Un modello di mouse non casuale per la riattivazione farmacologica di MECP2 sul cromosoma X inattivo

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui, descriviamo un protocollo per generare un modello murino femminile vitale con inattivazione cromosomico X non casuale, cioè il cromosoma X ereditato dalla materna è inattivo nel 100% delle cellule. Descriviamo anche un protocollo per testare la fattibilità, la tollerabilità e la sicurezza della riattivazione farmacologica del cromosoma X inattivo in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

X inattivazione cromosoma (XCI) è il silenziamento casuale di un cromosoma X nelle femmine per raggiungere l'equilibrio di dosaggio genico tra i sessi. Di conseguenza, tutte le femmine sono eterozigoti per l'espressione genica legata alla X. Uno dei regolatori chiave di XCI è XIST, che è essenziale per l'avvio e la manutenzione di XCI. Studi precedenti hanno identificato 13 fattori di inattivazione del cromosoma X Trans-azione (XCIFs) utilizzando uno schermo genetico su larga scala e perdita di funzione. L'inibizione degli Xcif, come ACVR1 e PDPK1, mediante l'utilizzo di RNA a breve tornante o di piccoli inibitori delle molecole, riattiva i geni collegati al cromosoma X nelle cellule coltivate. Ma la fattibilità e la tollerabilità di riattivare il cromosoma X inattivo in vivo rimane da determinare. Verso questo obiettivo, un modello di mouse Xistδ: MECP2/XIST: MECP2-GFP è stato generato con XCI non casuali a causa della cancellazione di XIST su un cromosoma X. Utilizzando questo modello, l'estensione della riattivazione X inattiva è stata quantitata nel cervello del topo dopo il trattamento con inibitori XCIF. I risultati recentemente pubblicati mostrano, per la prima volta, che l'inibizione farmacologica di XCIFs riattiva MECP2 dal cromosoma X inattivo nei neuroni corticali del cervello del topo vivente.

Introduction

L'inattivazione cromosoma x (XCI) è un processo di compensazione del dosaggio che bilancia l'espressione genica legata all'X silenziando una copia del cromosoma X nelle femmine1. Di conseguenza, il cromosoma X inattivo (XI) accumula le caratteristiche tipiche dell'eterocromatina, inclusa la metilazione del DNA e le modifiche dell'istone inibitorio, come l'istone H3-lisina 27 trimetilazione (H3K27me3) e l'istone H2A ubiquitinazione (H2Aub) 2. il regolatore principale del silenziamento cromosomico x è la regione del centro di inattivazione x (XIC), intorno a 100 − 500 KB, che controlla il conteggio e l'accoppiamento dei cromosomi x, la scelta casuale del cromosoma x per l'inattivazione, e l'inizio e la diffusione del silenziamento lungo il cromosoma X3. Il processo di inattivazione X è iniziato dalla trascrizione specifica X inattiva (XIST) che ricopre il XI in CIS per mediare il silenziamento a livello cromosoma e rimodellare la struttura tridimensionale del cromosoma x4. Recentemente, diversi schermi proteomici e genetici hanno identificato ulteriori regolatori di XCI, come le proteine interagenti XIST 5,6,7,8,9 , 10 il , 11 il , 12. ad esempio, uno studio precedente che utilizza uno schermo di interferenza dell'RNA a livello di genoma imparziale ha identificato 13 fattori XCI transagionanti (xcif)12. Meccanisticamente, XCIFs regolano l'espressione XIST e quindi, interferendo con la funzione xcifs provoca XCI12difettoso. Insieme, i recenti progressi nel campo hanno fornito importanti approfondimenti sui macchinari molecolari che sono necessari per avviare e mantenere XCI.

L'identificazione dei regolatori XCI e la comprensione del loro meccanismo in XCI è direttamente rilevante per le malattie dell'uomo legate all'X, come la sindrome di Rett (RTT)13,14. La RTT è un raro disturbo dello sviluppo neurologico causato da una mutazione eterozigote nella proteina 2 (MECP2) legata al metil-CPG X-linked che colpisce prevalentemente le ragazze15. Poiché MECP2 si trova sul cromosoma X, le ragazze RTT sono eterozigoti per deficit di MECP2 con ~ 50% cellule che esprimono Wild-Type e ~ 50% esprimendo MECP2mutante. In particolare, le cellule mutanti RTT porto una copia dormiente ma Wild-Type di MECP2 sul XI, fornendo una fonte del gene funzionale, che se riattivato, potrebbe potenzialmente alleviare i sintomi della malattia. Oltre alla RTT, ci sono diverse altre malattie umane legate alla X, per le quali la riattivazione di XI rappresenta un potenziale approccio terapeutico, come la sindrome DDX3X.

L'inibizione di XCIFs, 3-fosfoinositide dipendente proteina chinasi-1 (PDPK1), e activina un recettore di tipo 1 (ACVR1), sia da RNA corto (shRNA) o piccoli inibitori di molecola, riattiva geni XI-Linked12. La riattivazione farmacologica dei geni collegati a XI è osservata in vari modelli ex vivo che includono linee cellulari di fibroblasti del topo, neuroni corticali di topi adulti, fibromi embrionali del topo e linee cellulari di fibroblast derivate da un paziente RTT12. Tuttavia, se la riattivazione farmacologica dei geni collegati a XI è fattibile in vivo rimane da dimostrare. Un fattore limitante è la mancanza di modelli animali efficaci per misurare accuratamente l'espressione dei geni da riattivato XI. Verso questo obiettivo, è stato generato un modello di mouse Xistδ: MECP2/XIST: MECP2-GFP che trasporta un MECP2 geneticamente etichettato su XI in tutte le cellule a causa dell'eliminazione eterozigote in XIST sul cromosoma X materno16. Utilizzando questo modello, l'espressione di MECP2 da XI è stata quantitata dopo il trattamento con inibitori di XCIFs nel cervello dei topi viventi. Qui è descritta la generazione del modello di mouse Xistδ: MECP2/XIST: MECP2-GFP e la metodologia per quantificare la riattivazione di XI nei neuroni corticali utilizzando saggi basati su immunofluorescenza.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Il lavoro che coinvolge i topi è stato approvato dal Comitato per la cura e l'uso degli animali dell'Università della Virginia (IACUC; #4112).

1. generare un modello di mouse XCI non casuale con MECP2 geneticamente etichettato su Xi

Nota: Ceppi di topo utilizzati nello studio sono stati i seguenti: MECP2-GFP/MECP2-GFP (MECP2TM 3.1 uccello, tabella dei materiali) e XIST/δxist (B6; 129-XIST < tm5Sado >; fornito da Antonio bedalov, Fred Hutchinson Cancer Center, Seattle). Le strategie di allevamento tra i rispettivi ceppi sono state progettate per espandere le colonie di topi per ogni ceppo.

  1. Eseguire la genotipizzazione della PCR su tutti i ceppi di topi e le rispettive progenie ottenute dopo l'allevamento utilizzando primer specifici del gene elencati nella tabella 1.

2. progettare la strategia di allevamento del mouse per generare Xistδ: MECP2/XIST: MECP2-GFP

  1. Impostare una coppia di allevamento con un MECP2-GFP/Y maschio e una femmina XistΔ-MECP2/XIST-MECP2 insieme (12 h/12 h: ciclo chiaro/scuro) (Figura 1a). Idealmente, impostare almeno 5 coppie di allevamento alla volta utilizzando topi vitali e fertili. Dopo che la femmina incinta partorì, le permettesse di sollevare la sua prima lettiera con il maschio.
    Nota: Poiché il paterno XIST Knockout altera gli XCI imstampati, la compensazione del dosaggio e le vie di differenziazione17, l'uso di topi Xistδ-MECP2/Y nell'allevamento non produrrà i cuccioli femminili con il genotipo richiesto.
  2. Dopo lo svezzamento della lettiera al giorno 21 post-natale (p21), identificare e contrassegnare i cuccioli di Xistδ: MECP2/XIST: MECP2-GFP femmina utilizzando un saggio di genotipo basato sulla PCR (Figura 1B).
    Nota: In termini di numero di animali necessari per gruppo, per i risultati riportati di seguito, sono state create 5 coppie di allevamento che hanno generato circa 10 femmine Xistδ: MECP2/XIST: MECP2-GFP topi.
  3. Utilizzare modelli di mouse femminili per tutti gli esperimenti proposti.
    Nota: Il sesso è una variabile biologica importante per gli studi XCI, e il modello maschile non rappresenta gli effetti confondenti di XCI casuali.
  4. Per essere coerenti in tutti gli studi sugli animali e escludere qualsiasi effetto dell'età animale, eseguire tutti gli esperimenti in 5 − 8-settimana-vecchia femmina Xistδ: MECP2/XIST: MECP2-GFP topi.

3. isolare Xistδ femminile: MECP2/XIST: MECP2-GFP fibroblasti embrionali del topo (MEFs)

  1. Impostare l'accoppiamento temporizzato tra il MECP2-GFP/Y maschio e Xistδ-MECP2/XIST-MECP2 femmina. Impostare almeno 3 − 4 gabbie di accoppiamento per aumentare la probabilità di gravidanza.
  2. Dopo aver confermato la spina vaginale la mattina dopo l'accoppiamento, separare la femmina e questo giorno è considerato embrionale giorno 0,5 (E 0.5). Monitorare l'aumento di peso della futura femmina incinta e ispezionare visivamente l'addome dei topi per confermare la gravidanza. Su e 14.5 − 15.5, eutanasia i topi femminili gravidi attraverso la lussoposizione cervicale.
  3. Sotto una cappa laminare, pulire l'addome della femmina incinta con 70% di etanolo. Utilizzando forbici sterili, sezionare la cavità addominale e rimuovere le corna uterina contenenti gli embrioni. Usando le pinze, estrarre delicatamente gli embrioni durante il taglio del tessuto addominale rimanente (si prevede solitamente l'uso di 6 − 12 embrioni).
  4. Collocare le corna uterina contenenti gli embrioni in un piatto di coltura tissutale di 10 mm. Usando forbici e pinze sterili, fai un'incisione lungo le corna uterina per isolare le singole sacche che trasportano un embrione. Con cautela, collocare le corna uterini contenenti il resto degli embrioni in 30 mL di soluzione salina equilibrata di Hanks (HBSS) sul ghiaccio.
  5. Tagliare delicatamente aprire il sacco e isolare l'embrione utilizzando forbici sterili e pinze. Rimuovere la placenta tagliando il cordone ombelicale.
  6. Decapitate l'embrione.
    Nota: Mentre il resto del tessuto embrionale sarà ulteriormente elaborato, il tessuto della testa dell'embrione sarà utilizzato per isolare il DNA per la genotipizzazione.
  7. Aprire l'addome tagliando la linea mediana dell'embrione utilizzando forbici e pinze sterili. Rimuovere gli organi viscerali, come il cuore, fegato, e polmoni.
  8. Trasferire il tessuto embrionale rimanente in una piastra di coltura tissutale sterile da 60 mm e tagliare in piccoli pezzi utilizzando forbici o una lama per rasoio. Per rompere aprire i grumi di cellule, aggiungere 3 mL di tripsin-EDTA (0,05%) e incubare a 37 ° c per 15 min.
  9. Neutralizzare la tripsina-EDTA aggiungendo 5 mL del medium Eagle modificato di Dulbecco (DMEM) con il 10% di siero bovino fetale (FBS) e 10 μg/mL di penicillina/streptomicina (Pen/STREP) alla piastra e dissociare il tessuto mediante Pipettaggio ripetitivo (circa 20 − 30 volte).
  10. Girare verso il basso le cellule a 300 x g per 5 min e risospendere il pellet cellulare in 4 ml di DMEM con 10% FBS e 10 μg/ml Pen/Strep. Piastra le cellule su un piatto di coltura 60 mm, e la coltura le cellule a 37 ° c in presenza di 5% CO2.
  11. Eseguire i passaggi 3.5 − 3.10 per ciascun embrione.
  12. I MEF della coltura ottenuti al passo 3,11 per almeno 3 − 4 giorni.
    Nota: In questa fase, i MEF possono anche essere criopriservati per esperimenti futuri.
  13. Per determinare il sesso e il genotipo di ciascun embrione, eseguire la genotipo-PCR utilizzando il DNA isolato dalle teste degli embrioni utilizzando primer e condizioni di PCR elencate nella tabella 1.

4. confermare la mancanza di espressione di proteina fluorescente verde (GFP) nel cervello di Xistδ: MECP2/XIST: topi MECP2-GFP utilizzando un saggio basato sulla selezione delle cellule attivato da Ffluorescenza

  1. Utilizzando le forbici, separare la corteccia cerebrale dal resto degli emisferi cerebrali, e mettere in 1 mL di ghiaccio-freddo nuclei isolamento media (NIM) tampone contenente 250 mM di saccarosio, 25 mM di cloruro di potassio (KCl), 5 mM di cloruro di magnesio (MgCl2), 10 mm Tris-Cl, integrato con 2% paraformaldeide (PFA), e 0,1% tensioattivo non ionico (tabella dei materiali).
  2. Omogeneizzare con un omogeneizzatore di vetro ghiacciato.
  3. Girare verso il basso il tessuto omogeneizzato a 600 x g, 4 ° c per 5 min.
  4. Rimuovere il surnatante e risospendere il pellet in 1 mL di iodixanol al 25% in soluzione NIM.
  5. Aggiungere 1 ml di lodixanol al 29% in soluzione NIM a un tubo ultracentrifuga da 4 ml (conservare su ghiaccio fino a quando i campioni sono pronti) e accuratamente strato 1 ml di campione (in 25% lodixanol).
  6. Centrifugare a 9.000 x g, 4 ° c per 10 min in un Ultracentrifuge.
  7. Aspirare l'aspirato surnatante e risospendere il pellet in 500 μL di tampone di cernita delle cellule attivate a fluorescenza (FACS) (soluzione salina tamponata con fosfato [PBS] integrata con EDTA da 1 mM, 0,05% di sodio azide e 2% di albumina sierica bovina [BSA]).
    Nota: I campioni possono essere conservati a 4 ° c o fino a 1 settimana.
  8. Aggiungere 5 μL di 7-amino-actinomycin D (7-AAD; 50 mg/mL) per 5 minuti a temperatura ambiente per macchiare il DNA.
  9. Analizzare i campioni per il segnale 7-AAD e proteina fluorescente verde (GFP) usando la citometria a flusso.

5. determinare la fattibilità del modello di mouse Xistδ: MECP2/XIST: MECP2-GFP per la riattivazione XI

  1. Seme 1 x 105 cellule/ml femmina Xistδ: MECP2/XIST: MECP2-GFP MEFs, MECP2/MECP2-GFP e XIST-MECP2/Y MEFs ottenuti nel passo 3,12 in un formato 6-Well e in diapositive a camera, in DMEM con 10% FBS e 10 μg/ml Pen/STREP, a 37 ° c nel presenza di 5% CO2.
    Nota: MECP2/MECP2-GFP e XIST-MECP2/Y MEFs vengono utilizzati come controlli positivi e negativi negli esperimenti.
  2. Aggiungere il mezzo fresco alle cellule dopo 24 h. Per Xistδ: MECP2/XIST: MECP2-GFP MEFs, aggiungere mezzo integrato con XCIFs inibitori (ad esempio, 0,5 μm LDN193189 e 2,5 μm GSK650394), o veicolo da solo. Sostituire il mezzo con un nuovo inibitore o un veicolo da solo ogni 2 giorni. Per MECP2/MECP2-GFP e XIST-MECP2/Y MEFs, aggiungere un mezzo fresco ogni 2 giorni.
  3. Post 1 settimana di trattamento con inibitori, raccogliere MEF sia per l'isolamento dell'RNA (6-pozzetto piastra) o fissare le cellule per immunofluorescenza (diapositive camera). Utilizzare i MEF isolati da embrioni MECP2/MECP2-GFP come embrioni positivi e XIST-MECP2/Y come controlli negativi rispettivamente.
    1. Per l'isolamento dell'RNA, isolare l'RNA totale dal reagente di estrazione dell'RNA basato su tiocianato di guanidinio e trascrittasi inversa utilizzando la trascriptasi inversa. Misurare l'espressione MECP2-GFP in base alla PCR trascrittasi inversa quantitativa (qRT-PCR) utilizzando MECP2-WT e MECP2-GFP e i primer elencati nella tabella 1, come descritto in precedenza12.
    2. Per immunofluorescenza, macchia MEFs con un anticorpo primario anti-GFP (1:100), come descritto in precedenza12,16. Misurare l'intensità di GFP per immunofluorescenza quantitativa nel farmaco trattato con Xistδ: MECP2/XIST: MECP2-GFP MEFs, come descritto in precedenza18.

6. dimostrare la riattivazione farmacologica di XI nel cervello del Xistδ: MECP2/XIST: MECP2-GFP modello del mouse

  1. Preparare i farmaci e il controllo del veicolo.
    1. Preparare una soluzione fresca e sterile di veicolo (0,9% NaCl, 0,5% metilcellulosa, 4,5% dimetilsolfossido [DMSO]) per iniezioni cerebrali.
    2. Preparare gli inibitori chimici tra cui 1,5 mM LDN193189 (piccolo inibitore di molecola di ACVR1) e 1,6 mM GSK650394 (piccolo inibitore di molecola di SGK1, un Effettuatore a valle di PDPK1) risospeso nel veicolo (0,9% NaCl, 0,5% metilcellulosa, 4,5% DMSO), o veicolo soltanto. Il volume totale di inibitori chimici o di veicoli iniettati è di 10 μL per dose per animale.
  2. Preparare l'animale per iniezioni di cervello.
    1. Preparare l'area chirurgica asciugando il banco e il tampone riscaldante con disinfettante (soluzione di ipoclorito di sodio al 10%).
    2. Anestetizzare il topo di 4 settimane con un'iniezione intraperitoneale della miscela di chetamina/xylazina alla dose di 140 mg/kg e 10 mg/kg, rispettivamente. Utilizzare il riflesso di prelievo del pedale per determinare il livello di anestesia.
    3. Applicare unguento oftalmico agli occhi dopo induzione di anestesia per prevenire l'essiccazione corneale.
    4. Rasare la pelliccia dal collo alla parte superiore della testa del mouse.
    5. Posizionare il mouse nella piattaforma stereotassica agganciando i denti incisivi del mouse nella barra del morso del blocco del muso e stringendo il morsetto del naso sopra il muso, assicurando che la testa del mouse sia su un piano di livello.
    6. Regolare l'altezza delle barre dell'orecchio, se necessario, per raggiungere la porzione caudale del canale uditivo, assicurandole tale che la testa del mouse sia in un piano di livello e immobilizzata sul tocco delle dita.
    7. Disinfettare la testa del topo con salviette alterne di un antisettico d'attualità, come povidone-iodio e 70% etanolo.
  3. Somministrare farmaci.
    1. Utilizzando un bisturi sterile, fare un'incisione orizzontale di 0,75 cm nella metà del cuoio capelluto.
    2. Utilizzando una bava da 0,45 mm, praticare due fori simmetrici sopra gli emisferi corticali destro e sinistro (2 mm dalla sutura sagittale e 2 mm dalla sutura lambdoide, approssimativamente la metà dell'osso parietale).
    3. Fissare saldamente una siringa da 10 μL alla piattaforma stereotassica.
    4. Miscelare la soluzione di inibitori chimici e aspirare 10 μL di soluzione nella siringa. Evitare eventuali bolle d'aria nella siringa.
    5. Far avanzare l'ago della siringa nel buco del Burr mantenendo l'ago perpendicolare (90 °) al cranio. Quando l'ago attraversa il cranio, azzerare le coordinate sul display digitale stereotassico e poi avanzare la punta dell'ago fino a raggiungere una profondità di 2,5 mm.
    6. Prelevare l'ago 0,5 mm alla profondità per 2 mm.
    7. Iniettare lentamente 10 μL di soluzione (~ 1 min). Dopo l'iniezione è completa, lasciare l'ago nel cervello per ~ 1 min e quindi prelevare l'ago.
    8. Ripetere l'iniezione per il secondo emisfero (controllo solo veicolo).
    9. Utilizzando suture o "colla cutanea" chiudere la pelle del topo (se la ferita è > 0.5 cm devono essere usate entrambe le suture e "colla cutanea").
    10. Allentare le barre auricolari e rimuovere il mouse dall'apparato stereotassivo.
    11. Somministrare analgesici (buprenorfina SR 0,5 mg/kg IP) e posizionare il mouse su un tampone riscaldante impostato a 37 ° c fino a quando l'animale riprende coscienza.
    12. Una volta che il mouse è vigile e reattivo, trasferire l'animale torna alla sua gabbia originale.
    13. Ripetere la procedura ogni 2 giorni per 20 giorni. La foratura ripetuta dell'area non è necessaria per le successive iniezioni.
  4. Isolare il cervello del topo.
    1. Una volta completato il regime posologico, eutanasia il topo in una camera co2 .
    2. Immobilizzare il mouse su una superficie utilizzando aghi.
    3. Fare un'incisione laterale attraverso l'tegumento e la parete addominale appena sotto la gabbia toracica utilizzando forbici e pinze. Separare accuratamente il fegato dal diaframma.
    4. Utilizzando le forbici, tagliare il diaframma e continuare a tagliare lungo l'intera lunghezza della gabbia toracica per esporre la cavità pleurica.
    5. Usando le forbici, fai un'incisione all'estremità posteriore del ventricolo sinistro.
    6. Immediatamente, iniziare a iniettare la camera cardiaca a destra con ~ 15 mL di PBS oltre ~ 2 min. il cambiamento di colore del fegato dal rosso al rosa pallido è indicativo di una buona perfusione.
    7. Iniettare la camera giusta del cuore del topo con ~ 10 mL di 4% paraformaldeide in PBS su ~ 2 min.
    8. Decapitate il mouse e usate le forbici per fare un'incisione della linea mediana del cuoio capelluto per esporre il cranio.
    9. Posiziona una punta delle forbici nel foramen magnum e tagliale lateralmente nel cranio verso l'occhio. Ripeti per l'altro lato. Cercate di mantenere la fine delle forbici il più superficiale possibile per evitare lesioni del cervello.
    10. Utilizzare le forbici per tagliare la regione tra gli occhi e sopra il naso del mouse.
    11. Utilizzare pinze per sbucciare delicatamente le ossa craniali dagli emisferi cerebrali.
    12. Sollevare il cervello con una spatola, e utilizzare le forbici per sezionare attentamente le fibre nervose craniali che fissano al cranio.
    13. Posiziona il cervello su un piatto di plastica, Ritaglia il cervelletto e le lampadine olfattive e posiziona il cervello in un tubo da 15 mL riempito con il 4% di PFA è PBS.
  5. CRIO-sezione il cervello del topo.
    1. Fissare il cervello in 4% paraformaldeide in PBS a 4 ° c durante la notte.
    2. Sciacquare il cervello con PBS a 4 ° c almeno 3x per 5 min ciascuno.
    3. Etichettare gli stampi monouso per la criopreservazione dei tessuti.
    4. Tagliare la parte anteriore del cervello utilizzando forbici e pinze (iniziare a fare ~ sezioni di 5 mm da siti di iniezione).
    5. Trasferire il cervello al criomantico con la parte anteriore del cervello rivolta verso il basso per ottenere sezioni coronali. Immergere lo stampo contenente il cervello nel composto di temperatura di taglio ottimale (OCT).
    6. Versare l'azoto liquido in una capsula di Petri in plastica da 10 mm e collocare il cervello nel crio-stampo nell'azoto.
      Nota: È importante orientare il tessuto come descritto nel passo 6.5.5 per guidare il sezionamento del cervello.
    7. Quando il OCT è bianco fisso, posizionare il cervello congelato in un congelatore-80 ° c per la conservazione.
    8. Equilibrare il cervello a-20 ° c per almeno 30 minuti prima del sezionamento con criostato e criosezione (spessore 5 − 6 μm) del cervello, montaggio 2 − 3 sezioni per diapositiva. I vetrini possono essere conservati a-80 ° c per un uso successivo.
  6. Determinare la riattivazione di XI utilizzando un approccio basato su immunofluorescenza.
    1. Prima di iniziare la procedura di colorazione, asciugare le sezioni cerebrali durante la notte a 4 ° c.
    2. Immergere i vetrini nella soluzione di recupero dell'antigene (0,1 acido citrico M, 0,1 M Tris-base, pH = 6,0) su un blocco di calore di 100 ° c per 5 min.
    3. Lavare i vetrini 4x con 1x PBS per 5 min ciascuno a temperatura ambiente.
    4. Immergere i vetrini nella soluzione di bloccaggio (0,1 M NH4CL/PBS/0,2% gelatina/0,05% tensioattivo non ionico) per 20 minuti a temperatura ambiente.
    5. Lavare i vetrini 3x con tampone di lavaggio (PBS/0,2% gelatina) a temperatura ambiente per 5 min ciascuno.
    6. Sezioni del cervello macchia con anticorpi anti-GFP-AlexaFluor647 (1:100) e anti-MAP2 (1:1000) nel mezzo di incubazione (PBS/0,2% gelatina/1% BSA) e incubare a 4 ° c durante la notte.
    7. Raccogliere gli anticorpi primari (possono essere riutilizzati). Lavare i vetrini 4x con tampone di lavaggio per un totale di 30 min a temperatura ambiente.
    8. Incubare sezioni cerebrali con capra anti-pollo fluoresceina isotiocianato (FITC)-etichettato anticorpo secondario (1:1000) in incubazione di mezzo e incubare 1 − 2 h a temperatura ambiente al buio.
    9. Lavare i vetrini 4x con tampone di lavaggio per un totale di 30 min a temperatura ambiente.
    10. Posizionare una goccia di supporto di montaggio con 4 ′, 6-diamidino-2-phenylindole (DAPI) su un coprioggetti da 22 mm x 50 mm, quindi invertire il coprioggetti sul vetrino, coprendo tutte le sezioni di tessuto.
    11. Immagine al microscopio e regolare le immagini per contrasto e luminosità. Cattura le immagini e quantifica il numero di cellule positive di GFP sia per il trattamento farmacologico che per il veicolo trattato con Xistδ: MECP2/XIST: MECP2-GFP emisferi cerebrali del topo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Per dimostrare la fattibilità del modello di mouse Xistδ: MECP2/XIST: MECP2-GFP per gli studi di riattivazione XI, la riattivazione xcif inibitore-mediata di XI-Linked MECP2-GFP è stata testata nei fibroblasti embrionali di topo (MEFs). I MEF femminili sono stati isolati dal giorno 15,5 Xistδ: MECP2/XIST: MECP2-GFP embrioni come descritto nella sezione 3 (Figura 1a). I genotipi di Xistδ femminile: MECP2/XIST: MECP2-GFP MEFs sono stati confermati dalla GENOTOTIPIZZAZIONE-PCR, come descritto in precedenza19 (Figura 1B) e saggio basato su FACS (Figura 1C). I MEF sono stati trattati sia con DMSO che con i due farmaci LDN193189 e GSK650394 (rispettivamente 0,5 μM e 2,5 μM) per 7 giorni. Dopo il trattamento farmacologico, l'espressione di MECP2-GFP è stata monitorata da QRT-PCR. Come mostrato nella Figura 1D, il trattamento farmacologico, ma non DMSO, riattivato espressione di XI-MECP2-GFP. Successivamente, è stata effettuata l'immunofluorescenza quantitativa per determinare l'estensione dell'espressione XI-MECP2-GFP nei singoli MEF, come descritto al punto 5.3.2. Segnale da MEFs di controllo negativo isolato da embrioni maschi (MECP2/Y) è stato impostato come sfondo, e ~ 66% di controllo positivo MECP2-GFP/MECP2 MEFs ha avuto un segnale nucleare GFP. Come previsto, Xistδ: MECP2/XIST: MECP2-GFP MEFs trattati con DMSO aveva un livello molto basso di GFP nucleare (~ 3%). Al contrario, ~ 31% di Xistδ trattati con farmaci: MECP2/XIST: MECP2 MEFs sono stati positivi per il nucleare GFP (Figura 1e). Insieme, questi risultati dimostrano che gli inibitori XCIF riattivano i MECP2 collegati a XI in MEFs, ma l'estensione della riattivazione di XI varia nella popolazione cellulare.

Per valutare la fattibilità di un approccio farmacologico XI basato sulla riattivazione in vivo, se il trattamento farmacologico riattiva i MECP2 collegati a XI nel cervello di Xistδ: MECP2/XIST: MECP2-GFP femmina topi è stato studiato. 10 μL di veicolo o 10 μL di inibitori XCIF (1,5 mM LDN193189 e 1,6 mM GSK650394) sono stati somministrati in emisferi cerebrali opposti di topi femminili XI-MECP2-GFP di 4 settimane mediante iniezione intracerebroventricolare utilizzando procedure chirurgiche stereotassiche ( Figura 2a , B). La procedura è stata ripetuta ogni secondo giorno (Figura 2C), e tre settimane dopo, gli animali sono stati eutanizzati, e il cervello è stato isolato. Un sottoinsieme è stato utilizzato per qRT-PCR e un altro è stato analizzato da immunoistochimica. L'espressione di Wild-Type MECP2 e XI-MECP2-GFP negli emisferi infusi da veicoli e farmaci è stata determinata dalla QRT-PCR (sequenze di primer elencate nella tabella 1). Come mostrato nella Figura 2D, il trattamento farmacologico ha riattivato XI-MECP2-GFP in ~ 30% delle cellule nell'emisfero cerebrale infuso di droghe, mentre XI- MECP2-GFP non è stato rilevato nell'emisfero infuso del veicolo. Un gran numero di MAP2, un marcatore neuronale, i neuroni positivi sono stati anche positivi GFP (~ 45%) nell'emisfero trattato con farmaci, indicativo dell'espressione XI-MECP2-GFP . Circa il 20% delle cellule cerebrali MAP2 negative ha espresso GFP, confermando la riattivazione di XI-MECP2-GFP in cellule non neuronali (Figura 2e).

Figure 1
Figura 1: generazione e convalida modello di mouse XI-MECP2 . A) schema della strategia di allevamento per la generazione di Xistδ: MECP2/XIST: MECP2-GFP topi. B) genotipizzazione della PCR di XIST: MECP2-GFP/Y, xistδ: MECP2/XIST: MECP2 e Xistδ: MECP2/XIST: MECP2-GFP topi. I topi sono stati monitorati per la presenza di MECP2-GFP, MECP2 e regione di determinazione del sesso Y (SRY). (C) analisi della citometria a flusso dei nuclei isolati dalla corteccia del topo. MECP2/MECP2-GFP mouse Cortex show ~ 50% dei nuclei GFP-positivi mentre Xistδ: MECP2/XIST: MECP2-GFP non Mostra nuclei GFP-positivi. D) analisi QRT-PCR che monitora l'espressione di MECP2-GFP e trascrizioni MECP2 Wild-Type in Xistδ femminile: MECP2/XIST: MECP2-GFP MEFs dopo il trattamento con DMSO o farmaco (LDN193189 e GSK650394). GAPDH è stato monitorato come controllo di carico. E) monitoraggio quantitativo di immunofluorescenza intensità GFP in femmina Xistδ: MECP2/XIST: MECP2-GFP MEFs dopo il trattamento con DMSO o i farmaci LDN193189 e GSK650394. I MEF isolati dai topi MECP2/Y o MECP2/MECP2-GFP sono stati utilizzati rispettivamente come controlli negativi e positivi. Ogni punto rappresenta un MEF, e la linea tratteggiata indica il segnale di fondo massimo ottenuto in MECP2/Y, che è stato impostato su 1. Il pannello inferiore mostra le immagini rappresentative dei nuclei. Questa cifra è stata modificata da Przanowski et al.16. Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Figure 2
Figura 2: riattivazione farmacologica di MECP2 X-linked nei neuroni corticali cerebrali dei topi viventi. (A) schema di un cranio del topo e (B) cervello che mostra il sito di iniezione per veicolo o farmaco negli emisferi sinistro o destro del cervello. C) schema del regime farmacologico. D) immagini rappresentative di immunofluorescenza che mostrano un segnale GFP endogeno (verde) nelle sezioni cerebrali coronali da emisferi trattati con veicoli o farmaci. La colorazione DAPI è mostrata in blu. E) immagini rappresentative di immunofluorescenza delle sezioni cerebrali coronali che monitorano l'espressione di GFP (anti-GFP; rosso) e MAP2 (verde) nell'emisfero trattato con farmaci. La colorazione DAPI è mostrata in blu. Questa cifra è stata modificata da Przanowski et al.16. Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Primer inverso (5'-> 3') Temperatura di anealing/lunghezza del prodotto PCR
Altro da GGCATGGACTGTGGTCATGAG 60 ° c/87 BP
Di GCTGAACTTGTGGCCGTTTA 62 ° c/137 BP
Altro da TGTCAGAGCCCTACCCATAAG 62 ° c/140 BP
Altro da GCACAACCCCGCAAATGCTA 62 ° c/364 BP
Altro da GCACAACCCCGCAAATGCTA 62 ° c/250 BP
Altro da AATTGCCCTAACGAGCACAC 62 ° c/436 BP
Altro da GAACTTCAGGGTCAGCTTGC 62 ° c/217 BP
Il CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 BP

Tabella 1: elenco dei primer utilizzati per la genotipizzazione e la RT-PCR quantitativa in tempo reale.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In precedenza, gli Xcif che sono selettivamente necessari per il silenziamento dei geni collegati a Xi nelle cellule femminili di mammiferi sono stati identificati12. Abbiamo ulteriormente ottimizzato potenti inibitori di piccole molecole per indirizzare gli Xcif, come ACVR1 e gli effettori a valle di PDPK1, che riattivano in modo efficiente i MECP2 collegati a Xi nelle linee cellulari di fibroblasti del topo, i neuroni corticali del topo e una cellula fibroblastica umana una linea derivata da un paziente RTT. Questi risultati suggeriscono che la riattivazione di XI è un approccio terapeutico plausibile per salvare le carenze genetiche nei pazienti affetti da malattia legata alla X; Tuttavia, la fattibilità in vivo resta da determinare. Recentemente, gli inibitori di XCIF hanno dimostrato di riattivare il MECP2 in vivo di XI-linked, per il quale è stato generato un modello di mouse Xistδ: MECP2/XIST: MECP2-GFP non casuale.

Una caratteristica interessante del modello Xistδ: MECP2/XIST: MECP2-GFP è che consente una quantificazione accurata della riattivazione MECP2 legata a XI per diversi motivi. In primo luogo, a causa della cancellazione di XIST sul cromosoma X materno, il mouse Xistδ: MECP2/XIST: MECP2-GFP ha XCI non casuali. Di conseguenza, il MECP2 geneticamente etichettato è silenzioso nel 100% delle cellule (Figura 1C), a differenza di una prevista 50:50 espressione di geni X-linked in modelli di topi XCI casuali, come XIST: MECP2/XIST: MECP2-GFP. Pertanto, i risultati non sono preclusi dall'espressione mosaica di GFP, e il 100% delle cellule trasporta MECP2-GFP su XI nel modello xistδ: MECP2/XIST: MECP2-GFP . In secondo luogo, l'etichettatura genetica di MECP2 consente la visualizzazione diretta dei singoli neuroni con GFP riattivato, minimizzando così le manipolazioni sperimentali nell'analisi neuronale.

Uno studio recente ha trovato che l'iniezione intracerebroventricolare degli inibitori XCIF nell'emisfero cerebrale del topo riattiva la MECP2 collegata a XI utilizzando l'analisi immunofluorescenza del cervello del topo16. È importante sottolineare che il trattamento farmacologico non ha avuto effetti negativi sulla salute generale, come il peso, la toelettatura o la mobilità16. Inoltre, non vi è alcuna tossicità rilevata dal trattamento farmacologico nel fegato o nella milza. Insieme, questo studio fornisce una prova di principio essenziale per dimostrare che interferire con la funzione degli Xcif conduce alla derepressione di XI in vivo.

In sintesi, un modello di mouse sensibile può essere utilizzato per valutare la riattivazione di XI. Questo modello animale può anche essere adattato per generare un modello di topo RTT migliorato che porti MECP2 mutazioni (probabilmente meno sintomatiche) sul cromosoma X attivo e Wild-Type MECP2 sul XI in tutte le cellule. A causa di XCI non casuali, mentre i sintomi fenotipici possono essere più pronunciati, si prevede che questo modello consentirà anche una migliore valutazione e una valutazione accurata dell'inversione dei sintomi a causa della riattivazione di XI. Inoltre, Xistδ: MECP2/XIST: MECP2-GFP può anche essere modificato per studiare la riattivazione di XI in altri modelli di malattia legata alla X, come la sindrome di DDX3X.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Gli autori ringraziano Antonio Bedalov per aver fornito reagenti; Università di Virginia tessuto istologia nucleo per criosettioning; Università di Virginia flusso citometria nucleo per analisi di citometria a flusso; Christian Blue e saloni Singh per l'assistenza tecnica con la genotipo. Questo lavoro è stato sostenuto da una sovvenzione di ricerca Double Hoo a Z.Z., e da un premio del programma di progetto pilota dell'Università di Virginia-Virginia Tech Seed Fund Award e dal premio individuale di ricerca biomedica di Hartwell Foundation a ente

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics