Pasif X kromozom üzerinde Mecp2 farmakolojik yeniden aktivasyonu için rasgele olmayan bir fare modeli

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, rastgele olmayan X kromozom inactivation ile uygulanabilir bir kadın duvar modeli oluşturmak için bir protokol tarif, yani, maternally miras X kromozom hücrelerde% 100 ' de aktif değildir. Ayrıca, pasif X kromozom in vivo farmakolojik reaktivasyonunun fizibilite, tolerabilite ve güvenliğini test etmek için bir protokol açıklanmaktadır.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X kromozom inaktivasyonu (XCI) cinsiyeler arasında gen dozaj dengesi elde etmek için kadınlarda bir X kromozom rasgele susturulması olduğunu. Sonuç olarak, tüm kadınlar X bağlantılı gen ifadesi için heterozigot vardır. XCı 'nın anahtar düzenleyicilerinin biri, XCı 'nın başlatılması ve bakımı için gerekli olan Xist'dir. Önceki çalışmalar, büyük ölçekli, fonksiyon kaybı genetik ekranı kullanarak 13 Trans hareket X kromozom inaktivasyon faktörünü (Xcıs) tespit etmiştir. ACVR1 ve PDPK1 gibi Xcıs 'Ler, kısa saç pim RNA veya küçük molekül inhibitörleri kullanarak inhibisyonu, kültürlü hücrelerde X kromozom bağlantılı genleri yeniden etkinleştirir. Ancak Pasif X kromozom in vivo olarak yeniden aktive edilebilirliğinin fizibilite ve tolerabilitesi belirlenecek. Bu hedefe doğru, bir Xistδ: Mecp2/Xist: Mecp2-Gfp fare modeli bir X kromozom üzerinde Xist silinmesi nedeniyle olmayan rasgele XCI ile üretilir. Bu modeli kullanarak, aktif X reaktivasyonu ölçüde XCıF inhibitörleri ile tedavi sonrasında fare beyin quantite oldu. Son zamanlarda yayımlanan sonuçları göstermek, ilk kez, Xcıfs farmakolojik inhibisyonu canlı fare beynin kortikal nöronlar içinde aktif X kromozom Mecp2 yeniden etkinleştirir.

Introduction

X kromozom inaktivasyonu (XCI) doz telafisi bir süreçtir x-bağlantılı gen ifadesi dişilerde x kromozom bir kopyasını susturarak dengeler1. Sonuç olarak, aktif olmayan X kromozom (Xi), histon H3-lizin 27 trimetilasyon (H3K27me3) ve histon H2A mayası (H2Aub) gibi DNA metilasyonu ve inhibitör histon modifikasyonları dahil heterokromatin karakteristik özelliklerini birikir 2. x kromozom susturulması Master regülatörü, x kromozomların sayım ve eşleştirme, inactivation için x kromozom rasgele seçimi ve başlama ve başlatma kontrolleri 100 − 500 KB civarında, xınactivation Merkezi (KIC) bölgedir X kromozom3boyunca susturma yayılması. X inaktivasyonu süreci, x kromozom4' ün üç boyutlu yapısını yeniden modellemek ve kromozom çapında susturulması için BDT 'de bulunan XI 'e özel transkript (xıst) tarafından başlatılır. Son zamanlarda, çeşitli proteomik ve genetik ekranlar XCI ek regülatörler tespit etti, gibi x-ist etkileşim proteinleri5,6,7,8,9 , 10 ' dan fazla , 11 ' i , 12. Örneğin, tarafsız genom çapında RNA parazit ekranı kullanan bir önceki çalışmada 13 Trans-hareket XCI faktörü (xcıs)12tespit edilmiştir. Mekanik olarak, Xcıs Xıst ifadesini düzenler ve bu nedenle xcıfs işlevine müdahale etmek arızalı XCI12' ye neden olur. Birlikte, alanda son gelişmeler XCı başlatmak ve korumak için gerekli olan moleküler makine içine önemli Öngörüler sağladı.

XCI regülatörlerinin tanımlanması ve XCI 'daki mekanizmalarını anlamak Rett sendromu (RTT)13,14gibi X bağlantılı insan hastalıkları ile doğrudan ilgilidir. RTT, X-bağlantılı metil-CPG bağlayıcı protein 2 ' de bir heterozigot mutasyon nedeniyle nadir görülen bir nörogelişimsel hastalıktır (MECP2), ağırlıklı olarak kızları etkileyen15. MECP2 X kromozom üzerinde yer aldığından, RTT kızlar MECP2 eksikliği için heterozigot vardır ~ 50% vahşi tipi ifade hücreleri ve ~ 50% mutant MECP2ifade. Özellikle, RTT mutant hücreler bir uyuyan ama Wild-türü kopyası Mecp2 XI, fonksiyonel geni bir kaynak sağlayarak, hangi reaktive, potansiyel olarak hastalığın belirtileri hafifletmek olabilir. RTT ek olarak, Xi 'nin yeniden aktivasyonu DDX3X sendromu gibi potansiyel bir terapötik yaklaşımın temsil ettiği diğer birçok X bağlantılı insan hastalıkları vardır.

Xcıfs inhibisyonu, 3-fosfoinositide bağımlı protein kinaz-1 (PDPK1), ve aktivin bir reseptör tipi 1 (ACVR1), kısa saç iğnesi RNA (shrna) veya küçük molekül inhibitörleri tarafından, XI bağlı genler reaktive12. XI bağlantılı genlerin farmakolojik reaktivasyonu, fare fibroblast hücre hatları, Yetişkin fare kortikal nöronlar, fare embriyonik fibroblastlar ve bir RTT hastadan elde edilen fibroblast hücre hatları içeren çeşitli ex vivo modellerde görülür12. Ancak, XI bağlantılı genlerin farmakolojik yeniden aktivasyonuna uygun olup olmadığını gösterilecektir. Bir sınırlama faktörü doğru yeniden XI genlerin ifade ölçmek için etkili hayvan modellerinin eksikliği. Bu hedefe doğru, bir xistδ: Mecp2/Xist: Mecp2-Gfp fare modeli, maternal X kromozom16üzerinde Xist heterozigot silme nedeniyle tüm hücreler XI üzerinde bir genetik etiketli Mecp2 taşır üretilir. Bu modeli kullanarak, XI Mecp2 ifadesi, canlı farelerin beyinde Xcıfs inhibitörleri ile tedavi sonrasında quantitite edilmiştir. Burada, Xistδ: Mecp2/Xist: Mecp2-Gfp fare modeli ve metodolojisi nımofluorescence tabanlı asder kullanarak kortikal nöronlar üzerinde Niceye reaktivasyonu ile tanımlanmıştır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Fareler ile ilgili çalışmalar Virginia Üniversitesi Kurumsal hayvan bakımı ve kullanım Komitesi (ıayuc; #4112) tarafından onaylanmıştır.

1. bir non-Random XCı fare modeli ile genetik etiketli Mecp2 XI oluşturmak

Not: Çalışmada kullanılan fare suşları aşağıdaki gibidir: Mecp2-Gfp/Mecp2-Gfp (Mecp2TM 3.1 kuş, malzeme tablosu) ve Xist/δxist (B6; 129-Xist < tm5Sado >; Antonio bedalov, Fred tarafından sağlanmıştır Hutchinson Kanser Merkezi, Seattle). İlgili suşları arasında üreme stratejileri her gerinim için fare kolonileri genişletmek için tasarlanmıştır.

  1. Tablo 1' de listelenen gen spesifik astar kullanarak yetiştirildikten sonra elde edilen tüm fareler suşları ve ilgili nesil üzerinde PCR-genotyping gerçekleştirin.

2. tasarım fare üreme stratejisi Xistδ oluşturmak için: Mecp2/Xist: Mecp2-Gfp

  1. Bir Mecp2-Gfp/Y erkek ve XistΔ-Mecp2/Xist-Mecp2 kadın birlikte (12 h/12 h: ışık/karanlık döngüsü) (Şekil 1a) konut tarafından bir üreme çifti kurmak. İdeal olarak, uygulanabilir ve verimli fareler kullanarak bir defada en az 5 üreme çiftleri ayarlayın. Hamile kadın Doğum yaptıktan sonra, onu erkek ile ilk çöp yükseltmek için izin verir.
    Not: Çünkü baba Xist Knockout bastırılmış XCI, doz telafisi ve farklılaşma yolları17, üreme içinde xistδ-Mecp2/Y fareler kullanımı gerekli Genotype ile kadın yavruları üretmek için başarısız olacaktır.
  2. Post-Natal gün 21 (p21) at çöp sütten sonra, tanımlamak ve xistδ etiket: Mecp2/Xist: Mecp2-Gfp kadın pups bir PCR tabanlı Genotipleme Assay (Şekil 1B) kullanarak.
    Not: Grup başına gerekli hayvanların sayısı açısından, aşağıda bildirilen sonuçlar için, 5 üreme çiftleri yaklaşık 10 kadın Xistδ oluşturulan ayarlandı: Mecp2/Xist: Mecp2-Gfp fareler.
  3. Tüm önerilen deneyler için kadın fare modellerini kullanın.
    Not: Seks XCı çalışmaları için önemli bir biyolojik değişkendir ve erkek modeli rasgele XCı 'nın şaşırtıcı etkileri için hesap yapmaz.
  4. Hayvan çalışmaları boyunca tutarlı olmak ve hayvan çağı herhangi bir etkisi dışarı kural, 5 − 8 haftalık kadın Xistδ: Mecp2/Xist: Mecp2-Gfp fareler tüm deneyler gerçekleştirin.

3. izole dişi Xistδ: Mecp2/Xist: Mecp2-Gfp Mouse embriyonik fibroblastlar (MEFS)

  1. Mecp2-Gfp/Y erkek ve Xistδ-Mecp2/Xıst-Mecp2 dişi arasında zamanlanmış çiftleşme ayarlayın. Gebelik olasılığını artırmak için en az 3 − 4 çiftleşme kafesi ayarlayın.
  2. Çiftleşme sonra sabah vajinal fiş onayladıktan sonra, kadın ayrı ve bu gün embriyonik gün 0,5 (E 0.5) olarak kabul edilir. Prospektif hamile kadının ağırlık kazanç izlemek ve görsel gebelik onaylamak için fareler karın incelemek. E 14.5 − 15.5 üzerinde, servikal dislocation yoluyla hamile kadın fareler ötenize.
  3. Bir laminar kaput altında,% 70 etanol ile hamile dişi karın silin. Steril makas kullanarak, karın boşluğunu incelemek ve embriyoları içeren uterus boynuzlarını çıkarın. Forseps kullanarak, kalan karın dokusunu (6 − 12 embriyo genellikle bekleniyor) keserken embriyoları yavaşça çıkarın.
  4. Embriyoları içeren uterus boynuzlarını 10 mm 'lik bir doku-kültür yemeğinde yerleştirin. Steril makas ve forseps kullanarak, bir embriyo taşıyan bireysel Saks izole etmek için uterus boynuzları boyunca bir kesi yapmak. Dikkatle, 30 mL steril Hanks ' dengeli tuz çözeltisi (HBSS) buz üzerinde embriyo geri kalanı içeren uterus boynuzları yerleştirin.
  5. Yavaşça kesiği açın ve steril makas ve forseps kullanarak embriyo izole. Göbek kablosunu keserek plasenta çıkarın.
  6. Embriyonun kafasını dökür.
    Not: Embriyonik dokuların geri kalanı daha da işlenecek olmakla beraber, embriyo kafasından gelen doku Genotipleme için DNA 'Yı izole etmek için kullanılacaktır.
  7. Steril makas ve forseps kullanarak embriyonun orta çizgi keserek karın açın. Kalp, karaciğer ve akciğer gibi viseral organları çıkarın.
  8. Kalan embriyonik dokusu steril 60 mm doku kültürü plakasına aktarın ve makas veya jilet kullanılarak küçük parçalara ayrılır. Hücre kümeleri açık kırmak için, Trypsin-EDTA 3 mL ekleyin (0,05%) ve 37 °C ' de 15 dakika boyunca inkübe
  9. % 10 fetal Sığır serum (FBS) ve 10 μg/mL penisilin/streptomisin (pen/strep) ile 5 mL Dulbecco modifiye kartal Orta (DMEM) ekleyerek tripsin-EDTA nötralize eder ve tekrarlayan pipetleme (yaklaşık 20 − 30 kez) ile dokuyu ortadan kaldırıyor.
  10. 300 x g 'de hücreleri 5 dakika aşağı döndürün ve 4 ml dmem 'de% 10 FBS ve 10 μg/ml kalem/strep ile hücre pelsini yeniden askıya alın. 60 mm Kültür çanak hücreleri plaka ve kültür 37 °C ' de hücreler% 5 CO2varlığında.
  11. Her bir embriyo için 3,5 − 3.10 adımları uygulayın.
  12. 3,11 adımda en az 3 − 4 gün boyunca elde edilen kültür MEFs 'i.
    Not: Bu aşamada, MEFS de gelecekteki deneyler için kriokonservirovannogo olabilir.
  13. Her bir embriyonun cinsiyetini ve genotipini belirlemek için, Tablo 1' de listelenen astar ve PCR koşullarını kullanarak embriyoların başlarından izole edilen DNA 'yı kullanarak genotyping-PCR ' i gerçekleştirin.

4. Xistδ beyinde yeşil floresan protein (GFP) Ifadesi eksikliği onaylayın : Mecp2/Xist: Mecp2-Gfp fareler bir Ffloresans aktif hücre sıralama tabanlı tahlil kullanarak

  1. Makası kullanarak, beyin hemherinin geri kalanından serebral korteks ayırın ve 1 mL buz-soğuk çekirdekler yalıtım medya (nım) tampon içeren 250 mM sucrose, 25 mM potasyum klorür (KCl), 5 mM magnezyum klorür (MgCl2), 10 mm Tris-CL, % 2 paraformaldehit (PFA) ve 0,1% noniyonik yüzey (malzeme tablosu) ile takviye edilmiştir.
  2. Buz gibi bir cam Homogenizer kullanarak homojenize.
  3. 600 x g, 4 °c ' de 5 dakika boyunca homojenize dokusu döndürün.
  4. NIM çözeltisi içinde 1 ml 25% iyodixanol içinde süpernatant ve pelletini Pelet çıkarın.
  5. NIM çözüm 1 ml% 29 lodixanol Ekle 4 mL ultracentasıge tüp (örnekleri hazır olana kadar buz üzerinde mağaza) ve dikkatle katman 1 mL numune (içinde 25% lodixanol).
  6. 9.000 x g, 4 °c ' de santrifüj sırasında 10 dakika Santrifüjü.
  7. 500 μL floresan aktif hücre sıralama (FACS) tampon (fosfat-tamponlu tuz [PBS] 1 mm EDTA, 0,05% sodyum azid ve% 2 sığır serum albümin [BSA]) ile tamamlayıcı olarak aspirate süpernatant ve pelletini Pelet.
    Not: Örnekler 4 °C veya 1 haftaya kadar saklanabilir.
  8. 5 μL 7-amino-actinomycin D (7-AAD; 50 mg/mL), oda sıcaklığında 5 dk için leke DNA ekleyin.
  9. Akış sitometrisi kullanılarak 7-AAD ve yeşil floresan protein (GFP) sinyali için numuneleri analiz edin.

5. Xistδ: Mecp2/Xıst fizibilitesi belirleyin: XI reaktivasyonu için Mecp2-Gfp fare modeli

  1. Tohum 1 x 105 hücreler/ml dişi xistδ: Mecp2/Xıst: Mecp2-Gfp MEFS, Mecp2/Mecp2-Gfp ve Xist-Mecp2/Y MEFS, 6-well formatında ve oda slaytlarında adım 3,12 elde edilen, dmem ile% 10 FBS ve 10 μg/ml kalem/strep, 37 °c ' de % 5 CO2varlığı.
    Not: Mecp2/Mecp2-Gfp ve Xist-Mecp2/Y MEFS deneylerde pozitif ve negatif kontroller olarak kullanılır.
  2. 24 saat sonra hücrelere taze orta ekleyin. Xistδ: Mecp2/Xıst: Mecp2-Gfp MEFS Için, xcıfs inhibitörleri (örn., 0,5 μm LDN193189 ve 2,5 μm GSK650394) veya tek başına araç ile tamamlayıcı ortam ekleyin. Her 2 günde bir tek başına taze inhibitör veya araç ile tamamlayıcı orta değiştirin. Mecp2/Mecp2-Gfp ve Xist-Mecp2/Y MEFS için, her 2 günde bir taze ortam ekleyin.
  3. Önleyici tedavi sonrası 1 hafta, RNA yalıtım (6-kuyu plaka) ya da immünofluorescence (Oda slaytlar) için hücreleri düzeltmek için MEFs hasat. Mecp2/Mecp2-Gfp embriyoları tarafından pozitif ve Xist-Mecp2/Y embriyoları olarak negatif denetimler sırasıyla yalıtılmış MEFS kullanın.
    1. RNA yalıtımı için, toplam RNA 'nın guanidinyum Thiocyanate tabanlı RNA ekstraksiyon reaktif tarafından yalıtılması ve Reverse transcriptase kullanarak ters transkripsiyonu. Mecp2-WT ve Mecp2-Gfp kullanarak niceliksel ters transcriptase-PCR (QRT-PCR) Ile ölçüm Mecp2-Gfp Ifadesi ve önceden12açıklandığı gibi Tablo 1' de listelenen astar.
    2. İmmünofluorescence için, daha önce12,16açıklandığı gibi, Anti-Gfp primer antikor (1:100) ile leke MEFS. Ölçüm GFP yoğunluğu tarafından nicel immünofluorescence ilaç tedavi Xistδ: Mecp2/Xist: Mecp2-Gfp MEFS, daha önce açıklandığı gibi18.

6. Xistδ: Mecp2/Xist: Mecp2-Gfp fare modeli beyinde farmakolojik XI reaktivasyonunu gösterme

  1. Uyuşturucu ve araç kontrolü hazırlayın.
    1. Beyin enjeksiyonları için taze, steril bir araç (0,9% NaCl,% 0,5 metilselüloz,% 4,5 dimetil sülfoxid [DMSO]) hazırlayın.
    2. 1,5 mm LDN193189 (ACVR1 küçük molekül inhibitörü) ve 1,6 mm GSK650394 (SGK1 küçük molekül inhibitörü, PDPK1 bir akım efektör) araç (% 0,9 NaCl, 0,5% metilselüloz, 4,5% DMSO) yeniden askıya dahil kimyasal inhibitörleri hazırlayın veya araç Yalnız. Kimyasal inhibitörler veya araç enjekte edilen toplam hacim, hayvan başına doz başına 10 μL 'dir.
  2. Hayvan beyin enjeksiyonları için hazırlayın.
    1. Cerrahi bölgeyi dezenfektan (% 10 sodyum hipoklorit çözeltisi) ile tezgah ve ısıtma yastığı silerek hazırlayın.
    2. Anestezize 4 haftalık fare bir intraperitoneal enjeksiyonu ile ketamin/xylazine karışımı bir dozda 140 mg/kg ve 10 mg/kg, sırasıyla. Anestezi seviyesini belirlemek için pedal çekme refleks kullanın.
    3. Kornea kurutmayı önlemek için anestezi indüksiyonu aşağıdaki gözlere oftalmik merhem uygulayın.
    4. Fare kafasının üstüne boyun kürk tıraş.
    5. Fare kafasını bir seviye düzlemde olduğunu sağlayarak, burun kısıtlaması ısırma çubuğu ve burnun üzerinde burun kelepçesi sıkma fare 's kesici dişler Kancalı tarafından stereotaktik platformda fareyi konumlandırın.
    6. Kulağın yüksekliği, gerektiğinde, kulak kanalı kaudal kısmına ulaşmak için, fare kafası bir seviye düzlemde ve parmak dokunuşunda immobilize gibi onları güvence altında ayarlayın.
    7. Bir topikal antiseptik, povidone-iyot ve 70% etanol gibi alternatif mendiller ile fare kafasını dezenfekte.
  3. Uyuşturucuyu Yönet.
    1. Steril bir neşter kullanarak, Orta kafa derisi bir 0,75 cm yatay kesi olun.
    2. 0,45 mm 'lik bir Burr kullanarak, sağ ve sol kortikal hemisferlerin üzerinde iki simetrik delik (sagital sütür 2 mm ve lambdoid sütür 2 mm, parietal kemik yaklaşık ortasında) matkap.
    3. Stereotaktik platforma 10 μL şırıngayı sıkıca takın.
    4. Kimyasal inhibitörlerinin çözümünü karıştırın ve şırıngaya 10 μL çözelti çizin. Şırınga herhangi bir hava kabarcıkları kaçının.
    5. Şırınga iğnesini kafatasına dik şekilde (90 °) tutarak Burr deliğine ilerlenin. İğne kafatası geçtiğinde, stereotaktik dijital ekran üzerinde koordinatları sıfır ve 2,5 mm derinliğe ulaşıncaya kadar iğne ucunu ilerlemek.
    6. İğne 0,5 mm 'ye 2 mm derinliğe kadar çekin.
    7. 10 μL çözeltisi yavaşça enjekte edilir (~ 1 dk). Enjeksiyon tamamlandıktan sonra, ~ 1 dakika için beyinde iğne bırakın ve sonra iğne geri.
    8. İkinci Yarımküre için enjeksiyon tekrarlayın (araç sadece kontrol).
    9. Sütürler veya "cilt tutkal" fareyi kullanarak (Eğer yara > 0.5 cm hem sütürler ve "cilt tutkal" kullanılmalıdır) cilt kapatın.
    10. Kulak çubuklarını gevşetin ve fareyi stereotaktik cihazdan çıkarın.
    11. Analjezikler yönetin (Buprenorfik SR 0,5 mg/kg IP) ve hayvan bilinç geri gelene kadar 37 °C olarak ayarlanmış bir ısıtma yastığı üzerine fareyi yerleştirin.
    12. Fare uyarı ve duyarlı olduğunda, hayvanı orijinal kafesine geri aktarın.
    13. Prosedürü her 2 günde bir 20 gün boyunca tekrarlayın. Sonraki enjeksiyonlar için alan tekrar delme gerekli değildir.
  4. Fare beynini izole et.
    1. Doz rejimi tamamlandıktan sonra, bir CO2 odasında fare ötenize.
    2. İğneler kullanarak bir yüzeyde fareyi immobilize.
    3. Makas ve forseps kullanarak kaburga kafesi hemen altında integument ve abdominal duvar aracılığıyla lateral kesi olun. Karaciğeri diyaframdan dikkatlice ayırın.
    4. Makas kullanarak, diyaframı kesti ve plevral boşluğu açığa çıkarmak için kaburga kafesinin tüm uzunluğu boyunca kesme devam.
    5. Makas kullanarak, sol ventrikül posterior ucuna bir kesi yapmak.
    6. Hemen, ~ 2 dk üzerinden ~ 15 mL PBS ile sağ kalp odası enjekte başlar. kırmızı soluk pembe karaciğer renk değişimi iyi perfüzyon göstergesidir.
    7. ~ 2 dk üzerinde PBS% 4 civarında formaldehite ~ 10 ml ile fare kalbi sağ odası enjekte.
    8. Fare decapitate ve kafatası ortaya çıkarmak için kafa derisi bir orta çizgi kesi yapmak için makas kullanın.
    9. Makas bir ucu foramen magnum içine yerleştirin ve göz doğru kafatası içine yanal kesti. Diğer taraf için tekrarlayın. Beyin yaralanmasını önlemek için mümkün olduğunca yüzeysel olarak makas sonunu tutmaya çalışın.
    10. Fare burnunun üstündeki ve gözleri arasındaki bölgeyi kesmek için makas kullanın.
    11. Beyin hemheritlerinden kraniyal kemikleri hafifçe soyma forseps kullanın.
    12. Bir spatula ile beyin kaldırın ve dikkatle kafatası düzeltmek kranial sinir lifleri incelemek için makas kullanın.
    13. Beyin plastik bir çanak üzerine yerleştirin, beyinli ve koku ampuller kesip, ve bir 15 ml tüp içine beyin yer 4% PFA IS PBS.
  5. Fare beynine Cryo-Section.
    1. 4 °c ' de PBS 'de% 4 civarında formaldehite içinde beyin düzelt.
    2. Beyin PBS ile 4 °C ' de en az 3 Ila 5 dakika durulayın.
    3. Dokularda cryopreserving için tek kullanımlık kalıpları etiketleyin.
    4. Makas ve forseps (enjeksiyon sitelerden ~ 5 mm bölümleri yapmaya başlayın) kullanarak beynin ön kes.
    5. Koronal bölümler elde etmek için aşağı bakan beynin ön ile cryomold için beyin aktarın. En iyi kesme sıcaklığı bileşiği (OCT) içinde beyin içeren küf Submerge.
    6. 10 mm plastik Petri çanak içine sıvı azot dökün ve azot içine Kriyo-küf beyin yerleştirin.
      Not: Dokuyu, beynin kesimini yönlendirmek için adım 6.5.5 açıklandığı gibi yönlendirmek önemlidir.
    7. OCT katı beyaz olduğunda, dondurulmuş beyni depolama için bir-80 °C dondurucu içine yerleştirin.
    8. Beyin, kriyostat ve kriyobölüm (5 − 6 μm kalınlığı) ile kesimden önce en az 30 dk, her slayt için 2 − 3 Bölüm montajında, beyni-20 °C ' ye dengelenmesi. Slaytlar daha sonra kullanmak için-80 °C ' de depolanabilir.
  6. Bir immünofluorescence tabanlı yaklaşım kullanarak XI reaktivasyonunu belirleyin.
    1. Boyama prosedürünü başlatmadan önce, beyin bölümlerini 4 °C ' de bir gecede kurutun.
    2. (0,1 M sitrik asit, 0,1 M Tris-Base, pH = 6,0), 5 dakika boyunca bir 100 °C ısı bloğu üzerinde antijen alma çözeltisi içinde slaytlar daldırın.
    3. Her biri oda sıcaklığında 5 dakika boyunca 1x PBS ile 4X kaydırıyor.
    4. Blok çözeltisi içinde slaytlar batırın (0,1 M NH4CL/PBS/% 0.2 jelatin/0.05% noniyonik yüzey) Oda sıcaklığında 20 dakika için.
    5. Her biri için oda sıcaklığında (PBS/0.2% jelatin) yıkama tampon ile 3x yıkayın slaytlar.
    6. Anti-GFP-AlexaFluor647 (1:100) ve anti-MAP2 (1:1000) inkübasyon ortamında antikorlar (PBS/0.2% jelatin/1% BSA) ile leke beyin bölümleri ve gece 4 °C ' de kuluçgun.
    7. Birincil antikorları toplayın (yeniden kullanılabilir). Oda sıcaklığında toplam 30 dakika boyunca yıkama tampon ile 4X kayar.
    8. Kuluçk ortamında keçi Anti-tavuk Florükinin isothiocyanate (FITC) etiketli ikincil antikor (1:1000) ile beyin bölümlerini inkübasyon yapın ve karanlıkta oda sıcaklığında 1 − 2 h 'yi kulbin.
    9. Oda sıcaklığında toplam 30 dakika boyunca yıkama tampon ile 4X kayar.
    10. 22 mm x 50 mm lamel magazini üzerinde 4 ′, 6-diamidino-2-phenylindole (dapi) ile montaj orta bir damla yer, sonra tüm doku bölümlerini kapsayan, bir slayt üzerine lamel magazini tersine çevirin.
    11. Mikroskop üzerinde görüntü ve kontrast ve parlaklık için görüntüleri ayarlayın. Görüntüleri yakalamak ve hem ilaç tedavi ve araç Xistδ: Mecp2/Xist: Mecp2-Gfp fare beyin hemheres TEDAVI Gfp pozitif hücrelerin sayısını ölçmek.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Xistδ fizibilitesi göstermek için : Mecp2/Xıst: XI reaktivasyon çalışmaları için Mecp2-Gfp fare modeli, XI bağlantılı Mecp2-Gfp xcıf inhibitörü-aracılı reaktivasyonu fare embriyonik fibroblastlar (MEFS) test edildi. Kadın MEFs gün 15,5 Xistδ: Mecp2/Xıst: Mecp2-Gfp embriyolar Bölüm 3 ' te açıklandığı gibi izole edildi (Şekil 1a). Dişi Xistδ: Mecp2/Xist: Mecp2-Gfp MEFS 'in genotipleri, daha önce19 (Şekil 1B) ve FACS tabanlı tahlil (Şekil 1C) olarak açıklandığı gibi, genotyping-PCR tarafından onaylandı. MEFs, 7 gün boyunca DMSO ya da iki ilaç LDN193189 ve GSK650394 (0,5 μM ve 2,5 μM) ile tedavi edildi. İlaç tedavisi sonrasında Mecp2-Gfp ' i n Ifadesi QRT-PCR tarafından izleniyor. Şekil 1D'de görüldüğü gibi, ilaç tedavisi, ancak DMSO değil, XI-Mecp2-Gfp ' i n yeniden aktive edilmiş ifadesi. Daha sonra, adım 5.3.2 ' de açıklandığı gibi, bireysel MEFs 'de XI-Mecp2-Gfp ifadesinin kapsamını belirlemek için nicel immünofluoresesans gerçekleştirilmiştir. Erkek embriyolar (Mecp2/Y) izole negatif kontrol MEFS gelen sinyal arka plan olarak ayarlandı ve ~ 66 pozitif kontrol Mecp2-Gfp/Mecp2 MEFS bir nükleer Gfp sinyali vardı. Beklendiği gibi, Xistδ: Mecp2/Xist: Mecp2-Gfp MEFS DMSO ile tedavi nükleer Gfp çok düşük düzeyde vardı (~ 3%). Buna karşılık, ~ 31% ilaç tedavi Xistδ: Mecp2/Xist: Mecp2 MEFS nükleer Gfp için pozitif (Şekil 1e). Birlikte, bu sonuçlar XCıF inhibitörleri MEFs XI bağlantılı Mecp2 yeniden gösterir, ancak XI yeniden aktivasyonu ölçüde hücre nüfusu değişir.

Farmakolojik XI reaktivasyonu tabanlı yaklaşımımızın fizibilitesini değerlendirmek için, ilaç tedavisi Xistδ 'ın beyinde XI bağlantılı Mecp2 yeniden etkinleştirir olsun : Mecp2/Xist: Mecp2-Gfp dişi fareler araştırıldı. 10 μL araç veya 10 μL XCıF inhibitörü (1,5 mM LDN193189 ve 1,6 mM GSK650394), stereotaktik cerrahi prosedürler kullanılarak intracerebroventriküler enjeksiyon ile 4 haftalık XI-Mecp2-Gfp kadın farelerin zıt beyin hemfererlerinde uygulandı ( Şekil 2a , B). Prosedür her ikinci günde tekrarlandı (Şekil 2C), ve üç hafta sonra, hayvanlar ötenize edildi, ve beyin izole edildi. Bir alt küme qRT-PCR için kullanıldı ve başka bir immunohistokimya tarafından analiz edildi. Araç ve ilaç infeksli hemheres vahşi tip Mecp2 ve XI-Mecp2-Gfp ifadesi QRT-PCR ( Tablo 1' de listelenen astar dizileri) tarafından belirlendi. Şekil 2D'de gösterildiği gibi, ilaç tedavisi reaktive XI-Mecp2-Gfp içinde ~ 30% ilaç infekik beyin yarımküü hücrelerinde, ancak Xi- Mecp2-Gfp araç infemik Yarımküre içinde tespit edilmedi. MAP2 çok sayıda, bir nöronal Marker, pozitif nöronlar da GFP pozitif oldu (~ 45%) , XI-Mecp2-Gfp ifadesinin göstergesidir. MAP2 negatif beyin hücrelerinin yaklaşık% 20 GFP ifade, olmayan nöronal hücrelerde XI-Mecp2-Gfp reaktivasyonu teyit (Şekil 2e).

Figure 1
Şekil 1: nesil ve doğrulama XI-Mecp2 fare modeli. (A) xistδ oluşturmak için üreme stratejisi şematik : Mecp2/Xist: Mecp2-Gfp fareler. (B) xıst PCR Genotipleme : Mecp2-Gfp/Y, xistδ: Mecp2/xıst: Mecp2 ve xistδ: Mecp2/Xist: Mecp2-Gfp fareler. Fareler Mecp2-Gfp, Mecp2 ve cinsiyet belirleyici bölge Y (sry) varlığı için izleniyor. (C) fare korteks izole çekirdekler akış cytometri analizi. Mecp2/Mecp2-Gfp fare Cortex show ~ 50% Gfp-pozitif çekirdekler Iken Xistδ: Mecp2/Xist: Mecp2-GFP hiçbir Gfp-pozitif çekirdekleri gösterir. (D) QRT-PCR analizi, Mecp2-Gfp ve Wild-Type Mecp2 transkriptlerin kadın Xistδ: Mecp2/xıst: MECP2-Gfp MEFS 'ı DMSO veya ilaç (LDN193189 ve GSK650394) ile tedavi ederek izlenmesini takip etmek. Gapdh bir yükleme kontrolü olarak izleniyor. (E) dişi Xistδ 'da niceliksel immünofluorescence Izleme Gfp yoğunluğu : Mecp2/Xıst: Mecp2-Gfp MEFS DMSO veya ilaçlar LDN193189 ve GSK650394 ile tedavi. Mecp2/Y veya Mecp2/Mecp2-Gfp fareler tarafından izole edilen MEFS sırasıyla negatif ve pozitif kontroller olarak kullanıldı. Her nokta bir MEF 'i temsil eder ve kesik çizgi, 1 ' e ayarlanmış Mecp2/Y 'de elde edilen en büyük arka plan sinyalini gösterir. Alt panel çekirdeklerin temsili resimlerini gösterir. Bu rakam Przanowski ve ark.16' dan değiştirildi. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2: canlı farelerin Serebral kortikal nöronlarının X bağlantılı Mecp2 farmakolojik reaktivasyonu. (A) bir fare kafatası şematik ve (B) beynin sol veya sağ hemheres araç veya ilaç için enjeksiyon site gösteren beyin. (C) ilaç rejiminin şematik. (D) araç veya uyuşturucu tedavi edilen hemherlerden gelen koronal beyin bölümlerinde ENDOJEN Gfp sinyalini (yeşil) gösteren temsilci immünofluorescence görüntüler. DAPı boyama mavi renkte gösterilir. (E) ilacın tedavi edilen yarımküresinde GFP (ANTI-Gfp; kırmızı) ve MAP2 (yeşil) ifadesini izleyen koronal beyin kısımlarına ait immünofluorescence görüntüler. DAPı boyama mavi renkte gösterilir. Bu rakam Przanowski ve ark.16' dan değiştirildi. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Ters astar (5 '-> 3 ') Anealing Temperature/PCR ürün uzunluğu
GÜLDEN 60 °C/87 BP
BIR daha yok 62 °C/137 BP
(TGTCAGAGCCCTACCCATAAG) 62 °C/140 BP
GCACAACCCCGCAAATGCTA 62 °C/364 BP
GCACAACCCCGCAAATGCTA 62 °C/250 BP
AATTGCCCTAACGAGCACAC 62 °C/436 BP
GÜLGÜL 62 °C/217 BP
Bu da ne? 66 °C/270 BP

Tablo 1: Genotipleme ve nicel gerçek zamanlı RT-PCR için kullanılan astar listesi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Daha önce, memeliler kadın hücrelerinde XI bağlantılı genlerin susturulması için seçici olarak gerekli olan Xcıs12tespit edildi. Biz daha fazla güçlü küçük molekül inhibitörleri hedef xcıgs, ACVR1 ve PDPK1, hangi verimli Xi-bağlantılı Mecp2 fare fibroblast hücre hatları, fare kortikal nöronlar ve insan fibroblast hücre yeniden akış efektörlere gibi optimize bir RTT hasta türetilmiştir. Bu sonuçlar, XI reaktivasyonunun X bağlantılı hastalık hastalarında gen eksikliklerini kurtarmak için makul bir terapötik yaklaşım olduğunu göstermektedir; Ancak, in vivo fizibilite belirlenecektir. Son zamanlarda, XCIF inhibitörleri XI bağlantılı Mecp2 in vivo yeniden etkinleştirmek için gösterilmiştir, hangi bir olmayan rasgele Xistδ: Mecp2/Xist: Mecp2-Gfp fare modeli oluşturuldu.

Xistδ: Mecp2/Xist: Mecp2-Gfp modelinin çekici bir özelliği, Xi 'ye bağlı Mecp2 reaktivasyonunu birkaç nedenden dolayı doğru bir kantitasyon sağlar. İlk olarak, maternal X kromozom üzerinde Xist silinmesi nedeniyle, Xistδ: Mecp2/Xist: Mecp2-Gfp fare rasgele XCI vardır. Sonuç olarak, genetiği işaretlenmiş Mecp2 % 100 ' te sessiz (Şekil 1C), Xist: Mecp2/Xist: Mecp2-Gfp gibi rasgele XCI fareler modellerinde X bağlantılı genlerin beklenen 50:50 ifadesinin aksine. Bu nedenle, sonuçlar GFP mozaik ifadesi ile önleyen değildir, ve 100% hücreler Xistδ XI üzerinde Mecp2-Gfp taşımak : Mecp2/Xist: Mecp2-Gfp modeli. İkincisi, Mecp2 genetik etiketleme yeniden aktive Gfp ile bireysel nöronların doğrudan görselleştirme izin, böylece nöronal analiz deneysel manipülasyon minimize.

Yeni bir çalışmada, fare beyin yarımküredeki XCıF inhibitörleri intracerebroventriküler enjeksiyon XI bağlı Mecp2 fare beyni16immünofluorescence analizi kullanarak yeniden etkinleştirir bulundu. Daha da önemlisi, ilaç tedavisinde ağırlık, bakım veya hareketlilik16gibi genel sağlık üzerinde olumsuz bir etkisi yoktu. Dahası, karaciğer veya dalak ilaç tedavisi ile algılanan hiçbir toksisite yoktur. Bu çalışmada, Xcıs fonksiyonuyla müdahale etmek, XI in vivo ' nın bastırılmasına yol açan bir prensip kanıtı sağlar.

Özetle, hassas bir fare modeli XI yeniden aktivasyonunu değerlendirmek için kullanılabilir. Bu hayvan modeli tasarımı da tüm hücrelerde XI üzerinde aktif X kromozom ve Wild-Type Mecp2 üzerinde Mecp2 mutasyonlar (muhtemelen daha az semptomatik) liman gelişmiş bir RTT fare modeli oluşturmak için adapte edilebilir. Non-Random XCI nedeniyle, fenotipik belirtileri daha belirgin olabilir iken, bu model de daha iyi değerlendirme ve XI reaktivasyonu nedeniyle semptomların tersine doğru değerlendirilmesi için izin verecektir beklenmektedir. Ayrıca, Xistδ: Mecp2/Xıst: Mecp2-Gfp Ayrıca DDX3X sendromu gibi diğer X-bağlantılı hastalık modellerinde XI reaktivasyonu incelemek için değiştirilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların ifşa etmesi gereken hiçbir şey yok.

Acknowledgments

Yazarlar, reaktifler sağlamak için Antonio Bedalov teşekkür ederiz; Virginia Üniversitesi doku histolojisi çekirdek kriyobölümleme için; Akış sitometri analizi için Virginia Üniversitesi akış sitometri çekirdeği; Christian Blue ve Saloni Singh, genotyping ile teknik yardım için. Bu çalışma Z.Z. için bir Double Hoo araştırma Grant ve Virginia-Virginia teknoloji tohum fonu Ödülü ve Hartwell Vakfı bireysel Biyomedikal Araştırma Ödülü Üniversitesi 'nden bir pilot proje programı Ödülü tarafından destekleniyordu SB

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics