En icke-slumpmässig mus modell för farmakologisk Reaktive ring av Mecp2 på inaktiva X-kromosomen

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här, vi beskriver ett protokoll för att generera en livskraftig kvinnlig murina modell med icke-slumpmässiga X-kromosomen inaktive ring, dvs, den maternella-ärvda X-kromosomen är inaktiv i 100% av cellerna. Vi beskriver också ett protokoll för att testa genomförbarhet, tolerabilitet och säkerhet för farmakologisk reaktive ring av den inaktiva X-kromosomen in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X-kromosom inaktive ring (XCI) är slumpmässig dämpning av en X-kromosom hos Honor för att uppnå gen dos balans mellan könen. Som ett resultat, alla Honor är heterozygot för X-länkade gen uttryck. En av de viktigaste regulatorerna av XCI är xist, vilket är viktigt för initiering och underhåll av xci. Tidigare studier har identifierat 13 trans verkande X kromosom inaktive rings faktorer (XCIFs) med hjälp av en storskalig, förlust av funktion genetisk skärm. Hämning av XCIFs, såsom ACVR1 och PDPK1, med kort-hårnål RNA eller små molekyl hämmare, reaktiverar X kromosom-länkade gener i odlade celler. Men genomförbarheten och tolerabiliteten för återaktivering av den inaktiva X-kromosomen in vivo återstår att fastställa. Mot detta mål, en Xistδ: Mecp2/xist: Mecp2-GFP mus modell har genererats med icke-Random xci på grund av radering av xist på en X-kromosom. Med den här modellen kvantifierades omfattningen av den inaktiva X-reaktiveringen i mus hjärnan efter behandling med XCIF-hämmare. Nyligen publicerade resultat visar, för första gången, att farmakologisk hämning av XCIFs reaktiverar Mecp2 från inaktiva X-kromosomen i kortikala nerv celler i levande mus hjärna.

Introduction

X-kromosom inaktive ring (XCI) är en process för DOS kompensation som balanserar X-länkade gen uttryck genom att tysta en kopia av X-kromosomen hos Honor1. Som ett resultat, den inaktiva X-kromosomen (XI) ackumuleras karakteristiska egenskaper hos Heterokromatin inklusive DNA-metylering och hämmande histonmodifieringar, såsom Histon H3-lysin 27 trimetylering (H3K27me3) och Histon H2A ubikvitineras (H2Aub) 2. befälhavaren regulator av x-kromosom ljud dämpning är x-inactivation Center (XIC) region, cirka 100 − 500 KB, som styr räkning och ihopkoppling av x-kromosomer, det slumpmässiga valet av x-kromosomen för inaktive ring, och initiering och spridning av ljud dämpning längs X-kromosomen3. Processen för X inaktive ring initieras av X inaktiva specifika avskrift (xist) som täcker XI i CIS att förmedla kromosom-Wide ljud dämpning och remodel den tredimensionella strukturen av x-kromosom4. Nyligen har flera proteomiska och genetiska skärmar identifierat ytterligare tillsynsmyndigheter för xci, såsom xist samverkande proteiner5,6,7,8,9 , 10 , 11 för att , 12. till exempel, en tidigare studie med en opartisk GENOMTÄCKANDE RNA-interferensskärm identifierade 13 trans-acting xci-faktorer (xcifs)12. Mekanistiskt, XCIFs reglera xist uttryck och därför stör xcifs funktion orsakar defekta xci12. De senaste framstegen inom området har tillsammans gett viktiga insikter i de molekyl ära maskiner som krävs för att initiera och underhålla XCI.

Identifiering av xci regulatorer och förstå deras mekanism i xci är direkt relevant för X-länkade mänskliga sjukdomar, såsom Rett syndrom (RTT)13,14. RTT är en sällsynt neuroutvecklingsstörning som orsakas av en heterozyma mutation i X-länkade metyl-CpG bindande protein 2 (MECP2) som drabbar övervägande flickor15. Eftersom MECP2 ligger på X-kromosomen, RTT flickor är heterozygot för MECP2 -brist med ~ 50% celler uttrycker vild-typ och ~ 50% uttrycker Mutant MECP2. Särskilt, RTT Mutant celler hamn en vilande men vild-typ kopia av Mecp2 på XI, som ger en källa till den funktionella genen, som om återaktiveras, skulle kunna lindra symtom på sjukdomen. Förutom RTT, det finns flera andra X-länkade mänskliga sjukdomar, för vilka reaktive ring av XI representerar en potentiell terapeutisk metod, såsom DDX3X syndrom.

Hämning av XCIFs, 3-fosfoinositid beroende protein Kinas-1 (PDPK1), och Activin A receptor typ 1 (ACVR1), antingen genom kort hårnål RNA (shRNA) eller små molekyl hämmare, reaktiverar XI-länkade gener12. Farmakologisk reaktive ring av XI-länkade gener observeras i olika ex vivo-modeller som inkluderar mus fibroblast cellinjer, vuxna mus kortikala nerv celler, mus embryonala fibroblaster, och fibroblast cellinjer som härrör från en RTT patient12. Om farmakologisk reaktive ring av XI-länkade gener är genomförbar in vivo återstår dock att påvisa. En begränsande faktor är avsaknaden av effektiva djur modeller för att noggrant mäta uttrycket av gener från reaktive rad XI. Mot detta mål, en xistδ: Mecp2/xist: Mecp2-GFP mus modell har genererats som bär en genetiskt märkt Mecp2 på XI i alla celler på grund av heterozygot radering i xist på moderns X-kromosom16. Med denna modell har uttrycket Mecp2 från XI kvantifierats efter behandling med xcifs-hämmare i hjärnan hos levande möss. Här, generationen av Xistδ: Mecp2/xist: Mecp2-GFP mus modell och metodik för att kvantifiera XI reaktive ring i kortikala nerv celler med hjälp av immunofluorescence-baserade analyser beskrivs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Arbete som involverar möss godkändes av University of Virginia institutionella djur vård och användning kommittén (IACUC, #4112).

1. generera en icke-slumpmässig XCI mus modell med genetiskt märkt Mecp2 på XI

Anmärkning: Mus stammar som användes i studien var följande: Mecp2-GFP/Mecp2-GFP (Mecp2TM 3.1 Bird, material tabell) och xist/δxist (B6; 129-xist < tm5Sado >; tillhandahålls av Antonio bedalov, fred Hutchinson Cancer Center, Seattle). Avels strategierna bland de respektive stammarna har utformats för att utvidga muskolonierna för varje stam.

  1. Utför PCR-genotypning på alla möss stammar och respektive avkommor som erhålls efter avel med hjälp av genspecifika primers listade i tabell 1.

2. designa musen avel strategi för att generera Xistδ: Mecp2/xist: Mecp2-GFP

  1. Skapa ett avels par genom att inhysa en Mecp2-GFP/Y hane och en XistΔ-Mecp2/xist-Mecp2 hona tillsammans (12 h/12 h: ljus/mörker-cykel) (figur 1a). Helst sätta upp minst 5 avel par i taget med livskraftiga och fertila möss. Efter den gravida kvinnan föder, låt henne att höja sin första kull med hanen.
    Anmärkning: Eftersom paternal xist knockout försämrar märkt xci, dosering kompensation, och differentiering vägar17, kommer användningen av xistδ-Mecp2/Y möss i avel Miss lyckas med att producera de kvinnliga ungarna med erforderlig genotyp.
  2. Efter avvänjning av kullen på post-Natal dag 21 (P21), identifiera och tagga Xistδ: Mecp2/xist: Mecp2-GFP honungar med en PCR-baserad genotypning analys (figur 1b).
    Anmärkning: När det gäller antalet djur som behövs per grupp, för de resultat som redovisas nedan, inrättades 5 avels par som genererade cirka 10 kvinnliga Xistδ: Mecp2/xist: Mecp2-GFP- möss.
  3. Använd kvinnliga mus modeller för alla föreslagna experiment.
    Anmärkning: Sex är en viktig biologisk variabel för XCI studier, och den manliga modellen inte står för de störande effekterna av slumpmässiga XCI.
  4. Att vara konsekvent i hela djur studier och utesluta eventuella effekter av djur åldern, utföra alla experiment i 5 − 8-veckors-gammal kvinnlig Xistδ: Mecp2/xist: Mecp2-GFP möss.

3. isolera kvinnlig Xistδ: Mecp2/xist: Mecp2-GFP mus embryonala fibroblaster (mefs)

  1. Ställ in tidsinställd parning mellan Mecp2-GFP/Y hane och Xistδ-Mecp2/xist-Mecp2 hona. Ställ in minst 3 − 4 parnings burar för att öka sannolikheten för graviditet.
  2. Efter att ha bekräftat vaginal plugg morgonen efter parning, separera den kvinnliga och denna dag anses embryonal dag 0,5 (E 0.5). Övervaka viktökning hos blivande gravida kvinnor och visuellt inspektera buken av möss för att bekräfta graviditet. På E 14,5 − 15,5, euthanize de gravida honmöss via cervikal disloksering.
  3. Under en laminär huva, torka av buken av den gravida kvinnan med 70% etanol. Med hjälp av sterila saxar, dissekera bukhålan och ta bort livmoder hornen som innehåller embryona. Använda pincett, försiktigt ta ut embryona samtidigt skära av resterande buk vävnad (6 − 12 embryon är vanligt vis förväntas).
  4. Placera livmoder hornen som innehåller embryona i en 10 mm vävnad-kultur skålen. Med hjälp av sterila saxar och pincett, gör ett snitt längs livmoder hornen för att isolera enskilda säckar som transporterar ett embryo. Placera försiktigt livmoder hornen som innehåller resten av embryona i 30 mL steril Hanks bal anse rad saltlösning (HBSS) på isen.
  5. Försiktigt skära öppna SAC och isolera embryot med hjälp av sterila saxar och pincett. Ta bort moderkakan genom att skära navel strängen.
  6. Decapitate embryot.
    Anmärkning: Medan resten av den embryonala vävnaden kommer att bearbetas ytterligare, vävnad från embryot huvudet kommer att användas för att isolera DNA för genotypning.
  7. Öppna buken genom att skära av embryots mitt linje med hjälp av sterila saxar och pincett. Ta bort visceral organ, såsom hjärta, lever, och lungor.
  8. Överför resterande embryonala vävnad till en steril 60 mm vävnad-kultur tallrik och skärs i små bitar med hjälp av sax eller ett rakblad. För att bryta öppna cell klumpar, tillsätt 3 mL trypsin-EDTA (0,05%) och inkubera vid 37 ° c i 15 minuter.
  9. Neutralisera trypsin-EDTA genom att tillsätta 5 mL Dulbecco ' s modifierade Eagle medium (DMEM) med 10% fostrets bovint serum (FBS) och 10 μg/mL penicillin/streptomycin (penna/STREP) till plattan och separera vävnaden genom upprepad pipettering (ca 20 − 30 gånger).
  10. Snurra ner cellerna på 300 x g i 5 min och återsuspendera cellpelleten i 4 ml DMEM med 10% FBS och 10 μg/ml penna/STREP. Platta cellerna på en 60 mm kultur mat rätt, och kultur cellerna vid 37 ° c i närvaro av 5% CO2.
  11. Utför steg 3.5 − 3.10 för varje embryo.
  12. Kultur MEFs erhållits i steg 3,11 för minst 3 − 4 dagar.
    Anmärkning: I detta skede kan MEFs också fryses för framtida experiment.
  13. För att bestämma kön och genotyp hos varje embryo, utför genotypning-PCR med DNA som Isoler ATS från huvudena på embryona med primers och PCR-tillstånd som anges i tabell 1.

4. bekräfta bristen på grönt fluorescerande protein (GFP) uttryck i hjärnan av Xistδ: Mecp2/xist: Mecp2-GFP möss med hjälp av en Ffluorescence aktive rad cell sortering-baserad analys

  1. Med hjälp av saxar, separera hjärn Barken från resten av hjärn halvorna, och placera i 1 mL is-kallt kärnor isolering media (NIM) buffert som innehåller 250 mM sackaros, 25 mM kaliumklorid (KCl), 5 mM magnesiumklorid (MgCl2), 10 mm tris-cl, kompletterat med 2% paraformaldehyd (PFA) och 0,1% nonioniskt ytaktivt ämne (material tabell).
  2. Homogenisera med hjälp av en iskall glas Homogenisatorer.
  3. Snurra ner homogeniserad vävnad vid 600 x g, 4 ° c i 5 min.
  4. Avlägsna supernatanten och återsuspendera pelleten i 1 mL 25% iodixanol i NIM-lösning.
  5. Tillsätt 1 mL 29% lodixanol i NIM-lösning till ett 4 mL ultracentrifugerör (förvara på is tills proverna är klara) och noggrant lager 1 mL av provet (i 25% lodixanol).
  6. Centrifugera vid 9 000 x g, 4 ° c i 10 min i en ultracentrifuge.
  7. Aspirera supernatanten och återsuspendera pellet i 500 μL fluorescensaktiverad cell sortering (FACS) buffert (fosfatbuffrad saltlösning [PBS] kompletterad med 1 mM EDTA, 0,05% natriumazid och 2% bovint serumalbumin [BSA]).
    Anmärkning: Proverna kan förvaras vid 4 ° c eller upp till 1 vecka.
  8. Tillsätt 5 μL 7-amino-Actinomycin D (7-AAD; 50 mg/mL) i 5 min vid rums temperatur för att färga DNA.
  9. Analysera prover för 7-AAD och grönt fluorescerande protein (GFP) signal med flödescytometri.

5. Bestäm genomförbarheten för Xistδ: Mecp2/xist: Mecp2-GFP- mus modellen för XI Reactivation

  1. Frö 1 x 105 celler/ml kvinnlig Xistδ: Mecp2/xist: Mecp2-GFP Mefs, Mecp2/Mecp2-GFP och xist-Mecp2/Y mefs erhållna i steg 3,12 i ett 6-VÄLFORMAT och i kammar bilder, i DMEM med 10% FBS och 10 μg/ml penna/STREP, vid 37 ° c i förekomst av 5% CO2.
    Anmärkning: Mecp2/Mecp2-GFP och xist-Mecp2/Y mefs används som positiva och negativa kontroller i experimenten.
  2. Tillsätt friskt medium till cellerna efter 24 timmar. För Xistδ: Mecp2/xist: Mecp2-GFP mefs, tillsätt medium kompletterat med xcifs-hämmare (t. ex., 0,5 μm LDN193189 och 2,5 μm GSK650394), eller enbart vehikel. Ersätt medium kompletterat med färsk hämmare eller vehikel var 2 dagar. För Mecp2/Mecp2-GFP och xist-Mecp2/Y mefs, tillsätt färskt medium var 2: a dag.
  3. Post 1 vecka av inhibitor behandling, skörd mefs endera för RNA isolering (6-brunn platta) eller sätta fast cellerna för immunofluorescens (kammare glidningen). Använd MEFs isolerade från Mecp2/Mecp2-GFP embryon som positiva och xist-Mecp2/Y embryon som negativa kontroller respektive.
    1. För RNA-isolering, isolera totalt RNA genom guanidinium tiocyanat-baserade RNA extraktion reagens, och omvänd transkribera med omvänd transkriptas. Mät Mecp2-GFP uttryck genom kvantitativ omvänd transkriptase-PCR (QRT-PCR) med Mecp2-WT och Mecp2-GFP, och primers som anges i tabell 1, som beskrivits tidigare12.
    2. För immunofluorescens, fläcken mefs med en anti-GFP primär anti kropp (1:100), som beskrivits tidigare12,16. Mät GFP intensitet genom kvantitativ immunofluorescens i läkemedelsbehandlad Xistδ: Mecp2/xist: Mecp2-GFP mefs, som beskrivits tidigare18.

6. demonstrera den farmakologiska XI Reaktive ringen i hjärnan hos Xistδ: Mecp2/xist: Mecp2-GFP mus modell

  1. Förbered droger och fordons kontroll.
    1. Förbered en fräsch, steril lösning av fordonet (0,9% NaCl, 0,5% metylcellulosa, 4,5% dimetylsulfoxid [DMSO]) för hjärn injektioner.
    2. Förbered kemiska hämmare inklusive 1,5 mM LDN193189 (liten molekyl hämmare av ACVR1) och 1,6 mM GSK650394 (liten molekyl hämmare av SGK1, en nedströms effektor av PDPK1) återsuspenderad i fordon (0,9% NaCl, 0,5% metylcellulosa, 4,5% DMSO), eller fordon Ensam. Den totala volymen av kemiska hämmare eller injicerat fordon är 10 μL per dos per djur.
  2. Förbered djur för hjärn injektioner.
    1. Förbered Operations området genom att torka av bänken och värme plattan med desinfektions medel (10% natriumhypoklorit lösning).
    2. Anesthetize den 4 veckor gamla musen med en intraperitoneal injektion av Ketamin/xylazin blandning i en dos av 140 mg/kg och 10 mg/kg, respektive. Använd pedalen tillbaka dragande reflex att bestämma nivån av anestesi.
    3. Applicera oftalmisk salva i ögonen efter induktion av anestesi för att förhindra att horn hinnan torkar.
    4. Raka av pälsen från halsen till toppen av huvudet på musen.
    5. Placera musen i stereotaktiska plattform genom att haka på musens framtand tänder i bita baren på nos och dra åt näsan klämman över nos samtidigt som man ser till att musens huvud är på ett plant plan.
    6. Justera höjden på öron stängerna, vid behov, för att nå den kaudala delen av hörsel gången, säkra dem så att musens huvud är i ett plant plan och immobiliserade på finger beröring.
    7. Desinficera huvudet av musen med alternerande våtservetter av en aktuell antiseptisk, såsom povidon-jod och 70% etanol.
  3. Administrera droger.
    1. Med hjälp av en steril skalpell, gör en 0,75 cm horisontellt snitt i mitten av hår botten.
    2. Borra två symmetriska hål ovanför de högra och vänstra kortikala hjärn halvorna (2 mm från sagittal suturen och 2 mm från lambdoid-suturen, ungefär mitt i parietalbenet) med ett 0,45 mm grader.
    3. Sätt fast en 10 μL spruta på den stereotaktiska plattformen.
    4. Blanda lösningen av kemiska hämmare och dra 10 μL lösning i sprutan. Undvik eventuella luft bubblor i sprutan.
    5. För in sprutnålen i Burr hålet och bibehålla nålen vinkel rätt (90 °) mot skallen. När nålen korsar skallen, nollut koordinaterna på stereotaktiska digitala displayen och sedan avancera spetsen på nålen tills den når ett djup av 2,5 mm.
    6. Dra ut injektionsnålen 0,5 mm till djupet för 2 mm.
    7. Injicera långsamt 10 μL lösning (~ 1 min). Efter injektionen är klar, lämna nålen i hjärnan för ~ 1 min och sedan dra ut nålen.
    8. Upprepa injektionen för den andra hjärn halvan (endast vehikel-kontroll).
    9. Använda suturer eller "hudlim" stänga huden på musen (om såret är > 0.5 cm både suturer och "hudlim" bör användas).
    10. Lossa öron stängerna och ta bort musen från den stereotaktiska apparaten.
    11. Administrera analgetika (buprenorfin SR 0,5 mg/kg IP) och placera musen på en värme dyna inställd på 37 ° c tills djuret återfår medvetandet.
    12. När musen är alert och lyhörd, överföra djuret tillbaka till sin ursprungliga bur.
    13. Upprepa proceduren var 2 dag i 20 dagar. Upprepad borrning av området krävs inte för efterföljande injektioner.
  4. Isolera mus hjärnan.
    1. När dosregimen är avslutad, euthanize musen i en CO2 kammare.
    2. Immobilisera musen på en yta med hjälp av nålar.
    3. Gör en lateral snitt genom utrustningen och buk väggen precis under revbenen med sax och pincett. Separera levern försiktigt från membranet.
    4. Använda sax, skär membranet och fortsätta skära längs hela längden på revbenen för att exponera pleuramesoteliom hålighet.
    5. Använda sax, göra ett snitt till den bakre änden av den vänstra ventrikeln.
    6. Omedelbart, börja injicera rätt hjärt kammare med ~ 15 mL PBS över ~ 2 min. lever färg förändring från röd till ljusrosa är ett tecken på god per fusion.
    7. Injicera den högra kammaren i mus hjärtat med ~ 10 mL 4% paraformaldehyd i PBS över ~ 2 min.
    8. Hals huggningen musen, och använda sax för att göra en mitt linjen snitt i hår botten för att exponera skallen.
    9. Placera ett tips av saxen i foramen magnum, och skär i sidled i skallen mot ögat. Upprepa för den andra sidan. Försök att hålla änden av saxen så ytlig som möjligt för att undvika skador på hjärnan.
    10. Använd saxen för att skära regionen mellan ögonen och ovanför musens näsa.
    11. Använd pincett att försiktigt skala kranial benen från hjärn halvorna.
    12. Lyft hjärnan med en spatel, och använda sax för att försiktigt dissekera kranial nerv fibrer att fixa det till skallen.
    13. Placera hjärnan på en plast mat rätt, klippa ut lillhjärnan och lukt lökar, och placera hjärna i en 15 mL tub fylld med 4% PFA är PBS.
  5. Cryo-avsnitt musen hjärnan.
    1. Fix hjärna i 4% paraformaldehyd i PBS vid 4 ° c över natten.
    2. Skölj hjärnan med PBS vid 4 ° c minst 3x för 5 min vardera.
    3. Märk engångsformar för krykonservering av vävnader.
    4. Klipp ut fram sidan av hjärnan med hjälp av sax och pincett (börja göra ~ 5 mm sektioner från injektions ställen).
    5. Överföra hjärnan till cryomold med fram sidan av hjärnan vänd nedåt för att få koronala sektioner. Sänk formen som innehåller hjärnan i den optimala skär temperatur föreningen (ULT).
    6. Häll flytande kväve i en 10 mm plast petriskål och placera hjärnan i Cryo-mögel i kvävet.
      Anmärkning: Det är viktigt att orientera vävnaden som beskrivs i steg 6.5.5 att vägleda snittningen av hjärnan.
    7. När ULT är fast vitt, placera den frusna hjärnan i en-80 ° c frys för förvaring.
    8. Equilibrate hjärnan till-20 ° c i minst 30 min före snittning med kryostat och kryosektion (5 − 6 μm tjocklek) hjärnan, montering 2 − 3 sektioner per bild. Dia bilder kan förvaras vid-80 ° c för senare användning.
  6. Bestäm XI reaktive ring med hjälp av en immunofluorescens-baserad metod.
    1. Torka hjärn delarna över natten vid 4 ° c innan du påbörjar Färgnings proceduren.
    2. Sänk ned dia bilderna i antigen hämtnings lösning (0,1 M citron syra, 0,1 M tris-bas, pH = 6,0) på en 100 ° c värme block i 5 min.
    3. Tvätta glasen 4x med 1x PBS i 5 min vardera vid rums temperatur.
    4. Sänk ned glasen i blockerande lösning (0,1 M NH4cl/PBS/0,2% gelatin/0,05% nonioniskt ytaktivt ämne) i 20 min vid rums temperatur.
    5. Tvätta glasen 3x med tvättbuffert (PBS/0.2% gelatin) vid rums temperatur i 5 min vardera.
    6. Fläcken hjärn sektioner med anti-GFP-AlexaFluor647 (1:100) och anti-MAP2 (1:1000) anti kroppar i inkubations medium (PBS/0.2% gelatin/1% BSA) och inkubera vid 4 ° c över natten.
    7. Samla in primära anti kroppar (kan återanvändas). Tvätta dia bilder 4x med tvättbuffert för sammanlagt 30 min i rums temperatur.
    8. Inkubera hjärn sektioner med get anti-kyckling fluorescein Isotiocyanat (FITC)-märkt sekundär anti kropp (1:1000) i inkubations medium och inkubera 1 − 2 h vid rums temperatur i mörker.
    9. Tvätta dia bilder 4x med tvättbuffert för sammanlagt 30 min i rums temperatur.
    10. Placera en droppe av monterings mediet med 4 ′, 6-diamidino-2-fenylindole (DAPI) på en 22 mm x 50 mm täckglas, sedan Invertera täckglasen på en bild, som täcker alla vävnad sektioner.
    11. Bild på ett Mikroskop och justera bilder för kontrast och ljus styrka. Ta bilder och kvantifiera antalet GFP-positiva celler för både läkemedelsinducerad och vehikel-behandlad Xistδ: Mecp2/xist: Mecp2-GFP -mushjärn halvklot.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

För att påvisa genomförbarheten av xistδ: Mecp2/xist: Mecp2-GFP mus modell för XI reaktive ring studier, xcif inhibitor-medierad reaktive ring av XI-länkade Mecp2-GFP testades i mus embryonala fibroblaster (mefs). Kvinnliga MEFs isolerades från dag 15,5 Xistδ: Mecp2/xist: Mecp2-GFP- embryon enligt beskrivningen i avsnitt 3 (figur 1a). Genotyperna av kvinnlig Xistδ: Mecp2/xist: Mecp2-GFP mefs bekräftades genom genotyping-PCR, som beskrivits tidigare19 (figur 1b), och FACS-baserad analys (figur 1c). MEFs behandlades med antingen DMSO eller de två läkemedlen LDN193189 och GSK650394 (0,5 μM och 2,5 μM, respektive) för 7 dagar. Efter läkemedels behandling, uttryck för Mecp2-GFP övervakades av QRT-PCR. Som framgår av figur 1d, drogen behandling, men inte DMSO, återaktiveras uttryck för XI-Mecp2-GFP. Därefter utfördes kvantitativ immunofluorescens för att bestämma omfattningen av XI-Mecp2-GFP- uttryck i enskilda mefs, enligt beskrivningen i steg 5.3.2. Signal från negativ kontroll MEFs isolerade från manliga embryon (Mecp2/Y) sattes som bakgrund, och ~ 66% av positiv kontroll Mecp2-GFP/Mecp2 mefs hade en nukleär GFP-signal. Som väntat, Xistδ: Mecp2/xist: Mecp2-GFP mefs behandlas med DMSO hade en mycket låg nivå av nukleär GFP (~ 3%). Däremot ~ 31% av drogbehandlade Xistδ: Mecp2/xist: Mecp2 mefs var positiva för nukleära GFP (figur 1e). Tillsammans, dessa resultat visar att XCIF-hämmare återaktivera XI-länkade Mecp2 i mefs, men omfattningen av XI reaktive ring varierar i cell populationen.

För att bedöma genomförbarheten av farmakologisk XI-reaktiveringsbaserad metod in vivo, om läkemedels behandling reaktiverar XI-länkade Mecp2 i hjärnan av Xistδ: Mecp2/xist: Mecp2-GFP honmöss under Sök tes. 10 μL av vehikeln eller 10 μL XCIF-hämmare (1,5 mM LDN193189 och 1,6 mM GSK650394) administrerades i motsatta hjärn halvklot av 4-veckors-gamla XI-Mecp2-GFP honmöss genom intracerebroventrikulär injektion med hjälp av stereotaktiska kirurgiska ingrepp ( Figur 2A , B). Proceduren upprepades varannan dag (figur 2C), och tre veckor senare, djur var avlivas, och hjärnor isolerades. En delmängd användes för qRT-PCR och en annan analyserades av immunhistokemi. Uttrycket av vildtyps- Mecp2 och XI-Mecp2-GFP i de vehikel-och droginfunderade halvkloten bestämdes av QRT-PCR (sekvenser av primers listade i tabell 1). Som visas i figur 2D, drog behandling återaktiveras XI-Mecp2-GFP i ~ 30% av cellerna i drogen-infunderas hjärn halvan, medan XI- Mecp2-GFP inte upptäcktes i fordonet-infunderas halvklotet. Ett stort antal MAP2, en neuronala markör, positiva neuroner var också GFP positiva (~ 45%) i den drogbehandlade hjärn halvan, indikativt för XI-Mecp2-GFP- uttryck. Cirka 20% av MAP2 negativa hjärn celler uttryckte GFP, bekräftar XI-Mecp2-GFP reaktive ring i icke-neuronala celler (figur 2e).

Figure 1
Figur 1: generering och validering XI-Mecp2 mus modell. ASchematisk för avels strategin för att generera Xistδ: Mecp2/xist: Mecp2-GFP- möss. BPCR genotypning av xist: Mecp2-GFP/Y, Xistδ: Mecp2/xist: Mecp2 och Xistδ: Mecp2/xist: Mecp2-GFP- möss. Möss övervakades för närvaron av Mecp2-GFP, Mecp2 och kön-bestämning region Y (sry). (C) flödescytometri analys av kärnor isolerade från mus Barken. Mecp2/Mecp2-GFP mus cortex show ~ 50% av GFP-positiva kärnor medan Xistδ: Mecp2/xist: Mecp2-GFP visar inga GFP-positiva kärnor. DQRT-PCR-analys som övervakar uttrycket av Mecp2-GFP och Wild-Type Mecp2 transkriptioner i kvinnlig Xistδ: Mecp2/xist: Mecp2-GFP mefs efter behandling med DMSO eller Drug (LDN193189 och GSK650394). GAPDH övervakades som en lastnings kontroll. (E) kvantitativ immunofluorescens-övervakning GFP-intensitet hos kvinnlig Xistδ: Mecp2/xist: Mecp2-GFP mefs efter behandling med DMSO eller droger LDN193189 och GSK650394. MEFs isolerade från Mecp2/Y eller Mecp2/Mecp2-GFP möss användes som negativa respektive positiva kontroller. Varje punkt representerar en MEF och den streckade linjen anger den maximala bakgrunds signalen som erhölls i Mecp2/Y, vilken var inställd på 1. Undre panelen visar representativa bilder av Atom kärnor. Denna siffra har ändrats från Przanowski et al.16. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: farmakologisk reaktive ring av X-länkade Mecp2 i hjärn kortikala neuroner av levande möss. (A) Schematisk av en mus skalle och (b) hjärnan som visar platsen för injektion för fordon eller läkemedel i vänster eller höger hjärn halvklot. C) Schematisk behandling av läkemedlet. (D) representativa immunofluorescens-bilder som visar ENDOGENA GFP-signaler (grön) i hjärn sektioner i koronar från fordon-eller drogbehandlade halvklot. DAPI-färgning visas i blått. (E) representativa immunofluorescensbilder av de koronala hjärn avsnitten som övervakar uttrycket av GFP (anti-GFP; röd) och MAP2 (grönt) i den drogbehandlade hjärn halvan. DAPI-färgning visas i blått. Denna siffra har ändrats från Przanowski et al.16. Vänligen klicka här för att se en större version av denna siffra.

Omvänd primer (5 '-> 3 ') Anealing temperatur/PCR produkt längd
Mer från GGCATGGACTGTGGTCATGAG 60 ° c/87 BP
Mer från GCTGAACTTGTGGCCGTTTA 62 ° c/137 BP
Mer från TGTCAGAGCCCTACCCATAAG 62 ° c/140 BP
Mer från GCACAACCCCGCAAATGCTA 62 ° c/364 BP
Mer från GCACAACCCCGCAAATGCTA 62 ° c/250 BP
Mer från AATTGCCCTAACGAGCACAC 62 ° c/436 BP
Mer från GAACTTCAGGGTCAGCTTGC 62 ° c/217 BP
CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 BP

Tabell 1: förteckning över primers som används för genotypning och kvantitativ real tids RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tidigare identifierades de XCIFs-celler som selektivt krävs för ljud dämpning av XI-länkade gener i kvinno cellerna12. Vi ytterligare optimerade potenta små molekyl hämmare att rikta xcifs, såsom ACVR1 och nedströms manipulatorer av PDPK1, som effektivt återaktivera XI-länkade Mecp2 i mus fibroblast cellinjer, mus kortikala nerv celler, och en mänsklig fibroblast cell linje som härrör från en RTT-patient. Dessa resultat tyder på att XI reaktive ring är en trovärdig terapeutisk metod för att rädda gen brister hos X-länkade sjukdoms patienter; Det återstår dock att fastställa genomförbarheten för in vivo. Nyligen visades XCIF-hämmare återaktivera XI-länkade Mecp2 in vivo, för vilka en icke-slumpmässig Xistδ: Mecp2/xist: Mecp2-GFP mus modell genererades.

En attraktiv egenskap hos Xistδ: Mecp2/xist: Mecp2-GFP- modellen är att den tillåter en noggrann kvantitation av den XI-länkade Mecp2 reaktive ring av flera skäl. Först, på grund av radering av xist på moderns X-kromosomen, den Xistδ: Mecp2/xist: Mecp2-GFP Mouse har icke-slumpmässiga xci. Som ett resultat, den genetiskt märkta Mecp2 är tyst i 100% av cellerna (figur 1c), till skillnad från en förväntad 50:50 uttryck för X-länkade gener i slumpmässiga xci möss modeller, såsom xist: Mecp2/xist: Mecp2-GFP. Därför är resultaten inte hindras av mosaik uttryck av GFP, och 100% celler bär Mecp2-GFPXI i Xistδ: Mecp2/xist: Mecp2-GFP- modellen. För det andra, den genetiska märkningen av Mecp2 tillåter direkt visualisering av enskilda nerv celler med reaktive rad GFP, vilket minimerar de experimentella manipulationer i neuronala analys.

En nyligen studie fann att intracerebroventrikulär injektion av XCIF-hämmare i mus hjärn halvan reaktiverar XI-länkade Mecp2 med hjälp av immunofluorescens analys av musen hjärnan16. Viktigt, drog behandling hade ingen negativ effekt på den allmänna hälsan, såsom vikt, grooming, eller rörlighet16. Dessutom, det finns ingen toxicitet upptäcks av läkemedels behandling i levern eller mjälte. Tillsammans ger denna studie ett viktigt Proof-of-princip för att visa att störa funktionen av XCIFs leder till derepression av XI in vivo.

Sammanfattnings vis kan en känslig mus modell användas för att utvärdera reaktive ringen av XI. Denna djur modell design kan också anpassas för att generera en förbättrad RTT mus modell som hamnar Mecp2 mutationer (förmodligen mindre symptomatisk) på den aktiva X-kromosomen och Wild-typ Mecp2 på XI i alla celler. På grund av icke-slumpmässiga XCI, medan de fenotypiska symtomen kan vara mer uttalad, det förväntas att denna modell kommer också att möjliggöra en bättre utvärdering och korrekt bedömning av återföring av symtom på grund av XI reaktive ring. Dessutom kan Xistδ: Mecp2/xist: Mecp2-GFP också modifieras för att studera XI reaktive ring i andra X-länkade sjukdoms modeller, såsom DDX3X syndromet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Författarna tackar Antonio Bedalov för att tillhandahålla reagenser; University of Virginia vävnad histologi Core för krysnittning; University of Virginia Flow Cytometri kärna för flödescytometri analys; Christian Blue och Saloni Singh för teknisk assistans med genotypning. Detta arbete stöddes av en Double Hoo Research Grant till Z.Z., och en pilot projekt program Award från University of Virginia-Virginia Tech Seed Fund Award och Hartwell stiftelsen individuell biomedicinsk forskning Award till S.B.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics