En ikke-tilfældig muse model for farmakologisk reaktivering af Mecp2 på inaktiv X-kromosom

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi en protokol til at generere en levedygtig kvindelig murine model med ikke-tilfældige X kromosom inaktivering, dvs., det maternally-nedarvede X-kromosom er inaktiv i 100% af cellerne. Vi beskriver også en protokol til afprøvning af gennemførlighed, tolerabilitet og sikkerhed ved farmakologisk reaktivering af det inaktive X-kromosom in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X kromosom inaktivering (XCI) er den tilfældige hæmning af et X kromosom hos kvinder for at opnå gendose ring balance mellem kønnene. Som et resultat, alle kvinder er heterozygot for X-linked genekspression. En af de vigtigste regulatorer af XCI er Xist, som er afgørende for initiering og vedligeholdelse af XCI. Tidligere undersøgelser har identificeret 13 Trans Acting X kromosom inaktiverings faktorer (Xcif'er) ved hjælp af en storstilet, tab-af-funktion genetisk skærm. Hæmning af Xcif'er, såsom ACVR1 og PDPK1, ved hjælp af kort Hårnåle RNA eller små molekyler hæmmere, genaktiverer X kromosom-sammenkædede gener i dyrkede celler. Men gennemførligheden og tolerabiliteten af reaktivering af det inaktive X-kromosom in vivo er endnu ikke fastlagt. Mod dette mål, en Xistδ: Mecp2/Xist: Mecp2-Gfp musemodel er blevet genereret med ikke-tilfældige XCI på grund af sletning af Xist på en X kromosom. Ved hjælp af denne model var omfanget af inaktiv X-reaktivering kvantiteret i muse hjernen efter behandling med XCIF-hæmmere. Nyligt offentliggjorte resultater viser for første gang, at farmakologisk hæmning af XCIFs genaktiverer Mecp2 fra det inaktive X-kromosom i kortikale neuroner i den levende musehjerne.

Introduction

X kromosom inaktivering (XCI) er en proces af dosering kompensation, der balancerer X-linked genekspression ved at genhæmning en kopi af X-kromosomet hos kvinder1. Som følge heraf akkumulerer det inaktive X-kromosom (XI) karakteristiske træk ved heterokromatin, herunder DNA-methylering og hæmmende histonmodifikationer, såsom Histon H3-lysin 27 trimethylering (H3K27me3) og Histon H2A ubiquitination (H2Aub) 2. den overordnede regulator af x-kromosom hæmning er x-inaktiverings Center (xic)-regionen, ca. 100 − 500 kb, som styrer optællingen og parringen af x-kromosomerne, det tilfældige valg af x-kromosom til inaktivering og initiering og spredning af genhæmning langs X-kromosomet3. Processen med X inaktivering initieres af X inaktiv specifik afskrift (Xist), der frakker XI i CIS til at mægle kromosom-dækkende lyddæmpnings-og omforme den tredimensionale struktur af x-kromosom4. For nylig har flere protemiske og genetiske skærme identificeret yderligere regulatorer af XCI, såsom xist interagerende proteiner5,6,7,8,9 , 10 stk. , 11 af , 12. for eksempel, en tidligere undersøgelse ved hjælp af en upartisk genom-dækkende RNA interferens skærm identificeret 13 Trans-virkende XCI faktorer (xcifs)12. Mekanisk, XCIFs regulerer Xist udtryk og derfor interfererer med xcifs funktion forårsager defekt XCI12. Sammen har de seneste fremskridt på området givet vigtig indsigt i de molekylære maskiner, der er nødvendige for at initiere og vedligeholde XCI.

Identifikation af XCI regulatorer og forståelse af deres mekanisme i XCI er direkte relevant for X-linked humane sygdomme, såsom RETT syndrom (RTT)13,14. RTT er en sjælden Neuro udviklende lidelse forårsaget af en heterozygot mutation i det X-linkede methyl-CpG-bindingsprotein 2 (MECP2), der påvirker overvejende piger15. Da MECP2 er placeret på X-kromosomet, er RTT-pigerne heterozygot for MECP2 mangel med ~ 50% celler, der udtrykker vildtype og ~ 50% udtrykker mutant MECP2. Især RTT mutant celler havn en sovende, men vild-type kopi af Mecp2 på XI, der giver en kilde til det funktionelle gen, som hvis reaktiveret, kunne potentielt lindre symptomer på sygdommen. Ud over RTT, der er flere andre X-linked menneskelige sygdomme, for hvilke reaktivering af XI repræsenterer en potentiel terapeutisk tilgang, såsom DDX3X syndrom.

Hæmning af XCIFs, 3-phosphoinositide afhængige protein kinase-1 (PDPK1) og Activity A receptor type 1 (ACVR1), enten ved kort hårnål RNA (shRNA) eller små Molekylær hæmmere, genaktiverer XI-sammenkædede gener12. Farmakologisk reaktivering af XI-linkede gener observeres i forskellige ex vivo modeller, der omfatter muse fibroblast cellelinjer, voksne mus kortikale neuroner, mus embryonale fibroblaster, og fibroblast cellelinjer afledt af en RTT patient12. Det er dog endnu ikke påvist, om farmakologisk reaktivering af XI-linkede gener er gennemførlig in vivo. En begrænsende faktor er manglen på effektive dyremodeller til nøjagtigt at måle ekspressionen af gener fra genaktiveret XI. Mod dette mål, en Xistδ: Mecp2/Xist: Mecp2-Gfp musemodel er blevet genereret, der bærer en genetisk mærket Mecp2 på XI i alle cellerne på grund af heterozygot sletning i Xist på maternel X kromosom16. Ved hjælp af denne model, er udtrykket af Mecp2 fra XI blevet kvantiteret efter behandling med XCIFs hæmmere i hjernen af levende mus. Her er den generation af xistδ: Mecp2/xist: Mecp2-gfp musemodel og metodologi til kvantitat XI reaktivering i kortikale neuroner ved hjælp af immunofluorescens-baserede analyser beskrevet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Arbejde, der involverer mus, blev godkendt af University of Virginia institutions Komité for dyrepasning og-brug (IACUC; #4112).

1. Generer en ikke-tilfældig XCI Mouse model med genetisk mærket Mecp2 på XI

Bemærk: De muse stammer, der blev anvendt i undersøgelsen, var følgende: Mecp2-gfp/Mecp2-gfp (Mecp2TM 3.1 fugl, materiale oversigt) og xist/δxist (B6; 129-xist < tm5Sado >; leveret af Antonio bedalov, fred Hutchinson Cancer Center, Seattle). Avlsstrategier blandt de respektive stammer er designet til at udvide musens kolonier for hver stamme.

  1. Udfør PCR-genotyping på alle mus stammer og respektive afkom fremstillet efter avl ved hjælp af gen-specifikke primere opført i tabel 1.

2. design musens avls strategi til at generere Xistδ: Mecp2/Xist: Mecp2-Gfp

  1. Oprette et avls par ved at huse en Mecp2-Gfp/Y mand og en XistΔ-Mecp2/Xist-Mecp2 kvinde sammen (12 h/12 h: lys/mørk cyklus) (figur 1a). Ideelt set skal du oprette mindst 5 avls par ad gangen ved hjælp af levedygtige og frugtbare mus. Efter den gravide kvinde føder, tillade hende at hæve hendes første kuld med den mandlige.
    Bemærk: Fordi forældre xist knockout hæmmer påtrykt XCI, dosering kompensation, og differentiering veje17, brug af xistδ-Mecp2/Y mus i avl vil undlade at producere de kvindelige unger med krævede genotype.
  2. Efter fravænning af Strøelsen på postnatal dag 21 (P21) identificeres og tagger Xistδ: Mecp2/Xist: Mecp2-Gfp hununger ved hjælp af en PCR-baseret genotypebestemmelse (figur 1b).
    Bemærk: Med hensyn til antallet af dyr, der er behov for pr. gruppe, blev der for de nedenfor anførte resultater oprettet 5 avls par, som genererede ca. 10 kvindelige Xistδ: Mecp2/Xist: Mecp2-Gfp- mus.
  3. Brug kvindelige musemodeller til alle de foreslåede eksperimenter.
    Bemærk: Sex er en vigtig biologisk variabel for XCI-studier, og den mandlige model tager ikke højde for de forstyrrende virkninger af tilfældige XCI.
  4. At være konsekvent i hele dyreforsøg og udelukke eventuelle virkninger af dyrets alder, udføre alle eksperimenter i 5 − 8-ugers-gamle kvindelige Xistδ: Mecp2/Xist: Mecp2-Gfp mus.

3. Isoler kvindelige Xistδ: Mecp2/Xist: Mecp2-Gfp- embryonale fibroblaster (mefs)

  1. Indstil Tidsindstillet Parring mellem Mecp2-Gfp/Y mand og Xistδ-Mecp2/Xist-Mecp2 kvinde. Indstil mindst 3 − 4 parring bure for at øge sandsynligheden for graviditet.
  2. Efter at have bekræftet vaginal prop om morgenen efter parring, skal du adskille den kvindelige og denne dag anses embryonale dag 0,5 (E 0,5). Overvåg vægtøgning af den potentielle gravide kvinde og visuelt inspicere maven på mus for at bekræfte graviditet. På e 14.5 − 15.5, aflive de gravide hunmus via cervikal dislokation.
  3. Under en laminar hætte, tørre maven af den gravide kvinde med 70% ethanol. Ved hjælp af steril saks, dissekere bughulen og fjerne livmoder horn, der indeholder embryonerne. Brug pincet til forsigtigt at tage embryonerne ud, mens de resterende abdominalvæv skæres af (6 − 12 embryoner forventes normalt).
  4. De livmoder horn, der indeholder embryonerne, anbringes i en 10 mm vævskultur skål. Brug steril saks og pincet til at lave et snit langs livmoder hornene for at isolere individuelle sække, der bærer et foster. Læg forsigtigt livmoder hornene, der indeholder resten af embryonerne, i 30 mL steril Hanks-afbalanceret saltopløsning (HBSS) på is.
  5. Skær forsigtigt i sækken og Isoler fosteret ved hjælp af steril saks og pincet. Fjern placenta ved at klippe navlestrengen.
  6. Dekapiterer embryonet.
    Bemærk: Mens resten af embryonale væv vil blive behandlet yderligere, vil vævet fra embryo hovedet blive brugt til at isolere DNA til genotypebestemmelse.
  7. Åbn maven ved at skære midterlinjen af embryonet ved hjælp af steril saks og pincet. Fjern de visceral organer, såsom hjerte, lever, og lunger.
  8. Det resterende embryonale væv overføres til en steril 60 mm vævskultur plade og skæres i små stykker ved hjælp af en saks eller et barberblad. For at bryde åbne celle klumper tilsættes 3 mL trypsin-EDTA (0,05%) og inkuere ved 37 °C i 15 min.
  9. Neutraliserer trypsin-EDTA ved at tilsætte 5 mL af Dulbeccos modificerede Eagle medium (DMEM) med 10% føtalt kvægserum (FBS) og 10 μg/mL penicillin/streptomycin (pen/STREP) til pladen og dissociere vævet ved gentagen pipettering (ca. 20 − 30 gange).
  10. Spin ned celler på 300 x g i 5 min og re-suspendere celle pellet i 4 ml DMEM med 10% FBS og 10 μg/ml pen/STREP. Plade cellerne på en 60 mm kultur skål, og kultur cellerne ved 37 °C i nærværelse af 5% CO2.
  11. Udfør trin 3.5 − 3.10 for hvert embryo.
  12. Kultur-Mef'er opnået i trin 3,11 i mindst 3 − 4 dage.
    Bemærk: På nuværende tidspunkt kan Mef'er også kryopreserveres til fremtidige eksperimenter.
  13. Til bestemmelse af hvert embryon køn og genotype udføres genotyping-PCR ved hjælp af DNA isoleret fra lederne af embryonerne ved hjælp af primere og PCR-betingelser, der er anført i tabel 1.

4. Bekræft manglen på grønt fluorescerende protein (GFP) i hjernen hos Xistδ: Mecp2/Xist: Mecp2-gfp mus ved hjælp af en Ffluorescens aktiveret celle sorterings baseret assay

  1. Brug en saks til at adskille hjernebarken fra resten af hjerne halvkugler, og Placer i 1 mL iskold nuklei-isolations medie (NIM) buffer indeholdende 250 mM saccharose, 25 mM kaliumchlorid (KCl), 5 mM magnesiumchlorid (MgCl2), 10 mm Tris-CL, suppleret med 2% PARAFORMALDEHYD (PFA) og 0,1% nonionisk overfladeaktivt stof (tabel over materialer).
  2. Homogenisering ved hjælp af en iskold glas homogenisator.
  3. Spinner homogeniseret væv ved 600 x g, 4 °c i 5 min.
  4. Supernatanten fjernes, og pillen resuspenderes i 1 mL af 25% iodixanol i NIM-opløsning.
  5. Der tilsættes 1 mL af 29% lodixanol i NIM-opløsning til et 4 mL ultracentrifuge rør (opbevares på is, indtil prøverne er klar) og lag forsigtigt 1 mL prøve (i 25% lodixanol).
  6. Der centrifugeres ved 9.000 x g, 4 °c i 10 min i en ultracentrifuge.
  7. Aspirerende supernatanten og resuspension af pellet i 500 μL af fluorescens aktiveret celle sortering (FACS) buffer (fosfat-Buffered saltvand [PBS] suppleret med 1 mM EDTA, 0,05% natriumazid og 2% bovint serumalbumin [BSA]).
    Bemærk: Prøverne kan opbevares ved 4 °C eller op til 1 uge.
  8. Der tilsættes 5 μL 7-amino-actinomycin D (7-AAD; 50 mg/mL) i 5 minutter ved stuetemperatur til pletdna.
  9. Analysér prøverne til 7-AAD og grønt fluorescerende protein (GFP)-signal ved hjælp af flow cytometri.

5. Bestem gennemførlighed af Xistδ: Mecp2/Xist: Mecp2-Gfp muse model for XI reaktivering

  1. Frø 1 x 105 celler/ml kvindelig Xistδ: Mecp2/XST: Mecp2-gfp Mefs, Mecp2/Mecp2-Gfp og xist-Mecp2/Y mefs opnået i trin 3,12 i et 6-brønd format og i kammer glas, i DMEM med 10% FBS og 10 μg/ml pen/STREP, ved 37 °c i tilstedeværelse af 5% CO2.
    Bemærk: Mecp2/Mecp2-Gfp og Xist-Mecp2/Y -mef'er anvendes som positive og negative kontroller i forsøgene.
  2. Tilsæt frisk medium til cellerne efter 24 timer. For Xistδ: Mecp2/Xist: Mecp2-Gfp mefs, tilsæt medium suppleret med XCIFs-hæmmere (f. eks. 0,5 μm LDN193189 og 2,5 μm GSK650394) eller køretøj alene. Udskift medium suppleret med frisk hæmmer eller køretøj alene hver 2 dage. For Mecp2/Mecp2-Gfp og Xist-Mecp2/Y mef'er tilsættes frisk medium hver 2.
  3. Post 1 uge af inhibitor behandling, høst Mef'er enten for RNA isolation (6-brønd plade) eller reparere celler til immunofluorescens (kammer slides). Brug Mef'er isoleret fra Mecp2/Mecp2-Gfp- embryoner som positive og Xist-Mecp2/Y -embryoner som negative kontroller.
    1. For RNA-isolation isoleres det totale RNA ved brug af guanidinium thiocyanat-baseret RNA-ekstraktions reagens og revers Transkribering ved hjælp af omvendt transkriptase. Mål Mecp2-Gfp -udtryk ved kvantitativ reverse transkriptase-PCR (QRT-PCR) ved hjælp af Mecp2-WT og Mecp2-gfp, og primere opført i tabel 1, som beskrevet tidligere12.
    2. For immunofluorescens, pletter mefs med et anti-gfp primær antistof (1:100), som beskrevet tidligere12,16. Måle GFP intensitet ved kvantitativ immunofluorescens i stof behandlet Xistδ: Mecp2/Xist: Mecp2-gfp mefs, som beskrevet tidligere18.

6. demonstrere den farmakologiske XI reaktivering i hjernen af Xistδ: Mecp2/Xist: Mecp2-Gfp muse model

  1. Forbered stoffer og kontrol af køretøjet.
    1. Forbered en frisk, steril opløsning af køretøjet (0,9% NaCl, 0,5% methylcellulose, 4,5% dimethylsulfoxid [DMSO]) til hjerne injektioner.
    2. Forbered kemiske hæmmere, herunder 1,5 mM LDN193189 (lille molekyle hæmmer af ACVR1) og 1,6 mM GSK650394 (lille molekyle hæmmer af SGK1, en downstream effektor af PDPK1) re-suspenderet i køretøjet (0,9% NaCl, 0,5% methylcellulose, 4,5% DMSO), eller køretøj Alene. Den totale mængde af kemiske hæmmere eller det injicerede køretøj er 10 μL pr. dosis pr. dyr.
  2. Forbered dyr til hjerne injektioner.
    1. Forbered operationsområdet ved at aftørre bænken og varmepuden med desinfektionsmiddel (10% natriumhypochlorit-opløsning).
    2. Anæstetize den 4 uger gamle mus med en intraperitoneal injektion af ketamin/xylazin blanding i en dosis på 140 mg/kg og 10 mg/kg, hhv. Brug pedal abstinens refleks til at bestemme niveauet af anæstesi.
    3. Påfør oftalmisk salve til øjnene efter induktion af anæstesi for at forhindre hornhinde tørring.
    4. Barbere pels fra halsen til toppen af hovedet af musen.
    5. Anbring musen i den stereo forebyggende platform ved at tilslutte musens frembrudt tænder i bide stangen i snude og stramme næseklemmen over snuden og samtidig sikre, at musens hoved er på et niveau plan.
    6. Juster højden af ørestænger, efter behov, for at nå den hale del af øregangen, sikre dem sådan, at musens hoved er i et niveau plan og immobiliseret på fingerberøring.
    7. Desinficer hovedet af musen med vekslende klude af en aktuel antiseptisk, såsom povidon-jod og 70% ethanol.
  3. Giv lægemidler.
    1. Brug en steril skalpel, lav en 0,75 cm horisontal indsnit i midten af hovedbunden.
    2. Brug en 0,45 mm Burr, bor to symmetriske huller over højre og venstre kortikale halvkugler (2 mm fra sagittale sutur og 2 mm fra lambdoidesutur, ca. midten af parietale knogle).
    3. Fastgør en 10 μL sprøjte til den stereo forebyggende platform fast.
    4. Bland opløsningen af kemiske hæmmere, og træk 10 μL opløsning ind i sprøjten. Undgå luftbobler i sprøjten.
    5. Før sprøjtenålen ind i Burr hullet og opretholde nålen vinkelret (90 °) på kraniet. Når nålen krydser kraniet, skal du nulstille koordinaterne på det stereo aktiske digitale display og derefter rykke spidsen af nålen frem, indtil den når en dybde på 2,5 mm.
    6. Træk nålen 0,5 mm til dybden i 2 mm.
    7. Injicer langsomt 10 μL opløsning (~ 1 min.). Efter injektion er færdig, lad nålen i hjernen for ~ 1 min og derefter trække nålen.
    8. Gentag injektionen for den anden halvkugle (kun køretøjets kontrol).
    9. Ved hjælp af suturer eller "hud lim" lukke huden af musen (hvis såret er > 0,5 cm både suturer og "hud lim" bør anvendes).
    10. Løsn øretelefonerne, og fjern musen fra det stereo aktiske apparat.
    11. Giv analgetika (buprenorphin SR 0,5 mg/kg IP) og Anbring musen på en varmepude indstillet til 37 °C, indtil dyret genvinder bevidstheden.
    12. Når musen er vågen og lydhør, overføre dyret tilbage til sit oprindelige bur.
    13. Gentag proceduren hver 2 dage i 20 dage. Gentagen boring af området er ikke nødvendig ved efterfølgende injektioner.
  4. Isoler musens hjerne.
    1. Når dosisregimet er afsluttet, aflive musen i en co2 kammer.
    2. Immobiliserer musen på en overflade ved hjælp af nåle.
    3. Lav en lateral indsnit gennem integument og bugvæggen lige under brystkassen ved hjælp af saks og pincet. Omhyggeligt adskille leveren fra diafragma.
    4. Brug en saks, skær mellemgulvet og Fortsæt med at skære langs hele længden af brystkassen for at eksponere pleural hulrummet.
    5. Brug en saks til at lave et snit til den bageste ende af venstre ventrikel.
    6. Straks, begynde at injicere det rigtige hjertekammer med ~ 15 mL PBS over ~ 2 min. lever farveændring fra rød til lyserød er tegn på god perfusion.
    7. Indsprøjt det højre kammer af musens hjerte med ~ 10 mL 4% PARAFORMALDEHYD i PBS over ~ 2 min.
    8. Halsbrand musen, og bruge saks til at gøre en midterlinje indsnit af hovedbunden til at eksponere kraniet.
    9. Anbring en spids af saksen i foramen magnum, og skær sidelæns i kraniet mod øjet. Gentag for den anden side. Prøv at holde enden af saksen så overfladisk som muligt for at undgå skader på hjernen.
    10. Brug en saks til at klippeområdet mellem øjnene og over musens næse.
    11. Brug pincet til forsigtigt at skrælle kranielle knogler fra hjernen halvkugler.
    12. Løft hjernen med en spatel, og brug en saks til omhyggeligt at dissekere de kraniale nervefibre, der fastgør den til kraniet.
    13. Placer hjernen på en plastik skål, skær cerebellum og olfaktoriske pærer, og placere hjernen i en 15 ml tube fyldt med 4% PFA er PBS.
  5. Cryo-sektion musen hjernen.
    1. Fastgør hjernen i 4% PARAFORMALDEHYD i PBS ved 4 °C natten over.
    2. Skyl hjernen med PBS ved 4 °C mindst 3x i 5 min hver.
    3. Mærk de engangs forme til Kryopreservation af vævet.
    4. Skær forsiden af hjernen ved hjælp af saks og pincet (begynde at gøre ~ 5 mm sektioner fra injektionssteder).
    5. Overføre hjernen til kryomold med forsiden af hjernen vender nedad for at opnå koronale sektioner. Sænk formen indeholdende hjernen i den optimale skæring temperatur sammensatte (OCT).
    6. Hæld flydende kvælstof i en 10 mm plastik petriskål og Anbring hjernen i kryo-formen i nitrogen.
      Bemærk: Det er vigtigt at orientere vævet som beskrevet i trin 6.5.5 til at guide sektionering af hjernen.
    7. Når OCT er solid hvid, anbringes den frosne hjerne i en-80 °C fryser til opbevaring.
    8. Hjernen skal ækvilibreres til-20 °C i mindst 30 minutter før skæring med kryostat og kryosektion (5 − 6 μm tykkelse) af hjernen, montering af 2 − 3 sektioner pr. slide. Slides kan opbevares ved-80 °C til senere brug.
  6. Bestemmelse af XI-reaktivering ved hjælp af en immunofluorescens-baseret tilgang.
    1. Før du påbegynder farvnings proceduren, skal du tørre hjerne sektionerne natten over ved 4 °C.
    2. Fordyb lysbilleder i antigen genfindings opløsning (0,1 M citronsyre, 0,1 M Tris-base, pH = 6,0) på en 100 °C varmeblok i 5 min.
    3. Vask dias 4X med 1x PBS i 5 min hver ved stuetemperatur.
    4. Fordyb lysbilleder i blokerende opløsning (0,1 M NH4CL/PBS/0,2% gelatine/0,05% nonionisk overfladeaktivt stof) i 20 minutter ved stuetemperatur.
    5. Vask dias 3x med vaskebuffer (PBS/0,2% gelatine) ved stuetemperatur i 5 min hver.
    6. Plettede hjerne sektioner med anti-GFP-AlexaFluor647 (1:100) og anti-MAP2 (1:1000) antistoffer i inkubations medium (PBS/0,2% gelatine/1% BSA) og inkubere ved 4 °C om natten.
    7. Saml primære antistoffer (kan genbruges). Vask dias 4X med vaskebuffer i alt 30 minutter ved stuetemperatur.
    8. Inkubation af hjerne sektioner med gede anti-kylling fluorescein isothiocyanat (FITC)-mærket sekundært antistof (1:1000) i inkubations medium og inkube 1 − 2 h ved stuetemperatur i mørke.
    9. Vask dias 4X med vaskebuffer i alt 30 minutter ved stuetemperatur.
    10. Placer en dråbe af monterings medium med 4 ′, 6-diamidino-2-phenylindol (dapi) på en 22 mm x 50 mm dækglas, derefter invertere dækglas på en slide, der dækker alle væv sektioner.
    11. Billede på et mikroskop og justere billeder til kontrast og lysstyrke. Tage billeder og kvantificere antallet af GFP-positive celler for både stof-behandlet og køretøj behandlet Xistδ: Mecp2/Xist: Mecp2-gfp musehjerne halvkugler.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

For at påvise gennemførligheden af Xistδ: Mecp2/Xist: Mecp2-Gfp -musemodel for XI-reaktiverings undersøgelser, blev xcif-inhibitor-medieret reaktivering af XI-linked Mecp2-gfp testet i Foster embryonale fibroblaster (mefs). Kvindelige Mef'er blev isoleret fra dag 15,5 Xistδ: Mecp2/Xist: Mecp2-Gfp- embryoner som beskrevet i punkt 3 (figur 1a). De genotyper af kvindelige Xistδ: Mecp2/Xist: Mecp2-Gfp mefs blev bekræftet ved genotyping-PCR, som beskrevet tidligere19 (figur 1b), og FACS-baserede assay (figur 1c). MEFs blev behandlet med enten DMSO eller de to lægemidler LDN193189 og GSK650394 (henholdsvis 0,5 μM og 2,5 μM) i 7 dage. Efter lægemiddelbehandling blev ekspression af Mecp2-Gfp overvåget af QRT-PCR. Som vist i figur 1d, lægemidlet behandling, men ikke DMSO, reaktiveret udtryk for XI-Mecp2-gfp. Dernæst blev der udført kvantitativ immunofluorescens for at bestemme omfanget af XI-Mecp2-Gfp- ekspression i de enkelte mef'er, som beskrevet i trin 5.3.2. Signal fra negative-Control Mef'er isoleret fra mandlige embryoner (Mecp2/Y) blev sat som baggrund, og ~ 66% af positive kontrol Mecp2-Gfp/Mecp2 mefs havde et nukleart gfp-signal. Som forventet, Xistδ: Mecp2/Xist: Mecp2-gfp mefs behandlet med DMSO havde et meget lavt niveau af nuklear gfp (~ 3%). I modsætning hertil var ~ 31% af de stof behandlede Xistδ: Mecp2/Xist: Mecp2 mefs var positive for nuklear gfp (figur 1E). Tilsammen viser disse resultater, at XCIF-hæmmere genaktiverer XI-linked Mecp2 i mef'er, men omfanget af XI reaktivering varierer i celle populationen.

At vurdere gennemførligheden af farmakologisk XI reaktiverings baseret metode in vivo, hvorvidt lægemiddelbehandling genaktiverer XI-linked Mecp2 i hjernen hos Xistδ: Mecp2/Xist: Mecp2-gfp hunmus blev undersøgt. 10 μL af køretøjet eller 10 μL XCIF-hæmmere (1,5 mM LDN193189 og 1,6 mM GSK650394) blev administreret i modsatrettede hjernehalvdele af 4-ugers-gamle XI-Mecp2-Gfp hunmus ved intracerebroventrikulær injektion ved hjælp af stereo forebyggende kirurgiske indgreb ( Figur 2a , B). Proceduren blev gentaget hver anden dag (figur 2c), og tre uger senere, dyr blev euthanized, og hjerner blev isoleret. En delmængde blev anvendt til qRT-PCR, og en anden blev analyseret af immunohistochemistry. Ekspressionen af vildtype- Mecp2 og XI-Mecp2-gfp i køretøjets-og narkotika-inkusserne blev bestemt af QRT-PCR (sekvenser af primere, der er opført i tabel 1). Som vist i figur 2Dblev stofbehandling reaktiveret XI-Mecp2-gfp i ~ 30% af cellerne i den stof baserede hjerne halvkugle, hvorimod XI- Mecp2-gfp ikke blev påvist i en halvkugle med køretøjer. Et stort antal MAP2, en neuronal markør, positive neuroner var også GFP positiv (~ 45%) på den narkotika behandlede halvkugle, hvilket indikerer XI-Mecp2-Gfp- udtryk. Ca. 20% af MAP2 negative hjerneceller udtrykte GFP og bekræftede XI-Mecp2-gfp reaktivering i ikke-neuronale celler (figur 2E).

Figure 1
Figur 1: generering og validering XI-Mecp2 musemodel. A) skematisk over avls strategien for generering af Xistδ: Mecp2/Xist: Mecp2-gfp- mus. B) PCR genotypebestemmelse af Xist: Mecp2-Gfp/Y, xistδ: Mecp2/XST: Mecp2 og Xistδ: Mecp2/xist: Mecp2-gfp -mus. Mus blev overvåget for tilstedeværelsen af Mecp2-Gfp, Mecp2 og sex-bestemmelse region Y (Sry). (C) flow cytometri analyse af kerner isoleret fra muse cortex. Mecp2/Mecp2-gfp muse cortex show ~ 50% af gfp-positive kerner mens Xistδ: Mecp2/Xist: Mecp2-gfp viser ingen gfp-positive kerner. (D) QRT-PCR-analyse, der overvåger forekomsten af Mecp2-gfp og Wild-type Mecp2 udskrifter i kvindelige Xistδ: Mecp2/xist: Mecp2-GFP mefs efter behandling med DMSO eller lægemiddel (LDN193189 og GSK650394). Gapdh blev overvåget som læsse kontrol. E) kvantitativ immunofluorescens monitorering af gfp-intensitet hos kvinder i Xistδ: Mecp2/Xist: Mecp2-gfp- mefs efter behandling med DMSO eller narkotika LDN193189 og GSK650394. Mef'er isoleret fra Mecp2/Y eller Mecp2/Mecp2-gfp- mus blev anvendt som henholdsvis negative og positive kontroller. Hver prik repræsenterer en MEF, og den stiplede linje angiver det maksimale baggrunds signal, der er opnået i Mecp2/Y, som blev indstillet til 1. Nederste panel viser repræsentative billeder af kerner. Dette tal er blevet ændret fra Przanowski et al.16. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: farmakologisk reaktivering af X-linked Mecp2 i cerebral kortikale neuroner af levende mus. (A) skematisk af en mus kraniet og (b) hjernen viser injektionsstedet for køretøj eller stof i venstre eller højre halvkugle i hjernen. (C) skematisk af lægemidlet regime. (D) repræsentative immunofluorescens billeder, der viser ENDOGENE gfp-signal (grøn) i koronale hjerne sektioner fra køretøjs-eller narkotika behandlede halvkugler. DAPI-farvning vises med blåt. E) repræsentative immunofluorescens billeder af de koronale hjerne sektioner, der overvåger ekspressionen af gfp (anti-gfp, Red) og MAP2 (grøn) i den narkotika behandlede halvkugle. DAPI-farvning vises med blåt. Dette tal er blevet ændret fra Przanowski et al.16. Klik her for at se en større version af dette tal.

Omvendt primer (5 '-> 3 ') Anealing temperatur/PCR produkt længde
Fra Aalborg, Arhus, fordi du indsendte en 60 °C/87 BP
GCTGAACTTGTGGCCGTTTA 62 °C/137 BP
TGTCAGAGCCCTACCCATAAG 62 °C/140 BP
GCACAACCCCGCAAATGCTA 62 °C/364 BP
GCACAACCCCGCAAATGCTA 62 °C/250 BP
AATTGMEN 62 °C/436 BP
GAACTTCAGGGTCAGCTTGC 62 °C/217 BP
Har du ikke et særligt SYNS middel? 66 °C/270 BP

Tabel 1: liste over primere, der anvendes til genotypebestemmelse og kvantitativ real-time RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tidligere blev Xcif'er, der selektivt kræves til hæmning af XI-linkede gener i pattedyrs kvindelige celler, identificeret12. Vi yderligere optimeret potente små molekyle hæmmere til at målrette XCIFs, såsom ACVR1 og downstream effektorer af PDPK1, som effektivt genaktivere XI-linked Mecp2 i mus fibroblast cellelinjer, mus kortikale neuroner, og en menneskelig fibroblast celle afledt af en RTT-patient. Disse resultater tyder på, at XI reaktivering er en plausibel terapeutisk tilgang til at redde genet mangler hos X-linked disease patienter; Det er dog endnu ikke muligt at fastslå gennemførligheden in vivo. For nylig, XCIF-hæmmere blev påvist at genaktivere XI-linked Mecp2 in vivo, for hvilke en ikke-tilfældig Xistδ: Mecp2/Xist: Mecp2-gfp musemodel blev genereret.

Et attraktivt træk ved Xistδ: Mecp2/Xist: Mecp2-Gfp model er, at det giver en nøjagtig Kvantitation af XI-linked Mecp2 reaktivering af flere årsager. Først, på grund af sletningen af xist på maternel X kromosom, den Xistδ: Mecp2/Xist: Mecp2-gfp mus har ikke-tilfældige XCI. Som et resultat, den genetisk mærkede Mecp2 er tavs i 100% af cellerne (figur 1c), i modsætning til en forventet 50:50 udtryk for X-linked gener i tilfældige XCI mus modeller, såsom Xist: Mecp2/Xist: Mecp2-gfp. Derfor er resultaterne ikke udelukket af mosaik udtryk af GFP, og 100% celler bære Mecp2-gfpXI i xistδ: Mecp2/Xist: Mecp2-gfp model. For det andet, den genetiske mærkning af Mecp2 tillader direkte visualisering af individuelle neuroner med REAKTIVERET gfp, og dermed minimere de eksperimentelle manipulationer i neuronal analyse.

En nylig undersøgelse fandt, at intracerebroventrikulær injektion af XCIF-hæmmere i mus hjernen halvkugle genaktiverer XI-linked Mecp2 ved hjælp af immunofluorescens analyse af muse hjernen16. Vigtigt, narkotikabehandling havde ingen negativ indvirkning på den generelle sundhed, såsom vægt, grooming, eller mobilitet16. Desuden er der ingen toksicitet påvist ved narkotikabehandling i leveren eller milten. Sammen giver denne undersøgelse et vigtigt bevis-of-princip for at påvise, at interferere med funktionen af XCIFs fører til deundertrykkelse af XI in vivo.

Sammenfattende kan en følsom musemodel bruges til at evaluere reaktivering af XI. Denne dyremodel design kan også tilpasses til at generere en forbedret RTT musemodel, der havne Mecp2 mutationer (sandsynligvis mindre symptomatisk) på den aktive X kromosom og Wild-type Mecp2 på XI i alle celler. På grund af ikke-tilfældige XCI, mens de fænotypiske symptomer kan være mere udtalt, det forventes, at denne model også vil give mulighed for bedre evaluering og nøjagtig vurdering af revertering af symptomer på grund af XI reaktivering. Desuden, Xistδ: Mecp2/Xist: Mecp2-Gfp kan også ændres til at studere XI reaktivering i andre X-relaterede sygdomsmodeller, såsom DDX3X syndrom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Forfatterne takker Antonio Bedalov for at levere reagenser; University of Virginia vævs histologi kerne til kryosektionering; University of Virginia flow flowcytometri Core for flow cytometri analyse; Christian Blue og Saloni Singh for teknisk assistance med genotypebestemmelse. Dette arbejde blev støttet af en dobbelt hoo Research Grant til Z.Z., og en pilot Project program Award fra University of Virginia-Virginia Tech Seed fund Award og Hartwell Foundation individuelle biomedicinsk forskning Award til S.B.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics