عدد الخلايا.

لتقييم جدوى الدوائية Xi النهج القائم علي أعاده التنشيط في فيفو ، ما إذا كان العلاج بالعقاقير يعيد تنشيط الMecp2 المرتبطة xi في الدماغ من xistδ: Mecp2/xist: تم التحقيق في الفئران Mecp2 gfp الإناث. 10 μL من السيارة أو 10 μL من مثبطات XCIF (1.5 mM LDN193189 و 1.6 mM GSK650394) كانت تدار في نصفي الدماغ المعاكس من الفئران الإناث البالغة من العمر 4- Mecp2-Gfp من قبل الحقن داخل البطين باستخدام الإجراءات الجراحية المجسمة ( الشكل 2 الف ، باء). وتكرر الاجراء كل يومين (الشكل 2 ج) ، وبعد ثلاثه أسابيع ، كانت الماشية رحيم ، وكانت الادمغه معزولة. تم استخدام مجموعه فرعيه واحده ل qRT-PCR وتم تحليل آخر من قبل مناعي. وقد تم تحديد التعبير عن النوع البري Mecp2 والحادي عشر-Mecp2-gfp في نصفي المركبات والمخدرات المشبعة بالعقاقير من قبل qrt-PCR (متواليات الإشعال المدرجة في الجدول 1). كما هو مبين في الشكل 2D، أعاده تنشيط العلاج المخدرات Xi-Mecp2 في ~ 30 ٪ من الخلايا في نصف الكره الدماغية التي غرست المخدرات ، في حين لم يتم الكشف عن شي- Mecp2-gfp في نصف الكره التي غرست السيارة. وهناك عدد كبير من MAP2, علامة الخلايا العصبية, كانت عصبيه ايجابيه أيضا GFP ايجابيه (~ 45%) في نصف الكره المعالجة بالمخدرات ، مما يدل علي التعبير الحادي عشر-Mecp2-Gfp . حوالي 20 ٪ من خلايا الدماغ السلبية MAP2 وأعرب عن GFP ، مما يؤكد أعاده تنشيطMecp2-gfp في الخلايا غير العصبية (الشكل 2e).

Figure 1
الشكل 1: الجيل والتحقق من الصحة طراز الماوسMecp2 . (ا) تخطيطي لاستراتيجية التكاثر لتوليد Xistδ: Mecp2/Xist: Mecp2-gfp الفئران. (ب) التنميط الجيني لل Xist: Mecp2/Y, Xistδ: Mecp2/Xist: Mecp2 و xistδ: Mecp2/xist: الفئران الMecp2ه-gfp . ورصدت الفئران لوجود Mecp2-Gfp، Mecp2 والجنس تحديد المنطقة Y (sry). (ج) تحليل تدفق الخلوي لنوى معزولة من قشره الماوس. Mecp2/Mecp2 اللحاء الماوس إظهار ~ 50 ٪ من نواه ايجابيه gfp في حين xistδ: Mecp2/Xist: Mecp2-gfp يظهر اي نواه ايجابيه gfp. (د) تحليل QRT-PCR رصد التعبير عن Mecp2 والMecp2 البرية من نوع النصوص في Xistδ الإناث: Mecp2/xist: Mecp2-gfp mefs بعد العلاج مع dmso أو المخدرات (الLDN193189 والGSK650394). تم رصد الفجوة كعنصر تحكم التحميل. (ه) الرصد المناعي الكمي كثافة gfp في xistδ الإناث : Mecp2/Xist: Mecp2 mefs التالية العلاج مع dmso أو المخدرات LDN193189 والGSK650394. تم استخدام MEFs المعزولة من Mecp2/Y أو Mecp2/Mecp2 الفئران كعناصر التحكم السلبية والايجابيه ، علي التوالي. تمثل كل نقطه MEF ، ويشير الخط المتقطع إلى الحد الأقصى لاشاره الخلفية التي تم الحصول عليها في Mecp2/Y ، والتي تم تعيينها إلى 1. تظهر اللوحة السفلية صورا تمثيليه لنوى. وقد تم تعديل هذا الرقم من Przanowski et al.16. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 2
الشكل 2: أعاده التنشيط الدوائي لMecp2 المرتبطة بالعاشر في الخلايا العصبية القشرية الدماغية للفئران الحية. (ا) التخطيطي من جمجمة الماوس و (ب) الدماغ تظهر موقع الحقن للسيارة أو المخدرات في نصفي الكره اليمني أو اليمني من الدماغ. (ج) التخطيط لنظام المخدرات. (د) الصور المناعية التمثيلية التي تظهر اشاره gfp الذاتية (الخضراء) في أقسام المخ الاكليليه من نصفي الكره المعالجة بالمركبات أو المخدرات. ويظهر تلطيخ DAPI باللون الأزرق. (ه) الصور المناعية التمثيلية للأقسام الدماغية الاكليليه التي تراقب التعبير عن gfp (المضادة لMAP2 والأحمر) و (الأخضر) في نصف الكره المعالجة بالمخدرات. ويظهر تلطيخ DAPI باللون الأزرق. وقد تم تعديل هذا الرقم من Przanowski et al.16. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

التمهيدي العكسي (5 '-> 3 ') انلينغ درجه الحرارة/PCR طول المنتج
القط 60 درجه مئوية/87 bp
في الانجليزيه 62 درجه مئوية/137 bp
TGTCAGAGCCCTACCCATAAG 62 درجه مئوية/140 bp
في الانجليزيه 62 درجه مئوية/364 bp
في الانجليزيه 62 درجه مئوية/250 bp
في الانجليزيه 62 درجه مئوية/436 bp
المركز الجامعي 62 درجه مئوية/217 bp
CTCCTCTGTGACACTTTAGCCCTCCGA 66 درجه مئوية/270 bp

الجدول 1: قائمه الإشعال المستخدمة في التنميط الجيني والكمي في الوقت الحقيقي RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

سابقا ، تم تحديد XCIFs المطلوبة بشكل انتقائي لإسكات الجينات المرتبطة بالحادي عشر في الخلايا الانثويه الثديية12. ونحن كذلك الأمثل مثبطات جزيء صغير قويه لاستهداف XCIFs ، مثل ACVR1 والمستجيبين المصب من PDPK1 ، والتي بكفاءة تنشيط الحادي عشر مرتبطة Mecp2 في خطوط الخلية الخلايا الليفية الماوس ، والخلايا العصبية القشرية الماوس ، وخليه الإنسان الليفية خط مشتق من المريض RTT. وتشير هذه النتائج إلى ان التنشيط الحادي عشر هو نهج علاجي معقول لإنقاذ نقص الجينات في مرضي الامراض المرتبطة ب X. ومع ذلك ، فان الجدوى المجرية لا يزال يتعين تحديدها. في الاونه الاخيره ، وأظهرت مثبطات XCIF لأعاده تنشيط Mecp2 المرتبطة الحادي عشر في فيفو ، والتي xistδ غير عشوائي : Mecp2/xcif: تم إنشاء نموذج الماوس Mecp2 gfp .

ميزه جذابة لxistδ : Mecp2/Xist: Mecp2-Gfp النموذجي هو انه يسمح كميه دقيقه من أعاده تنشيط الMecp2 المرتبطة بالحادي عشر لعده أسباب. أولا ، وذلك بسبب حذف xist علي كروموسوم X الام ، xistδ: Mecp2/Xist: Mecp2-gfp الماوس لديها xist غير عشوائي. ونتيجة لذلك ، Mecp2 المسمية وراثيا صامته في 100 ٪ من الخلايا (الشكل 1c) ، علي عكس المتوقع 50:50 التعبير عن الجينات المرتبطة X في نماذج الفئران xci عشوائية ، مثل Xci: Mecp2/Xci: Mecp2-gfp. ولذلك ، لا يتم منع النتائج من قبل التعبير فسيفساء من GFP ، والخلايا 100 ٪ تحمل Mecp2 في الحادي عشر في Xistδ: Mecp2/Xist: Mecp2-gfp نموذج. ثانيا ، التسمية الوراثية Mecp2 يسمح التصور المباشر للخلايا العصبية الفردية مع gfp أعاده تنشيط ، التالي التقليل من التلاعب التجريبية في تحليل الخلايا العصبية.

وجدت دراسة حديثه ان حقن البطين البطيني من مثبطات XCIF في نصف الكره الدماغ الماوس يعيد تنشيط الحادي عشر المرتبطة Mecp2 باستخدام تحليل المناعي للدماغ الماوس16. والاهم من ذلك ان العلاج من تعاطي المخدرات لا يؤثر سلبا علي الصحة العامة ، مثل الوزن أو الاستمالة أو التنقل16. وعلاوة علي ذلك ، لا توجد سميه الكشف عنها من قبل العلاج المخدرات في الكبد أو الطحال. معا ، توفر هذه الدراسة دليلا أساسيا لإثبات ان التدخل في وظيفة XCIFs يؤدي إلى أزاله القمع من الحادي عشر في الجسم الحيوي.

باختصار ، يمكن استخدام نموذج ماوس حساسة لتقييم أعاده تنشيط Xi. هذا النموذج الحيواني تصميم يمكن أيضا ان تتكيف لتوليد نموذج الماوس RTT المحسنة التي تؤوي Mecp2 طفرات (ربما اقل اعراض) علي الكروموسوم X النشطة والبرية من نوع Mecp2 علي الحادي عشر في جميع الخلايا. بسبب XCI غير عشوائية ، في حين ان الاعراض الظاهرية قد تكون أكثر وضوحا ، فمن المتوقع ان هذا النموذج سوف يسمح أيضا لتقييم أفضل وتقييم دقيق لعكس الاعراض بسبب أعاده تنشيط Xi. بالاضافه إلى ذلك ، xistδ: Mecp2/Xist: يمكن أيضا تعديل Mecp2-Gfp لدراسة أعاده تنشيط الحادي عشر في نماذج الامراض الأخرى المرتبطة ب X ، مثل متلازمة الDDX3X.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

وليس لدي المؤلفين ما يفصحون عنه.

Acknowledgments

يشكر المؤلفات [أنتونيو] [بدالوف] ل يزود الكواشف; جامعه فرجينيا نسيج الانسجه الاساسيه للحصول علي التجميد; جامعه فرجينيا تدفق الخلوية الاساسيه لتحليل تدفق الخلوي. كريستيان بلو و سالوني سينغ للحصول علي المساعدة التقنية في التنميط الجيني. وقد تم دعم هذا العمل من خلال منحه بحثيه مزدوجة إلى Z.Z. بشان ، وجائزه برنامج المشروع التجريبي من جامعه فرجينيا فيرجينيا للتكنولوجيا البذور جائزه الصندوق وجائزه البحوث الطبية الحيوية الفردية مؤسسه هارتويل إلى نشره سورينام

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics