En ikke-tilfeldig Mouse modell for farmakologisk reaktivering av Mecp2 på inaktiv X-kromosom

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi en protokoll for å generere en levedyktig kvinnelig murine modell med ikke-tilfeldig X-kromosom inaktive, det vil si at moderskap X-kromosom er inaktiv i 100% av cellene. Vi beskriver også en protokoll for å teste gjennomførbarhet, toleranse og sikkerhet for farmakologisk reaktivering av det inaktive X-kromosom in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X kromosom inaktive (XCI) er tilfeldig demping av ett X-kromosom i kvinner for å oppnå gen dosering balanse mellom kjønnene. Som et resultat, er alle kvinner heterozygot for X-bundet genuttrykk. En av de viktigste regulatorer av XCI er Xist, som er avgjørende for initiering og vedlikehold av XCI. Tidligere studier har identifisert 13 trans fungerende X-kromosom inaktive faktorer (XCIFs) ved hjelp av en stor skala, tap-of-Function genetisk skjerm. Hemming av XCIFs, slik som ACVR1 og PDPK1, ved bruk av kort-eller små molekyl hemmere, reaktiverer X kromosom-tilknyttede gener i kultivert celler. Men gjennomførbarhet og toleranse for reaktivering av inaktive X-kromosom in vivo gjenstår å bestemmes. Mot dette målet har en XistΔ: Mecp2/Xist: Mecp2-Gfp musemodell blitt generert med ikke-tilfeldige XCI på grunn av sletting av Xist på ett X-kromosom. Ved hjelp av denne modellen, omfanget av inaktive X reaktivering ble quantitated i musen hjernen etter behandling med XCIF-hemmere. Nylig publiserte resultater viser, for første gang, at farmakologisk hemming av XCIFs reaktiverer Mecp2 fra inaktive X-kromosom i kortikale neurons av levende mus hjernen.

Introduction

X kromosom deaktivering (XCI) er en prosess med dosering kompensasjon som balanserer X-bundet genuttrykk ved å stanse en kopi av X-kromosom i kvinner1. Som et resultat, den inaktive X-kromosom (XI) akkumulerer karakteristiske trekk ved heterochromatin inkludert DNA metylering og hemmende histone modifikasjoner, for eksempel histone H3-lysin 27 trimethylation (H3K27me3) og histone H2A ubiqitinering (H2Aub) 2. The Master regulator av x-kromosom deaktivering er x-deaktivering Center (Xic) regionen, rundt 100 − 500 kB, som styrer telling og sammenkobling av x-kromosomer, tilfeldig valg av x-kromosom for inaktive, og initiering og spredning av demping langs X-kromosom3. Prosessen med X inaktive er initiert av X inaktiv spesifikk transkripsjon (Xist) som strøk XI i CIS for å megle kromosom hele stanse og renovere den tredimensjonale strukturen i X-kromosom4. Nylig har flere Proteomikk og genetiske skjermer identifisert flere regulatorer av XCI, sliksom Xist samspill proteiner5,6,7,8,9 , 10 andre , 11 flere , 12. for eksempel, en tidligere studie ved hjelp av en upartisk Genova-Wide RNA forstyrrelser skjermen identifisert 13 trans-fungerende XCI faktorer (XCIFs)12. Mechanistically, XCIFs regulere Xist uttrykk og derfor forstyrrer XCIFs funksjonen forårsaker defekt XCI12. Sammen har nylige fremskritt i feltet gitt viktig innsikt i molekyl maskineriet som kreves for å initiere og vedlikeholde XCI.

Identifisering av XCI regulatorer og forstå deres mekanisme i XCI er direkte relevant for X-tilknyttede menneskelige sykdommer, som rett syndrom (RTT)13,14. RTT er en sjelden neurodevelopmental lidelse forårsaket av en heterozygot mutasjon i X-tilknyttede metyl-CpG bindende protein 2 (MECP2) som rammer overveiende jenter15. Fordi MECP2 ligger på X-KROMOSOM, RTT jenter er heterozygot for MECP2 mangel med ~ 50% celler uttrykker vill-type og ~ 50% uttrykker mutant MECP2. Spesielt RTT mutant celler havn en sovende men vill-type kopi av Mecp2 på XI, som gir en kilde til funksjonell genet, som hvis reaktivert, potensielt kan lindre symptomer på sykdommen. I tillegg til RTT, er det flere andre X-tilknyttede menneskelige sykdommer, som reaktivering av XI representerer en potensiell terapeutisk tilnærming, for eksempel DDX3X syndrom.

Hemming av XCIFs, 3-fosfoinositid avhengige protein kinase-1 (PDPK1), og activin A reseptor type 1 (ACVR1), enten ved korte hæler RNA (shRNA) eller små molekyl hemmere, reaktiverer XI-koblede gener12. Farmakologisk reaktivering av XI-tilknyttede gener er observert i ulike ex vivo-modeller som inkluderer muse Fibroblast cellelinjer, voksen mus kortikale neurons, mus embryonale fibroblaster, og Fibroblast cellelinjer avledet fra en RTT pasient12. Men hvorvidt farmakologisk reaktivering av XI-koblede gener er gjennomførbart i vivo gjenstår å bli demonstrert. En begrensende faktor er mangelen på effektive dyremodeller for å nøyaktig måle uttrykk for gener fra reaktivert XI. Mot dette målet, en XistΔ: Mecp2/Xist: Mecp2-Gfp mus modellen har blitt generert som bærer en genetisk merket Mecp2 på XI i alle cellene på grunn av heterozygot sletting i Xist på mors X-kromosom16. Ved hjelp av denne modellen har uttrykket Mecp2 fra Xi blitt quantitated etter behandling med XCIFs-hemmere i hjernen til levende mus. Her beskrives genereringen av XistΔ: Mecp2/Xist: Mecp2-Gfp musemodell og metodikk for å quantitate XI reaktivering i kortikale neurons med immunofluorescence-baserte analyser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Arbeid med mus ble godkjent av University of Virginia institusjonelle Animal Care og use Committee (IACUC; #4112).

1. Generer en ikke-tilfeldig XCI Mouse modell med genetisk merket Mecp2 på XI

Merk: Mouse stammer som brukes i studien var som følger: Mecp2-Gfp/Mecp2-Gfp (Mecp2TM 3.1 Bird, tabell over materialer) og Xist/ΔXist (B6; 129-Xist < tm5Sado >; levert av Antonio Bedalov, fred Hutchinson Cancer Center, Seattle). Avl strategier blant de respektive stammene har blitt designet for å utvide muse koloniene for hver belastning.

  1. Utfør PCR-genotyperingteknologi på alle mus stammer og respektive Progenies oppnådd etter avl ved hjelp av gen spesifikke primere som er oppført i tabell 1.

2. design Mouse avl strategi for å generere XistΔ: Mecp2/Xist: Mecp2-Gfp

  1. Sett opp et avl par ved å bo en Mecp2-Gfp/Y hann og en XistΔ-Mecp2/Xist-Mecp2 hunn sammen (12 h/12 h: lys/mørk syklus) (figur 1a). Ideelt sett opp minst 5 avl parene om gangen ved hjelp av levedyktige og fruktbare mus. Etter den gravide kvinnelige føder, la henne til å heve sitt første kull med den mannlige.
    Merk: Fordi fars Xist knockout HEMMER trykt XCI, dosering kompensasjon, og differensiering trasé17, bruk av XistΔ-Mecp2/Y mus i avl vil mislykkes i å produsere den kvinnelige valper med nødvendige genotype.
  2. Etter venne kullet på post-Natal dag 21 (P21), identifisere og tag det XistΔ: Mecp2/Xist: Mecp2-Gfp kvinner pups benytter en PCR-basert genotyperingteknologi analysen (skikkelsen 1B).
    Merk: Inne pris av antallet av dyrene behøvde per gruppe, for det resultater rapportere neden, 5 formering parene var stille opp hvilke utviklet ca 10 kvinner XistΔ: Mecp2/Xist: Mecp2-Gfp mus.
  3. Bruk kvinnelige musemodeller for alle de foreslåtte eksperimentene.
    Merk: Sex er en viktig biologisk variabel for XCI studier, og den mannlige modellen ikke står for forvirrende effekter av tilfeldige XCI.
  4. For å være konsekvent gjennom dyrestudier og utelukke noen effekter av dyret alder, utføre alle eksperimenter i 5 − 8-ukers-gamle kvinnelige XistΔ: Mecp2/Xist: Mecp2-Gfp mus.

3. isolere kvinne XistΔ: Mecp2/Xist: Mecp2-Gfp Mouse embryonale fibroblaster (MEFs)

  1. Sett opp tidsbestemt paring mellom Mecp2-Gfp/Y mannlige og XistΔ-Mecp2/Xist-Mecp2 hunn. Sett opp minst 3 − 4 par Rings bur for å øke sannsynligheten for graviditet.
  2. Etter å ha bekreftet vaginal pluggen morgenen etter mating, skille den kvinnelige og denne dagen anses embryonale dagen 0,5 (E 0.5). Overvåk vektøkning av den potensielle gravide kvinnelige og visuelt inspisere magen av mus for å bekrefte svangerskapet. På E 14.5 − 15.5, euthanize gravide kvinnelige mus via cervical forvridning.
  3. Under en laminær hette, tørk magen av den gravide hunn med 70% etanol. Ved hjelp av sterile saks, analysere bukhulen og fjerne livmor hornene inneholder embryo. Bruke tang, forsiktig ta ut embryo mens kutte av gjenværende abdominal vev (6 − 12 embryo er vanligvis forventet).
  4. Plasser livmor hornene inneholder embryo i en 10 mm vev-kultur parabolen. Ved hjelp av sterile saks og tang, gjør et snitt langs livmor hornene å isolere enkelte SACs bærer et embryo. Legg forsiktig til livmor hornene som inneholder resten av embryo i 30 mL steril Hanks ' balanserte saltløsning (HBSS) på is.
  5. Forsiktig kuttet åpne SAC og isolere fosteret ved hjelp av sterile saks og tang. Fjern morkaken ved å kutte navlestrengen.
  6. Halshugge fosteret.
    Merk: Mens resten av den embryonale vevet vil bli videre behandlet, vevet fra embryo hodet vil bli brukt til å isolere DNA for genotyperingteknologi.
  7. Åpne magen ved å kutte midtlinjen av fosteret ved hjelp av steril saks og tang. Fjern visceral organer, for eksempel hjerte, lever og lunger.
  8. Overfør de resterende embryonale vevet inn i en steril 60 mm vev-kultur plate og skåret i små biter ved hjelp av saks eller en barberhøvel blad. For å bryte åpne cellen klumper, tilsett 3 mL Trypsin-EDTA (0,05%) og ruge ved 37 ° c i 15 min.
  9. Nøytralisere Trypsin-EDTA ved å legge til 5 mL Dulbecco ' s modifiserte Eagle medium (DMEM) med 10% fosterets storfe serum (FBS) og 10 μg/mL penicillin/Streptomycin (penn/strep) til platen og distansere vevet ved repeterende pipettering (ca. 20 − 30 ganger).
  10. Snurr ned cellene ved 300 x g i 5 min og re-suspendere celle pellet i 4 ml DMEM med 10% FBS og 10 μg/ml penn/strep. Plate cellene på en 60 mm kultur rett, og kultur cellene ved 37 ° c i nærvær av 5% CO2.
  11. Utfør trinn 3.5 − 3.10 for hvert embryo.
  12. Kultur MEFs innhentet i trinn 3,11 i minst 3 − 4 dager.
    Merk: På dette stadiet, MEFs kan også være embryo for fremtidige eksperimenter.
  13. For å bestemme kjønn og genotype for hvert embryo, Utfør genotyperingteknologi-PCR ved hjelp av DNA isolert fra hodene til embryo ved hjelp av primere og PCR forhold oppført i tabell 1.

4. Bekreft mangelen på grønne fluorescerende protein (GFP) uttrykk i Brain av XistΔ: Mecp2/Xist: Mecp2-GFP mus ved hjelp av en Ffluorescence aktivert Cell sortering-basert analyse

  1. Ved hjelp av saks, skille hjernebarken fra resten av hjernen halvkuler, og plasser i 1 mL av iskalde kjerner isolasjons medier (NIM) buffer som inneholder 250 mM sukrose, 25 mM kalium klorid (KCl), 5 mM magnesium klorid (MgCl2), 10 mm Tris-CL, suppleres med 2% paraformaldehyde (PFA), og 0,1% ioniske overflateaktivt middel (tabell med materialer).
  2. Homogenisere ved hjelp av en iskald glass homogenisator.
  3. Snurr ned homogenisert vev ved 600 x g, 4 ° c i 5 min.
  4. Fjern supernatanten og resuspend pellet i 1 mL 25% iodixanol i NIM-oppløsning.
  5. Tilsett 1 mL 29% lodixanol i NIM-oppløsning til et 4 mL ultracentrifuge rør (oppbevares på is til prøvene er klare) og nøye lag 1 mL av prøven (i 25% lodixanol).
  6. Sentrifuger ved 9 000 x g, 4 ° c i 10 min i en ultracentrifuge.
  7. Aspirer supernatanten og resuspend pellets i 500 μL av fluorescens aktivert celle sortering (FACS) buffer (fosfat-bufret saltvann [PBS] supplert med 1 mM EDTA, 0,05% natrium Natriumazid, og 2% storfe serum albumin [BSA]).
    Merk: Prøvene kan oppbevares ved 4 ° c eller opp til 1 uke.
  8. Tilsett 5 μL av 7-amino-actinomycin D (7-AAD; 50 mg/mL) i 5 min ved romtemperatur for å flekk DNA.
  9. Analyser prøver for 7-AAD og grønt fluorescerende protein (GFP) signal ved hjelp av Flow flowcytometri.

5. Bestem gjennomførbarhet av XistΔ: Mecp2/Xist: Mecp2-Gfp Mouse modell for XI reaktivering

  1. Seed 1 x 105 celler/ml hunn XistΔ: Mecp2/Xist: Mecp2-Gfp MEFs, Mecp2/Mecp2-Gfp og Xist-Mecp2/Y MEFs innhentet i trinn 3,12 i et 6-BRØNN format og i KAMMER lysbilder, i DMEM med 10% FBS og 10 μg/ml penn/strep, ved 37 ° c i tilstedeværelsen av 5% CO2.
    Merk: Mecp2/Mecp2-Gfp og Xist-Mecp2/Y MEFs brukes som positive og negative kontroller i eksperimentene.
  2. Legg friskt medium til cellene etter 24 h. For XistΔ: Mecp2/Xist: Mecp2-Gfp MEFs, tilsett medium supplert med XCIFs-hemmere (f. eks, 0,5 μm LDN193189 og 2,5 μM GSK650394), eller kjøretøy alene. Erstatt medium supplert med fersk inhibitor eller kjøretøy alene hver 2 dager. For Mecp2/Mecp2-Gfp og Xist-Mecp2/Y MEFs, legge friskt medium hver 2 dager.
  3. Post 1 uke av inhibitor behandling, høste MEFs enten for RNA isolasjon (6-brønn plate) eller fikse celler for immunofluorescence (kammer lysbilder). Bruk MEFs isolert fra Mecp2/Mecp2-Gfp embryo som positive og Xist-Mecp2/Y embryo som negative kontroller hhv.
    1. For RNA-isolering kan du isolere total RNA ved å guanidiniumklorid ammoniumthiocyanat RNA-reagens, og reversere transkribere ved hjelp av omvendt transkriptase. Mål Mecp2-Gfp uttrykk ved kvantitativ omvendt TRANSKRIPTASE-PCR (QRT-PCR) ved hjelp av Mecp2-WT og Mecp2-Gfp, og primere oppført i tabell 1, som beskrevet tidligere12.
    2. For immunofluorescence, beis MEFs med et anti-GFP primær antistoff (1:100), som beskrevet tidligere12,16. Mål GFP intensitet ved kvantitativ immunofluorescence i legemiddel behandlet XistΔ: Mecp2/Xist: Mecp2-GFP MEFs, som beskrevet tidligere18.

6. demonstrere farmakologisk XI reaktivering i Brain av XistΔ: Mecp2/Xist: Mecp2-Gfp Mouse modell

  1. Forbered narkotika og kjøretøy kontroll.
    1. Forbered en frisk, steril løsning av kjøretøyet (0,9% NaCl, 0,5% methylcellulose, 4,5% dimethyl sulfoxide [DMSO]) for hjernen injeksjoner.
    2. Forbered kjemiske hemmere inkludert 1,5 mM LDN193189 (liten molekyl hemmer av ACVR1) og 1,6 mM GSK650394 (liten molekyl hemmer av SGK1, en nedstrøms effektor av PDPK1) re-suspendert i bilen (0,9% NaCl, 0,5% methylcellulose, 4,5% DMSO), eller kjøretøy Alene. Det totale volumet av kjemiske hemmere eller kjøretøy injisert er 10 μL per dose per dyr.
  2. Forbered dyr for hjernen injeksjoner.
    1. Klargjør operasjonsområdet ved å tørke av benken og varmeputen med desinfeksjonsmiddel (10% natrium natriumhypokloritt oppløsning).
    2. Bedøve den 4 ukers gamle musen med en intraperitoneal injeksjon av ketamin/xylazine blanding i en dose av 140 mg/kg og 10 mg/kg, henholdsvis. Bruk pedalen tilbaketrekking refleks for å bestemme nivået av anestesi.
    3. Påfør øye salve i øynene etter induksjon av anestesi for å hindre at hornhinnen tørker.
    4. Barbere av pelsen fra nakken til toppen av hodet på musen.
    5. Plasser musen i stereotactic plattformen ved å hekte på musen er helikopteret tenner i bite bar av snute restrainer og stramme nesen klemme over snute samtidig som musen hode er på et nivå plan.
    6. Juster høyden på øret barer, etter behov, for å nå den caudal delen av øre kanalen, sikre dem slik at musen hode er i et nivå plan og immobilisert på finger touch.
    7. Desinfisere hodet på musen med vekslende kluter av en aktuell antiseptisk, som povidon-jod og 70% etanol.
  3. Administrere narkotika.
    1. Ved hjelp av en steril skalpell, lage en 0,75 cm horisontale snitt i midten av hodebunnen.
    2. Ved hjelp av en 0,45 mm Burr, bore to symmetriske hull over høyre og venstre kortikale halvkule (2 mm fra sagittal Sutur og 2 mm fra lambdoid Sutur, omtrent midten av parietal bein).
    3. Fest en 10 μL sprøyte til stereotactic plattformen fast.
    4. Bland oppløsningen av kjemiske hemmere, og trekk 10 μL oppløsning inn i sprøyten. Unngå eventuelle luftbobler i sprøyten.
    5. Før sprøyten nålen inn i Burr hullet opprettholde nålen vinkelrett (90 °) til skallen. Når nålen går gjennom skallen, null ut koordinatene på stereotactic digitale displayet og deretter fremme tuppen av nålen til den når en dybde på 2,5 mm.
    6. Trekk nålen 0,5 mm til dybden for 2 mm.
    7. Injiser langsomt 10 μL oppløsning (~ 1 min). Etter injeksjon er fullført, la nålen i hjernen i ~ 1 min og deretter trekke nålen.
    8. Gjenta injeksjonen for den andre halvkule (kun kjøretøyets kontroll).
    9. Ved hjelp av sting eller "hud lim" lukke huden på musen (hvis såret er > 0,5 cm både sting og "hud lim" bør brukes).
    10. Løsne øre bøy linjene og fjern musen fra stereotactic apparatet.
    11. Administrere smertestillende (SR 0,5 mg/kg IP) og plassere musen på en varmepute satt til 37 ° c til dyret gjenvinner bevisstheten.
    12. En gang musa er flyalarm og forståelsesfull, forflytning dyret rygg å dens original bur.
    13. Gjenta prosedyren hver 2 dager i 20 dager. Gjenta boring av området er ikke nødvendig for påfølgende injeksjoner.
  4. Isolere musen hjernen.
    1. Når dose regime er fullført, euthanize musen i et CO2 kammer.
    2. Nakkens musen på en overflate ved hjelp av nåler.
    3. Lag en lateral snitt gjennom integument og bukveggen like under rib bur med saks og tang. Forsiktig skille leveren fra membranen.
    4. Ved hjelp av saks, kutt membranen og fortsette å skjære langs hele lengden av ribbeinet buret for å avdekke pleural hulrom.
    5. Ved hjelp av saks, gjør et snitt til bakre enden av venstre ventrikkel.
    6. Umiddelbart, begynne å injisere høyre hjertekammer med ~ 15 mL PBS over ~ 2 min. Liver fargeendring fra rødt til svakt rosa er et tegn på god bruk.
    7. Injiser det høyre kammeret i muse hjertet med ~ 10 mL 4% paraformaldehyde i PBS over ~ 2 min.
    8. Halshugge musa, og bruke saks til å lage en midtlinjen snitt av hodebunnen for å avdekke skallen.
    9. Plasser en spiss av saksen i foramen Magnum, og skjær sidelengs inn i skallen mot øyet. Gjenta for den andre siden. Prøv å holde enden av saksen så overfladisk som mulig for å unngå skade på hjernen.
    10. Bruk saks til å klippeområdet mellom øynene og over nesen på musen.
    11. Bruk tang for å forsiktig skrelle skallen bein fra hjernen halvkuler.
    12. Løft hjernen med en slikkepott, og bruk saks til nøye å analysere skallen nervefibrene som fikse det til skallen.
    13. Plasser hjernen på en plast tallerken, Skjær ut lillehjernen og olfactory pærer, og plassere hjernen i en 15 mL rør fylt med 4% PFA er PBS.
  5. Fryse-delen musen hjernen.
    1. Fix hjernen i 4% paraformaldehyde i PBS ved 4 ° c over natten.
    2. Skyll hjernen med PBS ved 4 ° c minst 3x i 5 min hver.
    3. Merk en gangs formene for cryopreserving av vevet.
    4. Skjær ut fronten av hjernen ved hjelp av saks og tang (begynne å lage ~ 5 mm seksjoner fra injeksjonssteder).
    5. Overfør hjernen til cryomold med fronten av hjernen vendt ned for å få koronale seksjoner. Senk formen som inneholder hjernen i den optimale skjæring temperatur sammensatte (OCT).
    6. Hell flytende nitrogen i en 10 mm plastikk Petri parabol og plassere hjernen i fryse-mold i nitrogen.
      Merk: Det er viktig å orientere vevet som beskrevet i trinn 6.5.5 for å veilede snitting av hjernen.
    7. Når OCT er solid hvit, plasserer den frosne hjernen i en-80 ° c fryser for lagring.
    8. Likevekt hjernen til-20 ° c i minst 30 min før snitting med kryostaten og cryosection (5 − 6 μm tykkelse) hjernen, montering 2 − 3 seksjoner per Slide. Lysbilder kan lagres ved-80 ° c for senere bruk.
  6. Bestem XI reaktivering ved hjelp av en immunofluorescence-basert tilnærming.
    1. Før du starter farge prosedyren, tørker du av hjerne delene over natten ved 4 ° c.
    2. Dypp lysbilder i antigen henting løsning (0,1 M sitronsyre, 0,1 M Tris-base, pH = 6,0) på en 100 ° c varme blokk i 5 min.
    3. Vask lysbildene 4X med 1x PBS i 5 minutter hver ved romtemperatur.
    4. Dypp lysbildene i blokkerings løsningen (0,1 M NH4CL/PBS/0.2% gelatin/0,05% ioniske overflateaktivt middel) i 20 min ved romtemperatur.
    5. Vask lysbilder 3x med vaskebuffer (PBS/0.2% gelatin) ved romtemperatur i 5 min hver.
    6. Stain hjerne seksjoner med anti-GFP-AlexaFluor647 (1:100) og anti-MAP2 (1:1000) antistoffer i inkubasjons medium (PBS/0.2% gelatin/1% BSA) og ruge ved 4 ° c over natten.
    7. Samle primære antistoffer (kan gjenbrukes). Vask lysbilder 4X med vaskebuffer for totalt 30 min ved romtemperatur.
    8. Ruge hjerne seksjoner med geit anti-kylling Fluorescein isothiocyanate (FITC)-merket sekundært antistoff (1:1000) i inkubasjons medium og ruge 1 − 2 t ved romtemperatur i mørket.
    9. Vask lysbilder 4X med vaskebuffer for totalt 30 min ved romtemperatur.
    10. Plasser en dråpe montering medium med 4 ', 6-diamidino-2-phenylindole (DAPI) på en 22 mm x 50 mm dekkglass, deretter invertere dekkglass på et lysbilde, som dekker alle vev seksjoner.
    11. Bilde på et mikroskop og justere bilder for kontrast og lysstyrke. Ta bilder og kvantifisere antall GFP-positive celler for både medikament-behandlet og kjøretøy behandlet XistΔ: Mecp2/Xist: Mecp2-GFP mus hjernen halvkuler.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

For å demonstrere muligheten for XistΔ: Mecp2/Xist: Mecp2-Gfp mus modell for XI reaktivering studier, XCIF inhibitor-mediert reaktivering av XI-koblet Mecp2-Gfp ble testet i mus embryonale fibroblaster (MEFs). Kvinnelige MEFs ble isolert fra dag 15,5 XistΔ: Mecp2/Xist: Mecp2-Gfp embryo som beskrevet i avsnitt 3 (figur 1a). Genotyper av kvinnelige XistΔ: Mecp2/Xist: Mecp2-Gfp MEFs ble bekreftet av GENOTYPERINGTEKNOLOGI-PCR, som beskrevet tidligere19 (figur 1B), og FACS-basert analyse (figur 1C). MEFs ble behandlet med enten DMSO eller de to stoffene LDN193189 og GSK650394 (0,5 μM og 2,5 μM, henholdsvis) i 7 dager. Etter behandling av narkotika ble uttrykket av Mecp2-Gfp overvåket av QRT-PCR. Som vist i figur 1d, stoffet behandling, men ikke DMSO, reaktivert uttrykk for XI-Mecp2-Gfp. Deretter ble kvantitativ immunofluorescence utført for å fastslå omfanget av XI-Mecp2-Gfp uttrykk i individuelle MEFs, som beskrevet i trinn 5.3.2. Signal fra negativ-kontroll MEFs isolert fra mannlig embryo (Mecp2/Y) ble satt som bakgrunn, og ~ 66% av positiv kontroll Mecp2-Gfp/Mecp2 MEFS hadde en kjernefysisk Gfp signal. Som forventet, XistΔ: Mecp2/Xist: Mecp2-Gfp MEFs behandlet med DMSO hadde et svært lavt nivå av kjernefysiske Gfp (~ 3%). I motsetning ~ 31% av narkotika-behandlet XistΔ: Mecp2/Xist: Mecp2 MEFs var positive for kjernefysiske GFP (figur 1e). Sammen viser disse resultatene at XCIF-hemmere reaktivere XI-koblede Mecp2 i MEFs, men omfanget av XI reaktivering varierer i cellen befolkningen.

Å vurdere muligheten for farmakologisk XI reaktivering-basert tilnærming in vivo, om behandling reaktiverer XI-koblet Mecp2 i hjernen av XistΔ: Mecp2/Xist: Mecp2-Gfp kvinnelige mus ble undersøkt. 10 μL av kjøretøy eller 10 μL av XCIF-hemmere (1,5 mM LDN193189 og 1,6 mM GSK650394) ble administrert i motsatt hjerne halvkuler av 4-ukers-Old XI-Mecp2-Gfp kvinnelige mus ved intracerebroventrikulært injeksjon ved hjelp av stereotactic kirurgiske prosedyrer ( Figur 2a , B). Prosedyren ble gjentatt annenhver dag (figur 2C), og tre uker senere ble dyrene euthanized, og hjernen ble isolert. Et delsett ble brukt til qRT-PCR, og en annen ble analysert av immunhistokjemi. Uttrykket av vill-type Mecp2 og XI-Mecp2-Gfp i kjøretøyet-og medikament-tilført halvkuler ble bestemt av qRT-PCR (sekvenser av primere oppført i tabell 1). Som vist i figur 2D, narkotikabehandling reaktivert XI-Mecp2-Gfp i ~ 30% av cellene i den medikament-tilført hjernen halvkule, mens XI- Mecp2-Gfp ble ikke oppdaget i bilen-tilført halvkule. Et stort antall MAP2, en neuronal markør, positive neurons var også GFP positive (~ 45%) i den narkotikarelaterte halvkule, antyder XI-Mecp2-Gfp uttrykk. Omtrent 20% av MAP2 negative hjerneceller uttrykte GFP, som bekrefter XI-Mecp2-GFP reaktivering i ikke-neuronal celler (figur 2e).

Figure 1
Figur 1: generering og validering XI-Mecp2 musemodell. (A) skjematisk av avl strategien for å generere XistΔ: Mecp2/Xist: Mecp2-Gfp mus. (B) PCR genotyperingteknologi av Xist: Mecp2-Gfp/Y, XistΔ: Mecp2/Xist: Mecp2 og XistΔ: Mecp2/Xist: Mecp2-Gfp mus. Mus ble overvåket for tilstedeværelsen av Mecp2-Gfp, Mecp2 og sex-fastsettelse region Y (SRY). (C) Flow flowcytometri analyse av kjerner isolert fra musen cortex. Mecp2/Mecp2-Gfp mus cortex show ~ 50% av Gfp-positive kjerner mens XistΔ: Mecp2/Xist: Mecp2-GFP viser ingen Gfp-positive kjerner. (D) QRT-PCR-analyse som overvåker uttrykket av Mecp2-Gfp og ville-type Mecp2 transkripsjoner i kvinnelige XistΔ: Mecp2/Xist: MECP2-Gfp MEFS etter behandling med DMSO eller narkotika (LDN193189 og GSK650394). Gapdh ble overvåket som en laste kontroll. (E) kvantitativ IMMUNOFLUORESCENCE overvåking GFP intensitet i kvinnelige XistΔ: Mecp2/Xist: Mecp2-GFP MEFS etter behandling med DMSO eller narkotika LDN193189 og GSK650394. MEFs isolert fra Mecp2/Y eller Mecp2/Mecp2-Gfp mus ble brukt som negative og positive kontroller, henholdsvis. Hver prikk representerer en MEF, og den stiplede linjen indikerer maksimal bakgrunns signal innhentet i Mecp2/Y, som ble satt til 1. Nedre panel viser representative bilder av kjerner. Dette tallet er blitt modifisert fra Przanowski et al.16. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: farmakologisk reaktivering av X-knyttet Mecp2 i cerebral kortikale neurons av levende mus. (A) skjematisk av en mus skallen og (B) hjernen viser injeksjonsstedet for kjøretøy eller narkotika i venstre eller høyre halvkuler av hjernen. (C) skjematisk av narkotika regimet. (D) representative immunofluorescence bilder som viser endogene GFP-signalet (grønn) i koronale hjerne seksjoner fra kjøretøy-eller medikament behandlede halvkuler. DAPI farging er vist i blått. (E) representative immunofluorescence bilder av koronale hjerne seksjoner som overvåker UTTRYKKET av GFP (anti-GFP; rød) og MAP2 (grønn) i medikament behandlet halvkule. DAPI farging er vist i blått. Dette tallet er blitt modifisert fra Przanowski et al.16. Vennligst klikk her for å se en større versjon av dette tallet.

Omvendt primer (5 '-> 3 ') Anealing temperatur/PCR produkt lengde
GGCATGGACTGTGGTCATGAG 60 ° c/87 BP
GCTGAACTTGTGGCCGTTTA 62 ° c/137 BP
TGTCAGAGCCCTACCCATAAG 62 ° c/140 BP
GCACAACCCCGCAAATGCTA 62 ° c/364 BP
GCACAACCCCGCAAATGCTA 62 ° c/250 BP
AATTGCCCTAACGAGCACAC 62 ° c/436 BP
GAACTTCAGGGTCAGCTTGC 62 ° c/217 BP
CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 BP

Tabell 1: liste over primere som brukes til genotyperingteknologi og kvantitativ sann tids RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tidligere identifiserte XCIFs som er selektivt nødvendige for å stanse av XI-koblede gener i pattedyr kvinnelige celler,12. Vi videre optimalisert potente små molekyl hemmere å målrette XCIFs, slik som ACVR1 og nedstrøms effekt Orer av PDPK1, som effektivt reaktivere XI-koblet Mecp2 i mus Fibroblast cellelinjer, mus kortikale neurons, og en menneskelig Fibroblast celle linje avledet fra en RTT-pasient. Disse resultatene tyder på at XI reaktivering er en sannsynlig terapeutisk tilnærming for å redde genet mangler i X-tilknyttede sykdom pasienter; Men in vivo-gjennomførbarhet gjenstår å fastslå. Nylig ble XCIF-hemmere vist å reaktivere XI-koblede Mecp2 in vivo, som en ikke-tilfeldig XistΔ: Mecp2/Xist: Mecp2-Gfp musemodell ble generert.

En attraktiv funksjon i XistΔ: Mecp2/Xist: Mecp2-Gfp modellen er at den tillater en nøyaktig kvantifisering av XI-knyttet Mecp2 reaktivering av flere grunner. Først, på grunn av sletting av Xist på mors X-kromosom, den XistΔ: Mecp2/Xist: Mecp2-Gfp MUSEN har ikke tilfeldig XCI. Som et resultat, genetisk merket Mecp2 er taus i 100% av cellene (figur 1C), i motsetning til en forventet 50:50 uttrykk for X-koblede gener i tilfeldige XCI mus modeller, for eksempel Xist: Mecp2/Xist: Mecp2-Gfp. Derfor er resultatene ikke utelukket av mosaikk uttrykk for GFP, og 100% celler bære Mecp2-GFPXI i XistΔ: Mecp2/Xist: Mecp2-GFP modell. For det andre, den genetiske merkingen av Mecp2 tillater direkte visualisering av individuelle neurons med reaktivert GFP, og dermed minimere eksperimentelle manipulasjoner i neuronal analyse.

En fersk studie fant at intracerebroventrikulært injeksjon av XCIF-hemmere i musen hjernen halvkule reaktiverer XI-koblet Mecp2 bruker immunofluorescence analyse av musen hjernen16. Viktigere, narkotikabehandling hadde ingen negativ effekt på den generelle helsen, slik som vekt, grooming, eller mobilitet16. Videre er det ingen toksisitet oppdages ved behandling i lever eller milt. Sammen gir denne studien en viktig proof-of-prinsippet å demonstrere at forstyrrer funksjonen av XCIFs fører til de-undertrykking av XI in vivo.

Oppsummert kan en følsom musemodell brukes til å evaluere reaktivering av XI. Dette dyret modell design kan også tilpasses for å generere en forbedret RTT mus modell som havner Mecp2 mutasjoner (sannsynligvis mindre symptomatisk) på den aktive X-kromosom og vill-type Mecp2 på XI i alle celler. På grunn av ikke-tilfeldige XCI, mens fenotypiske symptomer kan være mer uttalt, er det forventet at denne modellen vil også gi mulighet for bedre evaluering og nøyaktig vurdering av reversering av symptomer på grunn av XI reaktivering. I tillegg kan XistΔ: Mecp2/Xist: Mecp2-Gfp også endres til å studere XI reaktivering i andre X-tilknyttede sykdoms modeller, for eksempel DDX3X syndrom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Forfatterne takker Antonio Bedalov for å gi reagenser; University of Virginia tissue histologi kjerne for kryosnitt; University of Virginia Flow flowcytometri Core for Flow flowcytometri analyse; Christian Blue og saloni Singh for teknisk assistanse med genotyperingteknologi. Dette arbeidet ble støttet av en Double hoo Research Grant til Z.Z., og en pilot Project program Award fra University of Virginia-Virginia Tech Seed Fund Award og Hartwell Foundation Individual Biomedical Research Award til S.B.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics