Ein nicht zufälliges Mausmodell zur pharmakologischen Reaktivierung von Mecp2 auf dem inaktiven X-Chromosom

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier beschreiben wir ein Protokoll zur Generierung eines lebensfähigen weiblichen Murinmodells mit nicht zufälliger X-Chromosomeninaktivierung, d.h. das mütterlich vererbte X-Chromosom ist in 100% der Zellen inaktiv. Wir beschreiben auch ein Protokoll zur Prüfung der Machbarkeit, Verträglichkeit und Sicherheit der pharmakologischen Reaktivierung des inaktiven X-Chromosoms in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X-Chromosomin-Inaktivierung (XCI) ist die zufällige Abschaltung eines X-Chromosoms bei Frauen, um das Gleichgewicht zwischen den Geschlechtern zu erreichen. Damit sind alle Weibchen heterozygös für die X-gebundene Genexpression. Einer der wichtigsten Regulatoren von XCI ist Xist,der für die Initiierung und Wartung von XCI unerlässlich ist. Frühere Studien haben 13 Trans, die X-Chromosom-Inaktivierungsfaktoren (XCIFs) verwenden, anhand eines großformatigen, funktionslosen genetischen Bildschirms identifiziert. Hemmung von XCIFs, wie ACVR1 und PDPK1, mit Kurzhaarnadel-RNA oder kleinen Molekül-Inhibitoren, reaktiviert X-Chromosomen-verknüpfte Gene in kultivierten Zellen. Doch die Machbarkeit und Verträglichkeit der Reaktivierung des inaktiven X-Chromosoms in vivo bleibt abzuwarten. Zu diesem Zweck wurde ein Xist-: Mecp2/Xist: Mecp2-Gfp-Mausmodell mit nicht zufälligem XCI erzeugt, da Xist auf einem X-Chromosom gelöscht wurde. Mit diesem Modell wurde das Ausmaß der inaktiven X-Reaktivierung im Maushirn nach der Behandlung mit XCIF-Inhibitoren quantitiert. Vor kurzem veröffentlichte Ergebnisse zeigen erstmals, dass die pharmakologische Hemmung von XCIFs Mecp2 aus dem inaktiven X-Chromosom in kortikalen Neuronen des lebenden Maushirns reaktiviert.

Introduction

X-Chromosomen-Inaktivierung (XCI) ist ein Prozess der Dosierkompensation, der X-verknüpfte Genexpression ausgleicht, indem eine Kopie des X-Chromosoms bei Frauen1zum Schweigen gebracht wird. Das inaktive X-Chromosom (Xi) sammelt daher charakteristische Merkmale von Heterochromatin, darunter die DNA-Methylierung und hemmende Histonmodifikationen, wie die Histon-H3-Lysin 27-Trimethylation (H3K27me3) und die Histon-H2A-Ubiquitation (H2A) 2. Der Hauptregler des X-Chromosomenschliakings ist die X-Inaktivierungs-Region (Xic), etwa 100 − 500 kb, die das Zählen und Paarung der X-Chromosomen, die zufällige Wahl des X-Chromosoms für die Inaktivierung und die Initiation und Ausbreitung von Schweigen entlang des X-Chromosoms 3. Der Prozess der X-Inaktivierung wird durch X-inaktive spezifische Transkription (Xist) eingeleitet, die den Xi in cis beschichtet, um Chromosomen-Sichern zu vermitteln und die dreidimensionale Struktur des X-Chromosoms4 neu zu modellieren. In jüngster Zeit haben mehrere proteomische und genetische Bildschirme zusätzliche Regulatoren von XCI identifiziert, wie zum Beispiel Xist interagierende Proteine 5,6,7,8, 9 , 10 , 11 , 12. Zum Beispiel hat eine frühere Studie mit einem unvoreingenommenen genom-weiten RNA-Interferenzbildschirm 13 Trans-wirkende XCI-Faktoren(XCIFs) 12 identifiziert. Mechanisch regulieren XCIFs den Xist-Ausdruck und führen daher zu defekten XCI12, die die XCIFs-Funktion stören. Zusammen haben die jüngsten Fortschritte auf diesem Gebiet wichtige Einblicke in die molekularen Maschinen gegeben, die für die Initiierung und Aufrechterhaltung von XCI erforderlich sind.

Die Identifizierung der XCI-Regulatoren und das Verständnis ihres Mechanismus in XCI sind für X-gebundene menschliche Krankheiten wie das Rett-Syndrom (RTT) 13,14direkt relevant. RTT ist eine seltene Neuroentwicklungsstörung, die durch eine heterozygöse Mutation im X-verknüpften Methyl-CpG-Bindungsprotein 2 (MECP2) verursacht wird, das vorwiegend Mädchen 15 betrifft. Da sich MECP2 auf dem X-Chromosom befindet, sind RTT-Mädchen heterozygös für MECP2 -Mangel mit ~ 50% Zellen, die Wild-Typ und ~ 50% Ausdruck der Mutant MECP2ausdrücken. Vor allem die RTT-Mutantzellen beherbergen eine ruhende, aber wilde Kopie von Mecp2 auf dem Xi, die eine Quelle des funktionellen Gens darstellt, das, wenn es reaktiviert wird, möglicherweise Symptome der Krankheit lindern könnte. Neben RTT gibt es noch einige andere X-gebundene menschliche Krankheiten, für die die Reaktivierung von Xi einen möglichen therapeutischen Ansatz darstellt, wie das DDX3X-Syndrom.

Hemmung von XCIFs, 3-phosphoinositid-abhängigem Protein Kinase-1 (PDPK1) und Aktivierung von A-Rezeptor Typ 1 (ACVR1), entweder durch kurze Haarnadel-RNA (shRNA) oder kleine Molekül-Inhibitoren, reaktiviert Xi-verknüpfte 12. Die pharmakologische Reaktivierung von Xi-verknüpften Genen wird in verschiedenen Ex-vivo-Modellen beobachtet, die Maus-Fischblätter-Linien, erwachsene Maus-kortikale Neuronen, Mäuse-Embryonalfibroblasten und Fibroblast-Zelllinien, die von einem RTT-Patienten12abgeleitet werden, umfassen. Ob in vivo eine pharmakologische Reaktivierung von Xi-gebundenen Genen möglich ist, bleibt jedoch abzuwarten. Ein begrenzender Faktor ist das Fehlen wirksamer Tiermodelle, um die Expression von Genen aus reaktivierten Xi genau zu messen. Zu diesem Ziel wurde ein Xist-: Mecp2/Xist: Mecp2-Gfp-Maus-Modell erstellt, das in allen Zellen ein genetisch beschriftetes Mecp2 auf Xi in allen Zellen trägt, da es im Xist auf dem mütterlichen X-Chromosom 16 eine heterozygöse Löschung gibt. Mit diesem Modell wurde der Ausdruck von Mecp2 von Xi nach der Behandlung mit XCIFs-Inhibitoren im Gehirn lebender Mäuse quantitativ behandelt. Hier wird die Generation der Xist-: Mecp2/Xist: Mecp2-Gfp-Maus-Modell und-Methodik zur Quantisierung der Xi-Recaktivierung in kortikalen Neuronen mit immunluoreszenalen Assays beschrieben.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Die Arbeiten mit Mäusen wurden vom Institutional Animal Care and Use Committee (IACUC; #4112) der University of Virginia genehmigt.

1. Generieren Sie ein nicht zufälliges XCI-Maus-Modell mit genetisch gekennzeichnetem Mecp2 auf Xi

NOTE: Die in der Studie verwendeten Mäusestämme waren: Mecp2-Gfp/Mecp2-Gfp (Mecp2tm3.1Bird, Materialtisch) und Xist/-Xist (B6;129-Xist; zur Verfügung gestellt von Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle). Die Zuchtstrategien unter den jeweiligen Sorten wurden entwickelt, um die Mauskolonien für jede Sorte zu erweitern.

  1. Führen Sie PCR-Genotypisierung auf allen Mäusenstämmen und den jeweiligen Nachkommen durch, die nach der Zucht mit genspezifischen Primern gewonnen werden, die in Tabelle 1aufgeführt sind.

2. Die Strategie zur Zucht von Maus zu entwerfen, um Xistin zu erzeugen: Mecp2/Xist: Mecp2-Gfp

  1. Richten Sie ein Zuchtpaar ein, indem Sie ein Mecp2-Gfp/Y-Männchen und ein Xist--Mecp2/Xist-Mecp2-Weibchen zusammen beherbergen (12 h/12 h: Hell-Dunkeln-Zyklus) (Abbildung 1A). Im Idealfall werden mindestens 5 Brutpaare gleichzeitig mit lebensfähigen und fruchtbaren Mäusen aufgestellt. Nachdem das schwangere Weibchen gebären hat, erlaube ihr, ihren ersten Wurf mit dem Männchen zu heben.
    NOTE: Da der väterliche Xist-Knockout die eingeprägten XCI, die Dosierkompensationund die Differenzierungswege 17 beeinträchtigt, wird die Verwendung von Xist-------und Y-Mäusen in der Zucht die weiblichen Welpen mit dem erforderlichen Genotyp nicht produzieren.
  2. Nach dem Entwennen des Wurfes am post-natalen Tag 21 (P21), identifizieren und markieren Sie die Xist-: Mecp2/Xist: Mecp2-Gfp weibliche Welpen mit einem PCR-basierten Genotyping-Assay (Abbildung 1B).
    NOTE: In Bezug auf die Anzahl der Tiere pro Gruppe wurden für die unten gemeldeten Ergebnisse 5 Zuchtpaare eingerichtet, die etwa 10 weibliche Xist-: Mecp2/Xist: Mecp2-Gfp-Mäuse erzeugten .
  3. Verwenden Sie weibliche Mausmodelle für alle vorgeschlagenen Experimente.
    NOTE: Sex ist eine wichtige biologische Variable für XCI-Studien, und das männliche Modell berücksichtigt nicht die verwirrenden Effekte von zufälligem XCI.
  4. Um während der gesamten Tierstudien konsistent zu sein und jegliche Auswirkungen des Tieralters auszuschließen, führen Sie alle Experimente mit 5 − 8 Wochen alten Xisten-: Mecp2/Xist: Mecp2-Gfp-Mäuse durch.

3. Isolate Female Xist-: Mecp2/Xist: Mecp2-Gfp Mouse Embryonale Fibroblasten (MEFs)

  1. Die zeitliche Paarung zwischen dem Mecp2-Gfp/Y-Männchen und dem Xist--Mecp2/Xist-Mecp2 -Weibchen. Stellen Sie mindestens 3 − 4 Paarungskäfige ein, um die Wahrscheinlichkeit einer Schwangerschaft zu erhöhen.
  2. Nach der Bestätigung der Scheidenstecker am Morgen nach der Paarung, trennen Sie das Weibchen und wird an diesem Tag als embryonaler Tag 0,5 (E0.5). Überwachen Sie die Gewichtszunahme der angehenden schwangeren Frau und inspizieren Sie visuell den Bauch der Mäuse, um die Schwangerschaft zu bestätigen. Auf E14.5−15.5 die schwangeren weiblichen Mäuse durch Gebärmutterhalskrebs euthanieren.
  3. Unter einer Laminathaube den Bauch der schwangeren Hündin mit 70% Ethanol abwischen. Mit einer sterilen Schere die Bauchhöhle zerlegen und die Gebärmutterhorne entfernen, die die Embryonen enthalten. Mit Zangen die Embryonen vorsichtig herausnehmen und das restliche Bauchgewebe abschneiden (in der Regel wird erwartet).
  4. Die Gebärmutterhorne, die die Embryonen enthalten, in eine 10 mm Gewebekultur legen. Mit sterilen Scheren und Zangen, einen Schnitt entlang der Gebärmutterhorne, um einzelne Säcke mit einem Embryo zu isolieren. Stellen Sie die Gebärmutterhorne, die den Rest der Embryonen enthalten, vorsichtig in 30 ml sterile Hanks ' ausgewogene Salzlösung (HBSS) auf Eis.
  5. Mit steriler Schere und Zange den Sack sanft aufschneiden und den Embryo isolieren. Die Plazenta entfernen, indem man die Nabelschnur schneidet.
  6. Den Embryo verdampfen.
    NOTE: Während der Rest des Embryonalgewebes weiterverarbeitet wird, wird das Gewebe aus dem Embryonenkopf verwendet, um die DNA für die Genotypisierung zu isolieren.
  7. Öffnen Sie den Bauch, indem Sie die Mittellinie des Embryos mit steriler Schere und Zange schneiden. Entfernen Sie die viszeralen Organe, wie Herz, Leber und Lunge.
  8. Das restliche Embryonalgewebe in eine sterile 60 mm Gewebekulturplatte übertragen und mit einer Schere oder einer Rasierklinge in kleine Stücke schneiden. Um die Zellklumpen aufzubrechen, 3 ml Trypsin-EDTA (0,05%) hinzufügen Inkubat bei 37 ° C für 15 min.
  9. Neutralisieren Sie Trypsin-EDTA, indem Sie 5 mL des modifizierten Eagle-Mediums (Dulbecco) mit 10% fetalem Rinderserum (FBS) und 10 μga/mL penicillin/streptomycin (pen/strep) auf die Platte und trennen das Gewebe durch wiederholendes Pipetting (ca. 20-30 mal).
  10. Drehen Sie die Zellen mit 300 x g für 5 Minuten und setzen Sie das Zellpellet in 4 mL DMEM mit 10% FBS und 10 μg/mL pen/strep wieder aus. Platzieren Sie die Zellen auf einem 60-mm-Kulturgericht, und Kultur die Zellen bei 37 ° C in Anwesenheit von 5% CO2.
  11. Führen Sie die Schritte 3,5 − 3.10 für jeden Embryo aus.
  12. Kultur MEFs in Schritt 3.11 für mindestens 3 − 4 Tage erhalten.
    NOTE: In dieser Phase können MEFs auch für zukünftige Experimente kryoopiert werden.
  13. Um das Geschlecht und den Genotyp jedes Embryos zu bestimmen, führen Sie die Genotyping-PCR mit Hilfe von DNA durch, die von den Köpfen der Embryonen mit Primern und PCR-Bedingungen isoliert ist, die in Tabelle 1aufgeführt sind.

4. Bestätigen Sie den Mangel an grünem Fluoreszenz-Protein (GFP) Expression im Gehirn der Xistin: Mecp2/Xist: Mecp2-Gfp Mice mit einem Ffluoreszenz-Aktivitäts-Assay

  1. Mit Hilfe der Schere die Gehirnrinde vom Rest der Gehirnhälfte trennen, Und platzieren Sie in 1 mL eiskalter Kerne Isolationsmedien (NIM) Puffer mit 250 mM Saccharose, 25 mM Kaliumchlorid (KCl), 5 mM Magnesiumchlorid (MgCl2), 10 mM Tris-Cl, Ergänzt mit 2% Paraformaldehyd (PFA) und 0,1% nonionischem Tensid(Materialtisch).
  2. Mit einem eiskalten Glas-Homogenisierer homogenisieren.
  3. Das homogenisierte Gewebe bei 600 x g,4 ° C für 5 min abdrehen.
  4. Entfernen Sie supernatante und wiederbelebte Pellets in 1 ml von 25% Iodixanol in der NIM-Lösung.
  5. Fügen Sie 1 mL von 29% Lodixanol in NIM-Lösung zu einem 4 mL Ultraentrifugen-Röhre hinzu (auf Eis aufbewahren, bis die Proben fertig sind) und legen Sie sorgfältig 1 mL Probe (in 25% Lodixanol).
  6. Zentrifuge bei 9.000 x g,4 ° C für 10 min in einer Ultraentrifuge.
  7. Aspirate supernatante und wiederbelebte Pellet in 500 μL fluoreszenzaktivierter Zellsortierung (FACS) Puffer (Phosphat-gepufferte Saline [PBS] ergänzt mit 1 mM EDTA, 0,05% Natriumazid und 2% Rinderserum Albumin [BSA]).
    NOTE: Proben können bei 4 ° C oder bis zu einer Woche gelagert werden.
  8. 5 μL von 7-amino-actinomycin D (7-AAD; 50 mg/mL) für 5 Minuten bei Raumtemperatur hinzufügen, um die DNA zu verfärben.
  9. Analysieren Sie Proben für 7-AAD und grünes fluoreszierendes Protein (GFP)-Signal mit Fließzytometrie.

5. Bestimmung der Machbarkeit der Xist-: Mecp2/Xist: Mecp2-Gfp Mouse Model für die Xi-Reaktivierung

  1. Samen 1 x 105 Cells/mL weibliche Xist-: Mecp2/Xist: Mecp2-Gfp MEFs, Mecp2/Mecp2-Gfp und Xist-Mecp2/Y MEFs in Schritt 3.12 in einem 6-Brunnen-Format und in Kammerdias, in DMEM mit 10% FBS und 10 μg/mL pen/strep, bei 37 ° C in der Das Hotel liegt in derNähe des Stadtzentrums von 5%.
    NOTE: Mecp2/Mecp2-Gfp und Xist-Mecp2/Y MEFs werden als positive und negative Kontrollen in den Experimenten eingesetzt.
  2. Nach 24 Stunden frisches Medium in die Zellen geben. Für Xist-: Mecp2/Xist: Mecp2-Gfp MEFs, Mittelwert ergänzt mit XCIFs-Inhibitoren (z.B. 0,5 μM LDN193189 und 2,5 μM GSK650394), oder Fahrzeug allein. Alle 2 Tage das Medium ersetzen, das mit frischem Inhibitor oder Fahrzeug ergänzt wird. Für Mecp2/Mecp2-Gfp und Xist-Mecp2/Y MEFs alle 2 Tage frisches Medium hinzufügen.
  3. Eine Woche Inhibitorbehandlung, die Ernte von MEFs entweder für die RNA-Isolierung (6-Well-Platte) oder die Fixierung von Zellen für die Immunfluoreszenz (Kammerrutschen). Verwenden Sie MEFs, die von Mecp2/Mecp2-Gfp-Embryonen isoliert sind, als positive und Xist-Mecp2/Y Embryonen als negative Kontrollen.
    1. Für die RNA-Isolierung, isolieren Sie die totale RNA durch Guanidinium thiocyanat-basiertes RNA-Extraktionsreagenz und die umgekehrte Transkription mit Hilfe der umgekehrten Transkriptase. Messen Sie den Mecp2 -Gfp-Ausdruck mit Hilfe von Mecp2-WT und Mecp2-GFP und Primern, die in Tabelle1 aufgeführt sind, wie zuvor beschrieben 12.
    2. Für die Immunfluoreszenz, staven MEFs mit einem Anti-GFP-primären Antikörper (1:100), wie zuvor12,16beschrieben. Messen Sie die GFP-Intensität durch die quantitative Immunfluoreszenz in der medikamentös behandelten Xist-: Mecp2/Xist: Mecp2-Gfp MEFs, wie zuvor18beschrieben.

6. Demonstrieren Sie die pharmakologische Xi-Reaktivierung im Gehirn der Xist-: Mecp2/Xist: Mecp2-Gfp Mouse Model

  1. Bereiten Sie Medikamente und die Fahrzeugkontrolle vor.
    1. Bereiten Sie eine frische, sterile Lösung des Fahrzeugs vor (0,9% NaCl, 0,5% Methylzellulose, 4,5% Dimethylsulfoxid [DMSO]) für Gehirninjektionen.
    2. Bereiten Sie chemische Inhibitoren wie 1,5 mM LDN193189 (kleiner Molekül-Inhibitor von ACVR1) und 1,6 mM GSK650394 (kleiner Molekül-Inhibitor von SGK1, Ein nachgeschalteter Effektor von PDPK1) wieder im Fahrzeug (0,9% NaCl, 0,5% Methylcellulose, 4,5% DMSO) oder Fahrzeug allein. Das Gesamtvolumen der chemischen Inhibitoren oder Fahrzeuginjektionen beträgt 10 μL pro Dosis pro Tier.
  2. Warten Sie Tiere auf Gehirnspritzen.
    1. Bereiten Sie den Operationsbereich vor, indem Sie die Bank und das Heizpolster mit Desinfektionsmittel (10% Natriumhypochlorit-Lösung) abwischen.
    2. Die 4 Wochen alte Maus mit einer intraperitonealen Injektion von ketamine/xylazine Gemisch in einer Dosis von 140 mg/kg bzw. 10 mg/kg anstecken. Verwenden Sie den Pedal-Entzugs-Reflex, um den Anästhesiegrad zu bestimmen.
    3. Augenheilkunde nach der Narkose auf die Augen auftragen, um eine Hornhauttrocknung zu verhindern.
    4. Das Fell vom Hals bis zum Kopf der Maus abwehren.
    5. Positionieren Sie die Maus in der stereotaktischen Plattform, indem Sie die Schneidezähne der Maus in den Biss-Riegel des Schnauzenrestrainers stecken und die Nasenklemme über die Schnauze ziehen, während Sie sicherstellen, dass der Kopf der Maus auf einer ebenen Ebene ist.
    6. Stellen Sie die Höhe der Ohrstangen, wenn nötig, um den kaudalen Teil des Gehörgangs zu erreichen, und sichern Sie sie so, dass der Kopf der Maus in einer ebenen Ebene ist und auf der Finger berührend.
    7. Desinfizieren Sie den Kopf der Maus mit abwechselnden Tüchern eines topischen Antiseptikums, wie Povidone-Jod und 70% Ethanol.
  3. Administer Drogen.
    1. Mit einem sterilen Skalpell einen horizontalen Schnitt von 0,75 cm in der Mittelhaut machen.
    2. Mit einem 0,45 mm Bohrer zwei symmetrische Löcher über der rechten und linken kortikalen Hemisphäre bohren (2 mm von der Sagittalnaht und 2 mm von der lambdoiden Naht, etwa die Mitte des parietalen Knochens).
    3. Eine 10 μL-Spritze fest an der stereotaktischen Plattform befestigen.
    4. Mischen Sie die Lösung der chemischen Inhibitoren, und ziehen Sie 10 μL der Lösung in die Spritze. Vermeiden Sie Luftblasen in der Spritze.
    5. Die Spritzennadel in das Bohrloch vorgeben und die Nadel senkrecht (90 °) zum Schädel halten. Wenn die Nadel den Schädel durchquert, null die Koordinaten auf dem stereotaktischen digitalen Display heraus und dann die Nadelspitze vorwärts, bis sie eine Tiefe von 2,5 mm erreicht.
    6. Ziehen Sie die Nadel 0,5 mm in die Tiefe für 2 mm.
    7. Langsam 10 μL Lösung injizieren (~ 1 min). Nachdem die Injektion abgeschlossen ist, lassen Sie die Nadel im Gehirn für ~ 1 min und ziehen Sie die Nadel.
    8. Wiederholen Sie die Injektion für die zweite Hemisphäre (nur Fahrzeugkontrolle).
    9. Mit Hilfe von Nähten oder "Hautkleber" schließen Sie die Haut der Maus (wenn die Wunde > 0,5 cm sind, sollten sowohl Nähte als auch "Hautkleber" verwendet werden).
    10. Lockern Sie die Ohrstöpsel und entfernen Sie die Maus aus dem stereotaktischen Apparat.
    11. Administer Schmerzmittel (Buprenorphine SR 0,5 mg/kg IP) und legen Sie die Maus auf ein Heizkissen auf 37 ° C gesetzt, bis das Tier das Bewusstsein wiedererlangt.
    12. Sobald die Maus wachsam und ansprechbar ist, überträgt das Tier zurück in seinen ursprünglichen Käfig.
    13. Wiederholen Sie die Prozedur alle 2 Tage für 20 Tage. Für nachfolgende Injektionen ist keine Wiederholbohrung des Areals erforderlich.
  4. Isolieren Sie das Gehirn der Maus.
    1. Sobald das Dosissystem abgeschlossen ist, euthanieren Sie die Maus in einer CO2-Kammer .
    2. Mit Nadeln die Maus auf eine Oberfläche.
    3. Machen Sie einen seitlichen Schnitt durch die integumente und Bauchwand direkt unter dem Rippenkäfig mit Schere und Zangen. Die Leber vorsichtig vom Zwerchfell trennen.
    4. Mit einer Schere das Zwerchfell schneiden und die gesamte Länge des Rippenkäfigs entlang schneiden, um die Pleurahöhle zu entlarven.
    5. Mit einer Schere, einen Schnitt an das hintere Ende der linken Herzkammer.
    6. Sofort, beginnen Sie, die rechte Herzkammer mit ~ 15 mL von PBS über ~ 2 min zu injizieren. Leber-Farbwechsel von rot zu hellrosa ist ein Hinweis auf eine gute Durchblutung.
    7. Die rechte Kammer des Mausherz mit ~ 10 mL von 4% Paraformaldehyd in PBS über ~ 2 min injizieren.
    8. Decapitate die Maus, und verwenden Sie die Schere, um einen Mittellinie Schnitt der Kopfhaut zu machen, um den Schädel zu entlarven.
    9. Legen Sie eine Spitze der Schere in das Foramen magnum und schneiden Sie seitlich in den Schädel zum Auge. Wiederholen Sie für die andere Seite. Versuchen Sie, das Ende der Schere so oberflächlich wie möglich zu halten, um Verletzungen des Gehirns zu vermeiden.
    10. Verwenden Sie eine Schere, um die Region zwischen den Augen und über der Nase der Maus zu schneiden.
    11. Verwenden Sie Zangen, um die Schädelknochen von den Gehirnhälften sanft zu schälen.
    12. Heben Sie das Gehirn mit einem Spachtel an und verwenden Sie eine Schere, um die Hirnnervenfasern, die es am Schädel befestigen, vorsichtig zu zerlegen.
    13. Legen Sie das Gehirn auf eine Plastikschale, schneiden Sie das Kleinhirn und olfaktorische Glühbirnen, und platzieren Sie das Gehirn in ein 15 ml Rohr mit 4% PFA gefüllt ist PBS.
  5. Kryo-Abschnitt das Maus-Gehirn.
    1. Fixhirn in 4% Paraformaldehyd in PBS bei 4 ° C über Nacht.
    2. Spülen Sie das Gehirn mit PBS bei 4 ° C mindestens 3 x für je 5 min ab.
    3. Etikettieren Sie die Einwegformen für die Kryokopreservierung des Gewebes.
    4. Die Vorderseite des Gehirns mit einer Schere und Zange ausschneiden (ca. 5 mm aus Injektionsstellen beginnen).
    5. Übertragen Sie das Gehirn auf die Kryomold mit der Vorderseite des Gehirns nach unten, um Koronalabschnitte zu erhalten. Das Gehirn enthaltene Schimmel in die optimale Schneidtemperaturverbindung (OCT) eintauchen.
    6. Flüssigen Stickstoff in eine 10 mm Plastikpetrischale gießen und das Gehirn in der Kryo-Schimmel in den Stickstoff geben.
      NOTE: Es ist wichtig, das Gewebe so zu orientieren, wie es in Schritt 6.5.5 beschrieben wird, um die Gehirnabtrennung zu leiten.
    7. Wenn das OCT fest weiß ist, legen Sie das gefrorene Gehirn in einen Gefrierschrank von-80 ° C zur Lagerung.
    8. Das Gehirn auf-20 ° C für mindestens 30 Minuten vor der Abtrennung mit Kryostat und Kryoschnitt (5 − 6 μm Dicke) gleichgesetzt, wobei 2 − 3 Abschnitte pro Dia montiert werden. Die Folien können für den späteren Gebrauch bei-80 ° C gelagert werden.
  6. Die Reaktivierung von Xi wird mit einem immunluoreszbasierten Ansatz ermittelt.
    1. Vor dem Beginn des Färbung die Hirnabschnitte über Nacht bei 4 ° C trocknen.
    2. Tauchen Sie Dias in Antigen-Abhollösung (0,1 M Zitronensäure, 0,1 M Tris-Basis, pH = 6,0) auf einem 100 ° C-Hitzeblock für 5 min ein.
    3. Waschen Sie die Dias 4x mit 1x PBS für je 5 min bei Raumtemperatur.
    4. Tauchen Sie Dias in Blockierlösung (0,1 MNH 4Cl/0,2% Gelatin/0,05% nonionisches Tensid) für 20 min bei Raumtemperatur.
    5. Dias 3x mit Waschpuffer (PBS/0,2% Gelatine) bei Raumtemperatur für je 5 min waschen.
    6. Färben Sie Hirnabschnitte mit Anti-GFP-AlexaFluor647 (1:100) und Anti-MAP2 (1:1000) Antikörpern im Inkubationsmedium (PBS/0,2% Gelatin/1% BSA) und Inkubat bei 4 ° C über Nacht.
    7. Sammeln Sie primäre Antikörper (kann wiederverwendet werden). Waschen Sie Dias 4x mit Waschpuffer für insgesamt 30 min bei Raumtemperatur.
    8. Inkubate Hirnabschnitte mit Ziegengewebe Fluorescein isothiocyanat (FITC)-beschrifteten sekundären Antikörper (1:1000) in Inkubationsmedium und Inkubat 1 − 2 h bei Raumtemperatur in der Dunkelheit.
    9. Waschen Sie Dias 4x mit Waschpuffer für insgesamt 30 min bei Raumtemperatur.
    10. Legen Sie einen Tropfen Montagemessmedium mit 4 ', 6-diamidino-2-Phenylindole (DAPI) auf eine 22 mm x 50 mm Koppel, dann drehen Sie den Koppel auf eine Folie, die alle Gewebeabschnitte bedeckt.
    11. Bild auf einem Mikroskop und passen Sie die Bilder auf Kontrast und Helligkeit. Erfassen Sie Bilder und quantifizieren Sie die Anzahl der GFP-positiven Zellen sowohl für medikamentöse als auch für die von Fahrzeugen behandelte Xistin: Mecp2/Xist: Mecp2-Gfp Maus-Hirnhälften.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Um die Machbarkeit der Xist-: Mecp2/Xist: Mecp2-Gfp-Maus für Xi-Reaktivierungsstudien zu demonstrieren, wurde die XCIF-Inhibitor-vermittelte Reaktivierung der Xi-verknüpften Mecp2 -Gfp in Mäuse-Embryonalfibroblasten (MEFs) getestet. Weibliche MEFs wurden ab dem Tag 15.5 Xistin: Mecp2/Xist: Mecp2-Gfp Embryonen isoliert, wie in Abschnitt 3 (Abbildung 1A) beschrieben. Die Genotypen der weiblichen Xist-: Mecp2/Xist: Mecp2-Gfp MEFs wurden durch die genotypische PCR, wie sie zuvorbeschrieben wurde, 19 (Abbildung1B) und FACS-basierte Chay (Abbildung 1C) bestätigt. Die MEFs wurden entweder mit DMSO oder den beiden Medikamenten LDN193189 und GSK650394 (0,5 μM bzw. 2,5 μM) für 7 Tage behandelt. Nach der medikamentösen Behandlung wurde der Ausdruck von Mecp2-Gfp von qRT-PCR überwacht. Wie in Abbildung 1D, die medikamentöse Behandlung, aber nicht DMSO, reaktivierte Ausdruck von Xi-Mecp2-Gfp. Als nächstes wurde die quantitative Immunfluoreszenz durchgeführt, um das Ausmaß der Xi-Mecp2-Gfp-Expression in einzelnen MEFs zu bestimmen, wie sie in Schritt 5.3.2 beschrieben wird. Als Hintergrund wurde das Signal von der Negativkontrolle MEFs gesetzt, die von männlichen Embryonen (Mecp2/Y) isoliert wurden, und ~ 66% der positiven Kontrolle Mecp2-Gfp/Mecp2 MEFs hatten ein atomares GFP-Signal. Wie zu erwarten, Xist-: Mecp2/Xist: Mecp2-Gfp MEFs, die mit DMSO behandelt wurden, hatten ein sehr niedriges Niveau an KernGFP (~ 3%). Im Gegensatz dazu waren ~ 31% der drogenbehandelten Xistin: Mecp2/Xist: Mecp2 MEFs waren positiv für die KernGFP (Abbildung 1E). Zusammen zeigen diese Ergebnisse, dass XCIF-Inhibitoren Xi-verknüpfte Mecp2 in MEFs reaktivieren, aber das Ausmaß der Xi-Reaktivierung variiert in der Zellpopulation.

Um die Machbarkeit des pharmakologischen Xi-Reaktivierungsbasierten Ansatzes in vivo zu beurteilen, ob die medikamentöse Behandlung im Gehirn von Xistin: Mecp2/Xist: Mecp2-Gfp weibliche Mäuse reaktiviert. 10 μL Fahrzeug oder 10 μL XCIF-Inhibitoren (1,5 mM LDN193189 und 1,6 mM GSK650394) wurden in Gegenüber der Gehirnhälfte von 4-wöchigen Xi-Mecp2 -Gfp weiblichen Mäusen durch intraerebroventrikuläre Injektion durch stereotaktische chirurgische Eingriffe ( Bild 2A , B). Die Prozedur wurde jeden zweiten Tag wiederholt (Abbildung 2C), und drei Wochen später wurden Tiere euthaniert und Gehirne isoliert. Ein Teilsatz wurde für qRT-PCR verwendet, und ein anderer wurde von der Immunhistochemie analysiert. Der Ausdruck von Wild-Typ Mecp2 und Xi-Mecp2-Gfp in den fahrzeug-und drogeninfizierten Hemisphären wurde durch qRT-PCR (Sequenzen von Primern, die in Tabelle 1aufgeführt sind) ermittelt. Wie in Abbildung 2Dgezeigt, reaktivierte die medikamentöse Behandlung Xi-Mecp2-Gfp in ~ 30% der Zellen in der medikamentös angetriebenen Gehirnhälfte, während Xi- Mecp2 -Gfp in der von Fahrzeugen durchgepressten Hemisphäre nicht nachgewiesen wurde. Eine große Anzahl von MAP2, ein neuronaler Marker, positive Neuronen waren auch GFP positiv (~ 45%) In der drogenbehandelten Hemisphäre, bezeichnend für Xi-Mecp2-Gfp Ausdruck. Etwa 20% der MAP2-negativen Gehirnzellen bedrückten GFP, was die Reaktivierung vonXi-Mecp2 -Gfp in nicht-neuronalen Zellen bestätigt (Abbildung 2E).

Figure 1
Abbildung 1: Generierung und Validierung Xi-Mecp2 Mausmodell. (A) Schematik der Zuchtstrategie zur Erzeugung von Xist-: Mecp2/Xist: Mecp2-Gfp-Mäuse . (B) PCR Genotypisierung von Xist:Mecp2-Gfp/Y, Xist-: Mecp2/Xist: Mecp2 und Xist-: Mecp2/Xist: Mecp2-Gfp-Mäuse. Die Mäuse wurden auf die Anwesenheit von Mecp2-Gfp, Mecp2 und der Sexualbestimmungsregion Y (SRY) überwacht. C) Strömungszytometrie-Analyse von Kernen, die vom Mauskortex isoliert sind. Mecp2/Mecp2-Gfp Maustelcortex zeigt ~ 50% der GFP-positiven Nuklei, während Xist-: Mecp2/Xist: Mecp2-Gfp keine GFP-positiven Nuklei zeigt. (D) Die qRT-PCR-Analyse zur Überwachung des Ausdrucks von Mecp2 -Gfp und wilden Mecp2 -Transkripten in weiblicher Xist-: Mecp2/Xist: Mecp2-Gfp MEFs nach der Behandlung mit DMSO oder Droge (LDN193189 und GSK650394). Gapdh wurde als Ladesteuerung überwacht. (E) Quantitative Immunfluoreszenzüberwachung GFP-Intensität in weiblicher Xist-: Mecp2/Xist: Mecp2-Gfp MEFs nach der Behandlung mit DMSO oder den Medikamenten LDN193189 und GSK650394. Als Negativ- bzw . Positivsteuerungen wurden MEFs, die von Mecp2/Y oder Mecp2/Mecp2-Gfp-Mäuse isoliert wurden, eingesetzt. Jeder Punkt stellt eine MEF dar, und die gestrichelte Zeile zeigt das maximale Hintergrundsignal an, das in Mecp2/Y erhalten wurde , das auf 1 gesetzt wurde. Untere Tafel zeigt repräsentative Bilder von Kernen. Diese Figur wurde von Przanowski et al. 16 geändert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figure 2
Abbildung 2: Pharmakologische Reaktivierung von X-verknüpftem Mecp2 in zerebralen kortikalen Neuronen lebender Mäuse. (A) Schematic of a mouse Schädel and (B) brain showing the site of injinjagto for vehicle or drug in the left or right hemispheres of the brain. (C) Schematic of the drug Regimen. D) repräsentative Immunfluoreszenzbilder, die endogenes GFP-Signal (grün) in koronalen Hirnabschnitten aus Fahrzeug-oder drogenbehandelten Hemisphären zeigen. Die DAPI-Färbung wird in blau dargestellt. E) repräsentative Immunfluoreszenzbilder der koronalen Hirnabschnitte, die den Ausdruck von GFP (Anti-GFP; rot) und MAP2 (grün) in drogenbehandelten Hemisphären überwachen. Die DAPI-Färbung wird in blau dargestellt. Diese Figur wurde von Przanowski et al. 16 geändert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Reverse Primer (5 '-> 3 ') Abstufung der Temperatur/der PCR-Produktlänge
GGCATGACTGTGGTCATGAG 60 ° C/87 bp
GCTGAACTTGTGGCCGTTTA 62 ° C/137 bp
TGTCAGAGCCCTACCCATAAG 62 ° C/140 bp
GCACAACCCCGCAAATGCTA 62 ° C/364 bp
GCACAACCCCGCAAATGCTA 62 ° C/250 bp
AATTGCCCTAACGAGCACAC 62 ° C/436 bp
GAACTTCAGGGTCAGCTTGC 62 ° C/217 bp
CTCCTCTGACTTTAGCCCTCCGA 66 ° C/270 bp

Tabelle 1: Liste der Primer, die für die Genotypisierung und quantitative Echtzeit-RT-PCR verwendet werden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Zuvor wurden XCIFs identifiziert, die selektiv für das Schweigen von Xi-verknüpften Genen in Säugetierzellen benötigt werden. Wir haben weitere potente kleine Molekül-Inhibitoren optimiert, um XCIFs, wie ACVR1 und nachgelagerte Effekte von PDPK1, die Xi-linked Mecp2 in Maus-Fischblastzelllinien, Mauskortikalneuronen und einer menschlichen Fibroblast effektiv reaktivieren Zeile abgeleitet von einem RTT-Patienten. Diese Ergebnisse deuten darauf hin, dass die Xi-Reaktivierung ein plausibler therapeutischer Ansatz zur Rettung der Gendefizite bei X-gebundenen Krankheitserkrankungen ist; Die in vivo-Machbarkeit bleibt jedoch noch zu ermitteln. Vor kurzem wurde gezeigt, dass XCIF-Inhibitoren Xi-verknüpfte Mecp2 in vivo reaktivieren, für die ein nicht zufälliges Xist-: Mecp2/Xist: Mecp2-Gfp-Maus-Modell erstellt wurde.

Ein attraktives Merkmal der Xist-: Mecp2/Xist: Mecp2-Gfp-Modell ist, dass es aus mehreren Gründen eine genaue Quantifizierung der Xi-verknüpften Mecp2 -Reaktivierung ermöglicht. Erstens: Durch die Löschung von Xist auf dem mütterlichen X-Chromosom, die Xist-: Mecp2/Xist: Mecp2-Gfp Maus hat nicht zufällige XCI. Das Ergebnis ist, dass die genetisch beschriftete Mecp2 in 100% der Zellen (Abbildung 1C) verstummt, im Gegensatz zu einer erwarteten 50:50-Expression von X-verknüpften Genen in zufälligen XCI-Mäuse-Modellen wie Xist:Mecp2/Xist:Mecp2-Gfp. Daher werden die Ergebnisse nicht durch den Mosaik-Ausdruck GFP ausgeschlossen, und 100% Zellen tragen Mecp2-Gfp auf Xi in der Xist-: Mecp2/Xist: Mecp2-Gfp-Modell . Zweitens ermöglicht die genetische Kennzeichnung von Mecp2 die direkte Visualisierung einzelner Neuronen mit reaktivierter GFP und minimiert damit die experimentellen Manipulationen in der neuronalen Analyse.

Eine aktuelle Studie hat herausgefunden, dass die intracerebroventrikuläre Injektion der XCIF-Inhibitoren in der Maus GehirnhälftedieXi-verknüpfte Mecp2 reaktiviert, indem sie die Immunfluoreszenzanalyse des Maushirns 16 verwendet. Wichtig ist, dass die medikamentöse Behandlung keine nachteiligen Auswirkungen auf die allgemeine Gesundheit hatte, wie zum Beispiel Gewicht, Pflege oder Mobilität16. Außerdem gibt es keine Toxizität, die durch die medikamentöse Behandlung in der Leber oder Milz festgestellt wird. Zusammen liefert diese Studie einen wesentlichen prinzipiellen Beweis, um zu zeigen, dass die Einmischung in die Funktion von XCIFs zu einer Entdrückung von Xi in vivo führt.

Zusammenfassend lässt sich sagen, dass ein sensibles Mausmodell verwendet werden kann, um die Reaktivierung von Xi zu bewerten. Dieses Tiermodelldesign kann auch für die Generierung eines verbesserten RTT-Mausmodells angepasst werden, das Mecp2 -Mutationen (wahrscheinlich weniger symptomatisch) auf dem aktiven X-Chromosom und Wild-Typ Mecp2 auf dem Xi in allen Zellen erntet. Aufgrund des nicht zufälligen XCI, während die phänotypischen Symptome stärker ausgeprägt sein können, wird erwartet, dass dieses Modell auch eine bessere Bewertung und genaue Beurteilung der Umkehrung der Symptome durch Xi Reaktivierung ermöglichen wird. Zusätzlich kann die Xist-: Mecp2/Xist: Mecp2-Gfp auch modifiziert werden, um die Xi-Reaktivierung in anderen X-gebundenen Krankheitsmodellen wie dem DDX3X-Syndrom zu untersuchen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Die Autoren danken Antonio Bedalov für die Bereitstellung von Reagenzien; University of Virginia Tissue Histology Core for Kryosectioning; University of Virginia Flow Cytometry Core für Fließzytometrie-Analyse; Christian Blue und Saloni Singh für technische Hilfe bei der Genotypisierung. Diese Arbeit wurde unterstützt durch einen Doppel-Hoo-Forschungsstipendium an Z.Z. und einen Pilot-Projektprogramm-Award von der University of Virginia-Virginia Tech Seed Fund Award und den Hartwell Foundation Individual Biomedical Research Award an S.B.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics