Un modelo de ratón no aleatorio para la reactivación farmacológica de Mecp2 en el cromosoma X inactivo

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí describimos un protocolo para generar un modelo murino femenino viable con inactivación cromosómica no aleatoria, es decir, el cromosoma X de herencia maternalmente está inactivo en el 100% de las células. También describimos un protocolo para probar la viabilidad, la tolerabilidad y la seguridad de la reactivación farmacológica del cromosoma X inactivo in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La inactivación del cromosoma x (XCI) es el silenciamiento aleatorio de un cromosoma X en las hembras para lograr el equilibrio de dosis genéticas entre los sexos. Como resultado, todas las hembras son heterocigósas para la expresión génica ligada al X. Uno de los reguladores clave de XCI es Xist, que es esencial para el inicio y mantenimiento de XCI. Estudios previos han identificado 13 factores de inactivación cromosómica de acción trans (XCIFs) que utilizan una pantalla genética de pérdida de función a gran escala. La inhibición de XCIFs, como ACVR1 y PDPK1, mediante el uso de ARN de horquilla corta o de inhibidores de moléculas pequeñas, reactiva los genes relacionados con los cromosomas X en las células cultivadas. Pero la viabilidad y tolerabilidad de reactivar el cromosoma X inactivo in vivo queda por determinar. Hacia este objetivo, se ha generado un modelo de ratón Xistδ: MECP2/Xist: MECP2-GFP con XCI no aleatorio debido a la eliminación de Xist en un cromosoma X. Usando este modelo, la extensión de la reactivación X inactiva fue cuantitada en el cerebro del ratón después del tratamiento con inhibidores de XCIF. Los resultados publicados recientemente muestran, por primera vez, que la inhibición farmacológica de XCIFs reactiva el Mecp2 del cromosoma X inactivo en las neuronas corticales del cerebro viviente del ratón.

Introduction

La inactivación del cromosoma x (XCI) es un proceso de compensación de dosis que equilibra la expresión génica ligada al X mediante el silenciamiento de una copia del cromosoma X en las hembras1. Como resultado, el cromosoma X inactivo (XI) acumula rasgos característicos de la heterocromatina, incluyendo la metilación del ADN y las modificaciones de la histona inhibitoria, tales como histona H3-lisina 27 trimetilación (H3K27me3) e histona H2A ubiquitinación (H2Aub) 2. el regulador maestro del silenciamiento cromosómico x es la región centro de inactivación x (XIC), alrededor de 100-500 KB, que controla el conteo y emparejamiento de los cromosomas x, la elección aleatoria del cromosoma x para la inactivación, y la iniciación y propagación del silenciamiento a lo largo del cromosoma X3. El proceso de inactivación X se inicia mediante una transcripción específica X inactiva (Xist) que recubre el XI en CIS para mediar el silenciamiento de todo el cromosoma y la remodelación de la estructura tridimensional del cromosoma X4. Recientemente, varias pantallas proteómicas y genéticas han identificado reguladores adicionales de XCI, como las proteínas de interacción Xist 5,6,7,8,9 , 10 , 11 , 12. por ejemplo, un estudio anterior que utiliza una pantalla de interferencia de ARN no sesgada de todo el genoma identificó 13 factores de XCI de acción Trans(xcifs)12. Mecaniísticamente, XCIFs regula la expresión Xist y, por lo tanto, interferir con la función xcifs causa XCI12defectuoso. En conjunto, los avances recientes en el campo han proporcionado información importante sobre la maquinaria molecular necesaria para iniciar y mantener la XCI.

La identificación de los reguladores de XCI y la comprensión de su mecanismo en XCI es directamente relevante para las enfermedades humanas vinculadas a X, como el síndrome de rett (RTT)13,14. El RTT es un trastorno raro del desarrollo neurológico causado por una mutación heterocigosa en la proteína de unión al metil-CpG 2 ligada al X (MECP2) que afecta predominantemente a las niñas15. Debido a que el MECP2 se encuentra en el cromosoma X, las niñas RTT son heterocigosas para la deficiencia de MECP2 con ~ 50% de células que expresan el tipo salvaje y ~ 50% expresan un mutante MECP2. En particular, las células mutantes RTT albergan una copia inactiva pero de tipo salvaje de Mecp2 en el XI, proporcionando una fuente del gen funcional, que si se reactiva, podría aliviar los síntomas de la enfermedad. Además del RTT, hay varias otras enfermedades humanas vinculadas al X, para las que la reactivación de XI representa un posible enfoque terapéutico, como el síndrome de DDX3X.

La inhibición de XCIFs, proteína de 3-fosfoinositida dependiente quinasa-1 (PDPK1), y Activin un receptor tipo 1 (ACVR1), ya sea por el ARN corto del pelo (shRNA) o inhibidores de moléculas pequeñas, reactiva los genes XI-vinculados12. La reactivación farmacológica de genes XI-ligados se observa en varios modelos ex vivo que incluyen líneas celulares de fibroblastos de ratón, neuronas corticales de ratones adultos, fibroblastos embrionarios de ratón y líneas celulares de fibroblastos derivadas de un paciente RTT12. Sin embargo, queda por demostrar si la reactivación farmacológica de los genes vinculados con XI es factible in vivo. Un factor limitante es la falta de modelos animales efectivos para medir con precisión la expresión de los genes de la reactivada XI. Hacia este objetivo, se ha generado un Xistδ: MECP2/Xist: modelo de ratón MECP2-GFP que lleva un MECP2 genéticamente etiquetado en XI en todas las células debido a la deleción Heterocigosa en Xist en el cromosoma X materno16. Usando este modelo, la expresión de Mecp2 de XI se ha cuantitado después del tratamiento con inhibidores de xcifs en el cerebro de los ratones vivos. Aquí se describe la generación de xistδ: MECP2/Xist: modelo de ratón MECP2-GFP y metodología para la reactivación de cuantificar XI en neuronas corticales utilizando ensayos basados en inmunofluorescencia.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

El trabajo relacionado con ratones fue aprobado por el Comité institucional de cuidado y uso de animales de la Universidad de Virginia (IACUC; #4112).

1. genere un modelo de ratón XCI no aleatorio con el Mecp2 genéticamente etiquetado en XI

Nota: Las cepas de ratón utilizadas en el estudio fueron las siguientes: MECP2-GFP/MECP2-GFP (MECP2TM 3.1 Bird, tabla de materiales) y Xist/δxist (B6; 129-Xist < tm5Sado >; proporcionada por Antonio bedalov, Fred Centro Oncológico Hutchinson, Seattle). Las estrategias de cría entre las respectivas cepas han sido diseñadas para expandir las colonias de ratones para cada cepa.

  1. Realizar genotipado por PCR en todas las cepas de ratones y los respectivos progenies obtenidos después de la cría utilizando imprimadores específicos de genes enumerados en la tabla 1.

2. Diseñe la estrategia de reproducción del ratón para generar Xistδ: MECP2/Xist: MECP2-GFP

  1. Establecer un par de cría por la vivienda de un Mecp2-GFP/Y macho y un XistΔ-Mecp2/Xist-Mecp2 hembra juntos (12 h/12 h: ciclo claro/oscuro) (figura 1A). Idealmente, establecer por lo menos 5 parejas reproductoras a la vez utilizando ratones viables y fértiles. Después de que la hembra embarazada da a luz, le permite levantar su primera camada con el macho.
    Nota: Debido a que el Xist Knockout paterno deteriora la XCI impresa, la compensación de dosificación y las vías de diferenciación17, el uso de ratones xistδ-Mecp2/Y en la cría no producirá las crías femeninas con el genotipo requerido.
  2. Después de destetar la camada en el día 21 (p21) post-natal, identifique y etiquete las crías de la hembra Xistδ: MECP2/Xist: MECP2-GFP utilizando un ensayo de genotipado basado en PCR (figura 1B).
    Nota: En cuanto al número de animales necesarios por grupo, para los resultados que se indican a continuación, se configuraron 5 pares reproductoras que generaron aproximadamente 10 hembras Xistδ: MECP2/Xist: los ratones MECP2-GFP .
  3. Utilice modelos de ratón hembra para todos los experimentos propuestos.
    Nota: El sexo es una variable biológica importante para los estudios de XCI, y el modelo masculino no tiene en cuenta los efectos de confusión del XCI aleatorio.
  4. Para ser consistente a lo largo de los estudios en animales y descartar cualquier efecto de la edad animal, realizar todos los experimentos en 5-8-semana-edad hembra Xistδ: MECP2/Xist: los ratones MECP2-GFP .

3. aislar la hembra Xistδ: MECP2/Xist: fibroblastos embrionarios de ratón de Mecp2-GFP (MEFS)

  1. Configure el acoplamiento cronometrado entre la hembra MECP2-GFP/y macho y xistδ-Mecp2/Xist-MECP2 . Configurar por lo menos 3 − 4 jaulas de acoplamiento para aumentar la probabilidad de embarazo.
  2. Después de confirmar el tapón vaginal la mañana después del apareamiento, separar la hembra y este día se considera embrionario día 0,5 (E 0.5). Monitorear el aumento de peso de la futura hembra embarazada y inspeccionar visualmente el abdomen de los ratones para confirmar el embarazo. En E 14.5 − 15.5, eutanasia a las hembras embarazadas a través de la dislocación cervical.
  3. Bajo una capucha laminar, limpie el abdomen de la hembra embarazada con etanol al 70%. Con tijeras estériles, diseccionar la cavidad abdominal y extraer los cuernos uterinos que contengan los embriones. Usando fórceps, retire suavemente los embriones mientras se corta el tejido abdominal restante (6 − 12 embriones por lo general se espera).
  4. Coloque los cuernos uterinos que contengan los embriones en un plato de cultivo de tejido de 10 mm. Usando tijeras y fórceps estériles, haga una incisión a lo largo de los cuernos uterinos para aislar los sacos individuales que llevan un embrión. Con cuidado, coloque los cuernos uterinos que contengan el resto de los embriones en 30 mL de solución de sal equilibrada (HBSS) estéril de Hanks sobre hielo.
  5. Cortar suavemente abrir el saco y aislar el embrión usando tijeras y fórceps estériles. Retira la placenta cortando el cordón umbilical.
  6. Decapitar el embrión.
    Nota: Mientras que el resto del tejido embrionario será procesado más adelante, el tejido de la cabeza del embrión será utilizado para aislar el ADN para el genotipado.
  7. Abra el abdomen cortando la línea media del embrión usando tijeras y fórceps estériles. Retira los órganos viscerales, como el corazón, el hígado y los pulmones.
  8. Transfiera el tejido embrionario restante a una placa de cultivo de tejido estéril de 60 mm y córtela en trozos pequeños usando tijeras o una cuchilla de afeitar. Para abrir los grumos celulares, añadir 3 mL de tripsina-EDTA (0,05%) e incubar a 37 ° c durante 15 min.
  9. Neutralizar tripsina-EDTA añadiendo 5 mL de medio de águila modificada de Dulbecco (DMEM) con un 10% de suero bovino fetal (FBS) y 10 μg/mL de penicilina/estreptomicina (Pen/estreptococo) a la placa y disociar el tejido mediante pipeteo repetitivo (aproximadamente 20 − 30 veces).
  10. Gire las células a 300 x g durante 5 min y vuelva a suspender el pellet de células en 4 ml de DMEM con 10% de FBS y 10 μg/ml de pluma/estreptococo. Placa las células en un plato de cultivo de 60 mm, y cultivo de las células a 37 ° c en presencia de 5% CO2.
  11. Lleve a cabo los pasos 3.5 − 3.10 para cada embrión.
  12. Cultura MEFs obtenida en el paso 3,11 durante al menos 3 − 4 días.
    Nota: En esta etapa, los MEFs también pueden ser crioreservados para futuros experimentos.
  13. Para determinar el sexo y el genotipo de cada embrión, llevar a cabo genotipado-PCR utilizando ADN aislado de las cabezas de los embriones utilizando cebadores y condiciones de PCR enumeradas en la tabla 1.

4. Confirme la falta de expresión de proteína fluorescente verde (GFP) en el cerebro de Xistδ: los ratones MECP2/Xist: MECP2-GFP que utilizan un ensayo basado en la clasificación de células activadas por ffluorescencia

  1. Usando tijeras, separe la corteza cerebral del resto de los hemisferios cerebrales, y colóquelo en 1 mL de tampón de medio de aislamiento de núcleos fríos (NIM) que contenga una sacarosa de 250 mM, cloruro de potasio de 25 mM (KCl), cloruro de magnesio de 5 mM (MgCl2), Tris-cl de 10 mm, complementado con 2% de paraformaldehído (PFA), y 0,1% surfactante no iónico (tabla de materiales).
  2. Homogeneizar con un homogenizador de vidrio frío-hielo.
  3. Gire hacia abajo el tejido homogeneizado a 600 x g, 4 ° c durante 5 min.
  4. Quitar el sobrenadante y el pellet de resuspendio en 1 mL de un 25% de iodixanol en la solución NIM.
  5. Añadir 1 ml de un 29% de lodixanol en la solución Nim a un tubo de ultracentrífuga de 4 ml (conservar en hielo hasta que las muestras estén listas) y cuidadosamente la capa de 1 ml de muestra (en un 25% de lodixanol).
  6. Centrifugar a 9.000 x g, 4 ° c durante 10 min en una ultracentrifuge.
  7. Aspirar el sobrenadante y el pellet de resuspendio en 500 μL de tampón de separación de células activadas por fluorescencia (FACS) (solución salina amortiguada con fosfato [PBS] suplementado con 1 mM EDTA, 0,05% azida sódica y 2% albúmina sérica bovina [BSA]).
    Nota: Las muestras se pueden almacenar a 4 ° c o hasta 1 semana.
  8. Añadir 5 μL de 7-amino-actinomicina D (7-AAD; 50 mg/mL) durante 5 min a temperatura ambiente para manchar el ADN.
  9. Analice muestras para la señal de 7-AAD y proteína fluorescente verde (GFP) utilizando citometría de flujo.

5. Determine la viabilidad del modelo de ratón Xistδ: MECP2/Xist: MECP2-GFP para la reactivación XI

  1. Semilla 1 x 105 células/ml hembra xistδ: Mecp2/Xist: Mecp2-GFP MEFS, Mecp2/Mecp2-GFP Y Xist-MECP2/y MEFS obtenida en el paso 3,12 en un formato de 6 pozo y en portaobjetos de cámara, en DMEM con 10% de FBS y 10 μg/ml de pluma/estreptococo 37, a presencia de 5% de CO2.
    Nota: Los MEFS MECP2/MECP2-GFP y Xist-MECP2/y se utilizan como controles positivos y negativos en los experimentos.
  2. Añadir un medio fresco a las células después de 24 h. Para Xistδ: MECP2/Xist: MECP2-GFP MEFS, añadir medio complementado con inhibidores de xcifs (p. ej., 0,5 μm LDN193189 y 2,5 μm GSK650394), o vehículo solo. Reemplace el medio complementado con un inhibidor fresco o un vehículo solo cada 2 días. Para MECP2/MECP2-GFP y Xist-MECP2/y MEFS, agregue un medio fresco cada 2 días.
  3. Después de 1 semana de tratamiento inhibidor, cosechar MEFs para el aislamiento de ARN (placa de 6-Well) o fijar las células para la inmunofluorescencia (diapositivas de la cámara). Utilice MEFs aislados de embriones de MECP2/MECP2-GFP como embriones positivos y Xist-Mecp2/Y como controles negativos respectivamente.
    1. Para el aislamiento de ARN, aislar el ARN total del reactivo de extracción de ARN basado en el tiocianato de guanidinio, y transcribir inverso utilizando la transcriptasa inversa. Mida la expresión Mecp2-GFP mediante la transcriptasa-PCR inversa cuantitativa (QRT-PCR) utilizando MECP2-WT y MECP2-GFP, y los imprimadores enumerados en la tabla 1, como se describió anteriormente12.
    2. Para la inmunofluorescencia, mancha MEFS con un anticuerpo primario anti-GFP (1:100), como se describió anteriormente12,16. Mida la intensidad GFP por inmunofluorescencia cuantitativa en el fármaco tratado Xistδ: MECP2/Xist: MECP2-GFP MEFS, como se describió anteriormente18.

6. demostrar la reactivación farmacológica XI en el cerebro del Xistδ: MECP2/Xist: modelo de ratón MECP2-GFP

  1. Prepare medicamentos y controle el vehículo.
    1. Prepare una solución fresca y estéril del vehículo (0,9% NaCl, 0,5% metilcelulosa, 4,5% dimetilsulfóxido [DMSO]) para las inyecciones cerebrales.
    2. Preparar inhibidores químicos incluyendo 1,5 mM LDN193189 (inhibidor de molécula pequeña de ACVR1) y 1,6 mM GSK650394 (inhibidor de molécula pequeña de SGK1, un efector descendente de PDPK1) re-suspendido en vehículo (0,9% NaCl, 0,5% metilcelulosa, 4,5% DMSO), o vehículo Solo. El volumen total de inhibidores químicos o de vehículos inyectados es de 10 μL por dosis por animal.
  2. Prepare animales para inyecciones cerebrales.
    1. Prepare el área quirúrgica limpiando el Banco y la almohadilla térmica con desinfectante (solución de hipoclorito de sodio al 10%).
    2. Anestesiar el ratón de 4 semanas de edad con una inyección intraperitoneal de la mezcla de ketamina/xilazina a una dosis de 140 mg/kg y 10 mg/kg, respectivamente. Utilice el reflejo de retirada del pedal para determinar el nivel de anestesia.
    3. Aplicar ungüento oftálmico a los ojos después de la inducción de la anestesia para prevenir el secado corneal.
    4. Afeitarse el pelaje desde el cuello hasta la parte superior de la cabeza del ratón.
    5. Coloque el ratón en la plataforma estereotáctica enganchando los dientes incisivos del ratón en la barra de mordida del hocico y apretando la abrazadera de la nariz sobre el hocico mientras se asegura de que la cabeza del ratón está en un plano nivelado.
    6. Ajustar la altura de las barras del oído, según sea necesario, para llegar a la porción caudal del conducto auditivo, asegurándolos de tal manera que la cabeza del ratón está en un plano de nivel e inmovilizado en el tacto del dedo.
    7. Desinfectar la cabeza del ratón con toallitas alternas de un antiséptico tópico, como povidona-yodo y etanol al 70%.
  3. Administrar drogas.
    1. Usando un bisturí estéril, haz una incisión horizontal de 0,75 cm en el cuero cabelludo medio.
    2. Utilizando una rebaba de 0,45 mm, taladre dos orificios simétricos por encima de los hemisferios corticales derecho e izquierdo (2 mm de la sutura sagital y 2 mm de la sutura lambdoidea, aproximadamente la mitad del hueso parietal).
    3. Fije firmemente una jeringa de 10 μL a la plataforma estereotáctica.
    4. Mezclar la solución de inhibidores químicos y extraer 10 μL de solución en la jeringa. Evite las burbujas de aire en la jeringa.
    5. Avance la aguja de la jeringa en el orificio de rebabas manteniendo la aguja perpendicular (90 °) al cráneo. Cuando la aguja atraviesa el cráneo, cero las coordenadas en la pantalla digital estereotáctica y luego avanzar la punta de la aguja hasta que alcanza una profundidad de 2,5 mm.
    6. Retirar la aguja 0,5 mm a la profundidad de 2 mm.
    7. Inyectar lentamente 10 μL de solución (~ 1 min). Una vez completada la inyección, deje la aguja en el cerebro durante ~ 1 min y luego retire la aguja.
    8. Repetir la inyección para el segundo hemisferio (control de vehículo solamente).
    9. El uso de suturas o "pegamento de la piel" cerrar la piel del ratón (si la herida es > 0,5 cm tanto suturas y "pegamento de la piel" debe ser utilizado).
    10. Afloje las barras del oído y retire el ratón del aparato estereotáctico.
    11. Administrar analgésicos (buprenorphine SR 0,5 mg/kg IP) y colocar el ratón sobre una almohadilla térmica configurada a 37 ° c hasta que el animal recupere la consciencia.
    12. Una vez que el ratón esté alerta y sensible, transfiera el animal de vuelta a su jaula original.
    13. Repita el procedimiento cada 2 días durante 20 días. No es necesario repetir la perforación de la zona para las inyecciones posteriores.
  4. Aísla el cerebro del ratón.
    1. Una vez finalizada la pauta posológica, eutanasia al ratón en una cámara CO2 .
    2. Inmovilizar el ratón sobre una superficie con agujas.
    3. Haga una incisión lateral a través del integumento y la pared abdominal justo debajo de la caja torácica usando tijeras y fórceps. Separe cuidadosamente el hígado del diafragma.
    4. Usando tijeras, cortar el diafragma y continuar cortando a lo largo de toda la longitud de la caja torácica para exponer la cavidad pleural.
    5. Con las tijeras, haz una incisión en el extremo posterior del ventrículo izquierdo.
    6. Inmediatamente, comience a inyectar la cámara cardíaca derecha con ~ 15 mL de PBS sobre ~ 2 min. cambio de color del hígado de rojo a rosa pálido es indicativo de buena perfusión.
    7. Inyecte la cámara derecha del corazón del ratón con ~ 10 mL de paraformaldehído al 4% en PBS sobre ~ 2 min.
    8. Decapitar el ratón, y utilizar tijeras para hacer una incisión de la línea media del cuero cabelludo para exponer el cráneo.
    9. Coloque una punta de las tijeras en el foramen magnum, y corte lateralmente en el cráneo hacia el ojo. Repite para el otro lado. Trate de mantener el extremo de las tijeras lo más superficial posible para evitar lesiones en el cerebro.
    10. Utilice tijeras para cortar la región entre los ojos y por encima de la nariz del ratón.
    11. Usa fórceps para pelar suavemente los huesos craneales de los hemisferios cerebrales.
    12. Levante el cerebro con una espátula y use tijeras para diseccionar cuidadosamente las fibras nerviosas craneales que lo fijan al cráneo.
    13. Coloque el cerebro en un plato de plástico, corte el cerebelo y las bombillas olfativas, y coloque el cerebro en un tubo de 15 mL lleno de 4% de PFA es PBS.
  5. Cryo-Section el cerebro del ratón.
    1. Fije el cerebro en un 4% de paraformaldehído en PBS a 4 ° c durante la noche.
    2. Enjuague el cerebro con PBS a 4 ° c al menos 3x durante 5 min cada uno.
    3. Etiquete los moldes desechables para la criopreserva de los tejidos.
    4. Cortar la parte frontal del cerebro usando tijeras y fórceps (empezar a hacer ~ 5 mm secciones de sitios de inyección).
    5. Transfiera el cerebro al crimomoldeo con la parte frontal del cerebro hacia abajo para obtener secciones coronales. Sumerja el molde que contiene el cerebro en el compuesto de temperatura de corte óptimo (OCT).
    6. Vierta el nitrógeno líquido en una placa de Petri de plástico de 10 mm y coloque el cerebro en el criomoldeo en el nitrógeno.
      Nota: Es importante orientar el tejido como se describe en el paso 6.5.5 para guiar la seccionción del cerebro.
    7. Cuando la OCT es de color blanco sólido, coloque el cerebro congelado en un congelador de-80 ° c para almacenarse.
    8. Equilibrar el cerebro a-20 ° c durante al menos 30 minutos antes de la seccionamiento con criostato y cricosección (5 − 6 μm de espesor) del cerebro, montaje de 2 − 3 secciones por diapositiva. Las diapositivas se pueden almacenar a-80 ° c para su uso posterior.
  6. Determine la reactivación XI utilizando un enfoque basado en inmunofluorescencia.
    1. Antes de comenzar el procedimiento de tinción, seque las secciones cerebrales durante la noche a 4 ° c.
    2. Sumergir diapositivas en solución de recuperación de antígeno (0,1 M de ácido cítrico, 0,1 M Tris-base, pH = 6,0) en un bloque de calor de 100 ° c durante 5 min.
    3. Lave las diapositivas 4x con 1x PBS durante 5 min cada una a temperatura ambiente.
    4. Sumergir los portaobjetos en la solución de bloqueo (0,1 M NH4cl/PBS/0,2% gelatina/0,05% tensioactivo no iónico) durante 20 min a temperatura ambiente.
    5. Lavar las diapositivas 3x con tampón de lavado (PBS/0,2% gelatina) a temperatura ambiente durante 5 min cada uno.
    6. Manchas en las secciones cerebrales con anticuerpos anti-GFP-AlexaFluor647 (1:100) y anti-MAP2 (1:1000) en medio de incubación (PBS/0,2% de gelatina/1% de BSA) e incubar a 4 ° c durante la noche.
    7. Recoja los anticuerpos primarios (se pueden reutilizar). Lave las diapositivas 4x con el tampón de lavado durante un total de 30 minutos a temperatura ambiente.
    8. Incubar las secciones cerebrales con la cabra anti-pollo fluoresceina isotiocianato (FITC)-etiquetado secundario anticuerpo (1:1000) en medio de incubación e incubar 1 − 2 h a temperatura ambiente en la oscuridad.
    9. Lave las diapositivas 4x con el tampón de lavado durante un total de 30 minutos a temperatura ambiente.
    10. Coloque una gota de medio de montaje con 4 ′, 6-diamidino-2-Phenylindole (DAPI) en un recubrimiento de 22 mm x 50 mm, luego invierta el cubreobjetos en una diapositiva, cubriendo todas las secciones de tejido.
    11. Imagen en un microscopio y ajuste las imágenes para el contraste y el brillo. Capture imágenes y cuantifique el número de células GFP positivas tanto para el tratamiento con fármacos como para el tratamiento con el vehículo Xistδ: MECP2/Xist: los hemisferios cerebrales del ratón de Mecp2-GFP.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Para demostrar la viabilidad del modelo de ratón Xistδ: MECP2/Xist: MECP2-GFP para estudios de reactivación XI, se probó la reactivación por inhibidor de xcif del Mecp2-GFP de XI ligado en fibroblastos embrionarios de ratones (MEFS). Las MEFs femeninas se aislaron del día 15,5 Xistδ: MECP2/Xist: embriones de MECP2-GFP como se describe en la sección 3 (figura 1A). Los genotipos de la hembra Xistδ: MECP2/Xist: los MEFS de MECP2-GFP fueron confirmados por GENOTIPADO-PCR, como se describió anteriormente19 (figura 1B), y ensayo basado en FACS (figura 1C). Los MEFs fueron tratados con DMSO o con los dos fármacos LDN193189 y GSK650394 (0,5 μM y 2,5 μM, respectivamente) durante 7 días. Después del tratamiento farmacológico, la expresión de Mecp2-GFP fue monitoreada por la QRT-PCR. Como se muestra en la Figura 1D, el tratamiento farmacológico, pero no DMSO, la expresión reactivada de XI-Mecp2-GFP. A continuación, se llevó a cabo inmunofluorescencia cuantitativa para determinar la extensión de la expresión XI-Mecp2-GFP en los MEFS individuales, como se describe en el paso 5.3.2. La señal de los MEFs de control negativo aislados de embriones masculinos (MECP2/Y) se estableció como fondo, y ~ 66% del control positivo Mecp2-GFP/MECP2 MEFS tenía una señal GFP nuclear. Como era de esperar, Xistδ: MECP2/Xist: los MEFS de MECP2-GFP tratados con DMSO tenían un nivel muy bajo de GFP nuclear (~ 3%). Por el contrario, ~ 31% de Xistδ tratado con fármacos: MECP2/Xist: los MEFS de MECP2 fueron positivos para la GFP nuclear (Figura 1E). Juntos, estos resultados demuestran que los inhibidores de XCIF reactivan el Mecp2 ligado al XI en MEFS, pero la extensión de la reactivación XI varía en la población celular.

Para evaluar la viabilidad del enfoque farmacológico XI basado en la reactivación in vivo, si el tratamiento farmacológico reactiva el MECP2 ligado XI en el cerebro de xistδ: Mecp2/Xist: se investigó el ratón hembra MECP2-GFP. se administraron 10 μL de vehículo o 10 μL de inhibidores de XCIF (1,5 mM LDN193189 y 1,6 mM GSK650394) en hemisferios cerebrales opuestos de ratones hembra XI-Mecp2-GFP de 4 semanas de edad mediante inyección intracerebroventricular mediante procedimientos quirúrgicos estereotácticos ( Figura 2A , B). El procedimiento se repitió cada segundo día (figura 2C), y tres semanas más tarde, los animales fueron eutanizados, y los cerebros se aislaron. Se usó un subconjunto para la qRT-PCR y otro fue analizado por inmunohistoquímica. La expresión de MECP2 de tipo silvestre y XI-Mecp2-GFP en los hemisferios con infusión de vehículos y medicamentos fue determinada por la PCR-QRT (secuencias de cebadores enumeradas en la tabla 1). Como se muestra en la Figura 2D, el tratamiento farmacológico reactivó XI-Mecp2-GFP en ~ 30% de las células en el hemisferio cerebral con infusión de drogas, mientras que XI- MECP2-GFP no se detectó en el hemisferio con infusión de vehículo. Un gran número de MAP2, un marcador neuronal, las neuronas positivas también fueron positivas GFP (~ 45%) en el hemisferio tratado con drogas, indicativo de la expresión XI-Mecp2-GFP . Aproximadamente el 20% de MAP2 células cerebrales negativas expresaron GFP, confirmando la reactivación de XI-Mecp2-GFP en células no neuronales (Figura 2E).

Figure 1
Figura 1: generación y validación del modelo de ratón XI-Mecp2 . (A) esquema de la estrategia de cría para generar xistδ: los ratones MECP2/Xist: MECP2-GFP . (B) genotipado por PCR de Xist: Mecp2-GFP/Y, xistδ: Mecp2/Xist: MECP2 y xistδ: MECP2/Xist: ratones MECP2-GFP . Se supervisó a los ratones para detectar la presencia de MECP2-GFP, MECP2 y la región de determinación del sexo y (SRY). (C) análisis de citometría de flujo de núcleos aislados de la corteza del ratón. La corteza de ratón MECP2/MECP2-GFP ~ 50% de los núcleos GFP positivos mientras que xistδ: Mecp2/Xist: Mecp2-GFP no muestra núcleos GFP positivos. (D) análisis de QRT-PCR que monitoreando la expresión de las transcripciones de Mecp2 -GFP y de tipo silvestre en la hembra xistδ: Mecp2/Xist: MECP2-GFP MEFS después del tratamiento con DMSO o drogas (LDN193189 y GSK650394). GAPDH fue monitoreado como un control de carga. (E) inmunofluorescencia cuantitativa monitorización de la intensidad GFP en hembra xistδ: Mecp2/Xist: Mecp2-GFP MEFS tras el tratamiento con DMSO o los fármacos LDN193189 y GSK650394. Los MEFs aislados de los ratones MECP2/y o MECP2/Mecp2-GFP se utilizaron como controles negativos y positivos, respectivamente. Cada punto representa un MEF, y la línea discontinua indica la señal de fondo máxima obtenida en Mecp2/Y, que se estableció en 1. El panel inferior muestra imágenes representativas de núcleos. Esta cifra ha sido modificada de Przanowski et al.16. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: reactivación farmacológica del Mecp2 ligado al X en neuronas corticales cerebrales de ratones vivos. (A) esquemático de un cráneo del ratón y (B) cerebro mostrando el sitio de la inyección para el vehículo o el fármaco en los hemisferios izquierdo o derecho del cerebro. (C) esquema del régimen farmacológico. (D) imágenes representativas de inmunofluorescencia que muestren la señal GFP endógena (verde) en las secciones del cerebro coronal de los hemisferios de vehículos o tratados con drogas. La tinción de DAPI se muestra en azul. (E) imágenes de inmunofluorescencia representativas de las secciones del cerebro coronal que monitoreando la expresión de GFP (anti-GFP; rojo) y MAP2 (verde) en el hemisferio tratado con fármacos. La tinción de DAPI se muestra en azul. Esta cifra ha sido modificada de Przanowski et al.16. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Imprimación inversa (5 '-> 3 ') Temperatura de Anealing/longitud del producto PCR
GGCATGGACTGTGGTCATGAG 60 ° c/87 BP
GCTGAACTTGTGGCCGTTTA 62 ° c/137 BP
TGTCAGAGCCCTACCCATAAG 62 ° c/140 BP
GCACAACCCCGCAAATGCTA 62 ° c/364 BP
GCACAACCCCGCAAATGCTA 62 ° c/250 BP
AATTGCCCTAACGAGCACAC 62 ° c/436 BP
GAACTTCAGGGTCAGCTTGC 62 ° c/217 BP
CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 BP

Tabla 1: lista de imprimadores utilizados para Genotipado y en tiempo real cuantitativo RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Anteriormente, se identificaron XCIFs que son requeridos selectivamente para el silenciamiento de genes ligados a XI en células femeninas de mamíferos12. Además, optimizamos potentes inhibidores de moléculas pequeñas para apuntar a XCIFs, como ACVR1 y efectores descendentes de PDPK1, que reactivan eficientemente el Mecp2 ligado a XI en líneas celulares de fibroblastos de ratón, neuronas corticales de ratón y una célula de fibroblastos humanos línea derivada de un paciente con RTT. Estos resultados sugieren que la reactivación XI es un enfoque terapéutico plausible para rescatar las deficiencias genéticas en pacientes con enfermedad ligada al X; sin embargo, queda por determinar la viabilidad in vivo. Recientemente, se demostró que los inhibidores de XCIF reactivaban el MECP2 ligado a XI en vivo, para el cual se generó un modelo de ratón xistδ no aleatorio: Mecp2/Xist: Mecp2-GFP .

Una característica atractiva del modelo Xistδ: MECP2/Xist: MECP2-GFP es que permite una cuantificación precisa de la reactivación de Mecp2 ligada a XI por varias razones. En primer lugar, debido a la supresión de Xist en el cromosoma X materno, el ratón xistδ: Mecp2/Xist: Mecp2-GFP tiene XCI no aleatorio. Como resultado, el Mecp2 genéticamente etiquetado es silencioso en el 100% de las células (figura 1C), a diferencia de una expresión 50:50 esperada de genes enlazados a X en modelos de ratones XCI aleatorios, como Xist: Mecp2/Xist: MECP2-GFP. Por lo tanto, los resultados no están excluidos por la expresión de mosaico de GFP, y el 100% de las células transportan MECP2-GFP en XI en el modelo xistδ: Mecp2/Xist: MECP2-GFP . En segundo lugar, el etiquetado genético de Mecp2 permite la visualización directa de neuronas individuales con GFP reactivado, minimizando así las manipulaciones experimentales en el análisis neuronal.

Un estudio reciente descubrió que la inyección intracerebroventricular de los inhibidores de XCIF en el hemisferio cerebral del ratón reactiva el Mecp2 ligado a XI mediante el análisis de inmunofluorescencia del cerebro del ratón16. Es importante destacar que el tratamiento farmacológico no tuvo ningún efecto adverso en la salud general, como el peso, el aseo o la movilidad16. Por otra parte, no hay toxicidad detectada por el tratamiento farmacológico en el hígado o el bazo. En conjunto, este estudio proporciona una prueba de principio esencial para demostrar que interferir con la función de XCIFs conduce a la desrepresión de XI in vivo.

En Resumen, un modelo de ratón sensible se puede utilizar para evaluar la reactivación de XI. Este diseño de modelo animal también se puede adaptar para generar un modelo de ratón RTT mejorado que alberga mutaciones de MECP2 (probablemente menos sintomáticas) en el cromosoma X activo y el Mecp2 de tipo silvestre en el XI en todas las células. Debido a la XCI no aleatoria, mientras que los síntomas fenotíricos pueden ser más pronunciados, se espera que este modelo también permita una mejor evaluación y una evaluación precisa de la reversión de los síntomas debido a la reactivación de XI. Además, Xistδ: MECP2/Xist: MECP2-GFP también se puede modificar para estudiar la reactivación XI en otros modelos de enfermedad ligada al X, como el síndrome de DDX3X.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores agradecen a Antonio Bedalov por aportar reactivos; Centro de histología de tejido de la Universidad de Virginia para criseccionamiento; Núcleo de citometría de flujo de la Universidad de Virginia para análisis de citometría de flujo; Christian Blue y Saloni Singh por asistencia técnica con genotipado. Este trabajo fue apoyado por una beca de investigación Double Hoo a Z.Z., y un programa de proyecto piloto otorgado por el Premio de la Universidad de Virginia-Virginia Tech Seed Fund y el Premio de investigación biomédica individual de la Fundación Hartwell a S.B.

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics