Un modèle de souris non aléatoire pour la réactivation pharmacologique de Mecp2 sur le chromosome X inactif

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous décrivons un protocole pour générer un modèle de murin femelle viable avec l’inactivation non aléatoire de chromosome x, c.-à-d. le chromosome x maternellement hérité est inactif dans 100% des cellules. Nous décrivons également un protocole pour tester la faisabilité, la tolérabilité et la sécurité de la réactivation pharmacologique du chromosome X inactif in vivo.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Przanowski, P., Zheng, Z., Wasko, U., Bhatnagar, S. A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome. J. Vis. Exp. (147), e59449, doi:10.3791/59449 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L’inactivation des chromosomes x (XCI) est le silençage aléatoire d’un chromosome X chez les femelles pour atteindre l’équilibre posologique génique entre les sexes. En conséquence, toutes les femelles sont hétérozygotes pour l’expression génique liée au X. L’un des régulateurs clés de XCI est Xist, qui est essentiel pour l’initiation et la maintenance de XCI. Des études antérieures ont permis d’identifier 13 facteurs d’inactivation des chromosomes X (XCIFs) TRANS-agissant à l’aide d’un écran génétique à grande échelle et à perte de fonction. L’inhibition des XCIFs, tels que ACVR1 et PDPK1, à l’aide d’ARN à courte épingle à cheveux ou d’inhibiteurs de petites molécules, réactive les gènes liés aux chromosomes X dans les cellules cultivées. Mais il reste à déterminer la faisabilité et la tolérabilité de la réactivation du chromosome X inactif in vivo. Vers cet objectif, un modèle de souris Xistδ: Mecp2/Xist: Mecp2-GFP a été généré avec des XCI non aléatoires en raison de la suppression de Xist sur un chromosome X. À l’aide de ce modèle, l’étendue de la réactivation X inactive a été quantitée dans le cerveau de la souris après un traitement par des inhibiteurs de la XCIF. Les résultats récemment publiés montrent, pour la première fois, que l’inhibition pharmacologique de XCIFs réactive Mecp2 du chromosome X inactif dans les neurones corticaux du cerveau de la souris vivante.

Introduction

L’inactivation des chromosomes x (XCI) est un processus de compensation de dosage qui équilibre l’expression génique liée au X en faisant taire une copie du chromosome X chez les femelles1. En conséquence, le chromosome X inactif (XI) accumule les caractéristiques caractéristiques de l’hétérochromatine, y compris la méthylation de l’ADN et les modifications inhibitrices de l’histone, telles que la triméthylation de l’histone H3-lysine 27 (H3K27me3) et l’ubiquitination de l’histone H2A (H2Aub) 2. le régulateur principal du silençage de chromosome x est la région du centre d’inactivation x (XIC), autour de 100 − 500 kb, qui contrôle le comptage et l’appariement des chromosomes x, le choix aléatoire du chromosome x pour l’inactivation, et l’initiation et propagation du silençage le long du chromosome X3. Le processus d’inactivation de X est initié par X transcription spécifique inactive (Xist) qui recouvre le XI dans CIS pour médiate le silençage à l’échelle du chromosome et remodeler la structure tridimensionnelle du chromosome x4. Récemment, plusieurs écrans protéomiques et génétiques ont identifié des régulateurs supplémentaires de XCI, tels que les protéines interdépendantes Xist 5,6,7,8,9 , le 10 , le 11 , 12. par exemple, une étude antérieure utilisant un écran d’interférence d’ARN à l’échelle du génome non biaisé a identifié 13 facteurs XCI TRANS-agissant (xcifs)12. Mécanistiquement, XCIFs réguler l’expression Xist et, par conséquent, interférer avec la fonction xcifs provoque défectueux XCI12. Ensemble, les progrès récents dans le domaine ont fourni des informations importantes sur la machinerie moléculaire qui est nécessaire pour initier et maintenir XCI.

L’identification des régulateurs XCI et la compréhension de leur mécanisme dans XCI est directement pertinente pour les maladies humaines liées aux X, comme le syndrome de Rett (RTT)13,14. La RTT est un trouble neurodéveloppemental rare provoqué par une mutation hétérozygote dans la protéine de liaison méthyl-CpG 2 (MeCP2) liée aux X qui touche principalement les filles15. Parce que MeCP2 est situé sur le chromosome X, les filles de RTT sont hétérozygotes pour la carence de MECP2 avec ~ 50% cellules exprimant le type sauvage et ~ 50% exprimant le mutant MeCP2. Notamment, les cellules mutantes RTT abritent une copie dormante mais sauvage de Mecp2 sur le XI, fournissant une source du gène fonctionnel, qui, si réactivé, pourrait potentiellement atténuer les symptômes de la maladie. En plus de la RTT, il existe plusieurs autres maladies humaines liées à X, pour lesquelles la réactivation de XI représente une approche thérapeutique potentielle, comme le syndrome de DDX3X.

L’inhibition du XCIFs, de la protéine kinase-1 (PDPK1) dépendante du 3-phosphoinositide et du récepteur de type 1 (ACVR1) de l’activine A, soit par l’ARN court en épingle à cheveux (shRNA), soit par des inhibiteurs de petites molécules, réactive les gènes liés au XI12. La réactivation pharmacologique des gènes liés au XI est observée dans divers modèles ex vivo incluant des lignées cellulaires de fibroblastes de souris, des neurones corticaux de souris adultes, des fibroblastes embryonnaires de souris et des lignées cellulaires de fibroblastes dérivées d’un patient de RTT12. Toutefois, il reste à démontrer si la réactivation pharmacologique des gènes liés au XI est réalisable in vivo. L’un des facteurs limitatifs est l’absence de modèles animaux efficaces pour mesurer avec précision l’expression des gènes du XI réactivé. Vers cet objectif, un modèle de souris Xistδ: Mecp2/Xist: Mecp2-GFP a été généré qui porte un Mecp2 génétiquement étiqueté sur XI dans toutes les cellules en raison de la suppression hétérozygote dans Xist sur le chromosome X maternel16. Utilisant ce modèle, l’expression de Mecp2 de XI a été quantitée après traitement avec des inhibiteurs de xcifs dans le cerveau des souris vivantes. Ici, la génération du modèle et de la méthodologie de la souris Xistδ: Mecp2/Xist: Mecp2-GFP pour quantifier la réactivation XI dans les neurones corticaux à l’aide d’essais à base d’immunofluorescence est décrite.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Le travail impliquant des souris a été approuvé par le Comité d’utilisation et de protection des animaux de l’Université de Virginie (IACUC; #4112).

1. générer un modèle de souris XCI non aléatoire avec génétiquement étiqueté Mecp2 sur XI

Remarque: Les souches de souris utilisées dans l’étude étaient les suivantes: Mecp2-GFP/Mecp2-GFP (Mecp2TM 3.1 Bird, table des matières) et Xist/δxist (B6; 129-Xist < tm5Sado >; fourni par Antonio bedalov, Fred Hutchinson Cancer Center, Seattle). Les stratégies d’élevage parmi les souches respectives ont été conçues pour élargir les colonies de souris pour chaque souche.

  1. Effectuer une PCR-génotypage sur toutes les souches de souris et les descendances respectives obtenues après la reproduction à l’aide d’amorces spécifiques au gène énumérées dans le tableau 1.

2. concevez la stratégie de sélection de souris pour générer Xistδ: Mecp2/Xist: Mecp2-GFP

  1. Mettre en place une paire de reproducteurs en abritant un mâle Mecp2-GFP/Y et un XistΔ-Mecp2/Xist-Mecp2 femelle ensemble (12 h/12 h: cycle lumière/obscurité) (figure 1a). Idéalement, mettre en place au moins 5 paires de reproduction à la fois en utilisant des souris viables et fertiles. Après que la femelle enceinte donne naissance, lui permettre d’élever sa première litière avec le mâle.
    Remarque: Parce que le Knockout Xist paternel altère les XCI imimprimés, la compensation de dosage et les voies de différenciation17, l’utilisation de souris xistδ-Mecp2/Y dans l’élevage ne produira pas les chiots femelles avec le génotype requis.
  2. Après le sevrage de la litière au jour 21 (P21) post-natal, identifiez et balisez les chiots femelles Xistδ: Mecp2/Xist: Mecp2-GFP à l’aide d’un dosage de génotypage à base de PCR (figure 1b).
    Remarque: En ce qui concerne le nombre d’animaux nécessaires par groupe, pour les résultats rapportés ci-dessous, 5 couples reproducteurs ont été mis en place qui ont généré environ 10 femelles Xistδ: Mecp2/Xist: Mecp2-GFP souris.
  3. Utilisez des modèles de souris femelles pour toutes les expériences proposées.
    Remarque: Le sexe est une variable biologique importante pour les études XCI, et le modèle masculin ne tient pas compte des effets confusionnels de XCI aléatoire.
  4. Pour être cohérent tout au long des études animales et exclure tous les effets de l’âge animal, effectuer toutes les expériences chez les femelles de 5 − 8 semaines Xistδ: Mecp2/Xist: Mecp2-GFP .

3. isolat femelle Xistδ: Mecp2/Xist: fibroblastes embryonnaires de souris Mecp2-GFP (MEFs)

  1. Configurez l’accouplement chronométré entre le mâle Mecp2-GFP/Y et le Xistδ-Mecp2/Xist-Mecp2 femelle. Mettre en place au moins 3 − 4 cages d’accouplement pour augmenter la probabilité de grossesse.
  2. Après avoir confirmé le bouchon vaginal le matin après l’accouplement, séparer la femelle et ce jour est considéré comme le jour embryonnaire 0,5 (E 0.5). Surveillez le gain de poids de la femelle enceinte prospective et inspectez visuellement l’abdomen des souris pour confirmer la grossesse. Sur E 14.5 − 15.5, euthanasier les souris femelles enceintes par la dislocation cervicale.
  3. Sous une hotte laminaire, essuyez l’abdomen de la femelle enceinte avec 70% d’éthanol. En utilisant des ciseaux stériles, disséquez la cavité abdominale et enlevez les cornes utérines contenant les embryons. À l’aide de forceps, enlevez doucement les embryons tout en coupant le tissu abdominal restant (6 − 12 embryons est habituellement attendu).
  4. Placer les cornes utérines contenant les embryons dans un plat de 10 mm de culture tissulaire. En utilisant des ciseaux et des pinces stériles, faire une incision le long des cornes utérines pour isoler les sacs individuels porteurs d’un embryon. Soigneusement, placer les cornes utérines contenant le reste des embryons dans 30 mL de solution stérile de sel équilibré de Hanks (HBSS) sur la glace.
  5. Coupez doucement le sac et isolez l’embryon à l’aide de ciseaux et de forceps stériles. Retirer le placenta en coupant le cordon ombilical.
  6. Décapiter l’embryon.
    Remarque: Alors que le reste du tissu embryonnaire sera transformé, le tissu de la tête d’embryon sera utilisé pour isoler l’ADN pour le génotypage.
  7. Ouvrez l’abdomen en coupant la ligne médiane de l’embryon à l’aide de ciseaux et de forceps stériles. Enlevez les organes viscéraux, tels que le cœur, le foie et les poumons.
  8. Transférer le reste du tissu embryonnaire dans une plaque de culture tissulaire stérile de 60 mm et couper en petits morceaux à l’aide de ciseaux ou d’une lame de rasoir. Pour briser les amas cellulaires, ajouter 3 mL de trypsine-EDTA (0,05%) et incuber à 37 ° c pendant 15 min.
  9. Neutraliser la trypsine-EDTA en ajoutant 5 mL du milieu d’aigle modifié (DMEM) de Dulbecco avec 10% de sérum bovin fœtal (FBS) et 10 μg/mL de pénicilline/streptomycine (stylo/STREP) à la plaque et dissociez le tissu par pipetage répétitif (environ 20 − 30 fois).
  10. Faire tourner les cellules à 300 x g pendant 5 min et suspendre à nouveau le culot cellulaire dans 4 ml de DMEM avec 10% de FBS et 10 μg/ml de stylo/STREP. Plaque les cellules sur un plat de culture 60 mm, et la culture des cellules à 37 ° c en présence de 5% CO2.
  11. Effectuer les étapes 3.5 − 3.10 pour chaque embryon.
  12. Les MEFs de culture obtenus à l’étape 3,11 pendant au moins 3 − 4 jours.
    Remarque: À ce stade, les MEFs peuvent également être cryopréservés pour des expériences futures.
  13. Pour déterminer le sexe et le génotype de chaque embryon, effectuer le génotypage-PCR à l’aide d’ADN isolé des têtes des embryons à l’aide des amorces et des conditions de PCR énumérées dans le tableau 1.

4. confirmer l’absence d’expression de la protéine fluorescente verte (GFP) dans le cerveau des souris Xistδ: Mecp2/Xist: Mecp2-GFP à l’aide d’un test de tri à base de cellules activées par Ffluorescence

  1. À l’aide de ciseaux, séparer le cortex cérébral du reste des hémisphères cérébraux, et placer dans 1 mL de tampon d’isolement de noyaux de glace-froid (NIM) contenant 250 mM de saccharose, 25 mM de chlorure de potassium (KCl), 5 mM de chlorure de magnésium (MgCl2), 10 mm Tris-Cl, complété par 2% de paraformaldéhyde (PFA) et 0,1% de surfactant nonionique (table des matières).
  2. Homogénéiser à l’aide d’un homogénéisateur de verre glacé.
  3. Faire tourner le tissu homogénéisé à 600 x g, 4 ° c pendant 5 min.
  4. Retirer le surnageant et Resuspendre le granule dans 1 mL d’iodixanol à 25% dans la solution NIM.
  5. Ajouter 1 mL de 29% de lodixanol dans la solution de NIM à un tube d’ultracentrifuge de 4 mL (conserver sur la glace jusqu’à ce que les échantillons soient prêts) et mettre délicatement en couche 1 mL d’échantillon (dans 25% de lodixanol).
  6. Centrifuger à 9 000 x g, 4 ° c pendant 10 min dans un ultracentrifuge.
  7. Aspirer le surnageant et le resuspendre dans 500 μL de tampon de tri des cellules activées par fluorescence (FACS) (solution saline tamponnée au phosphate [PBS] additionnée de 1 mM d’EDTA, 0,05% d’azide de sodium et 2% d’albumine sérique bovine [BSA]).
    Remarque: Les échantillons peuvent être stockés à 4 ° c ou jusqu’à 1 semaine.
  8. Ajouter 5 μL de 7-amino-actinomycine D (7-AAD; 50 mg/mL) pendant 5 min à la température ambiante pour tacher l’ADN.
  9. Analysez les échantillons pour le signal de 7-AAD et de protéine fluorescente verte (GFP) utilisant la cytométrie de flux.

5. déterminer la faisabilité du modèle de souris Xistδ: Mecp2/Xist: Mecp2-GFP pour la réactivation XI

  1. Semences 1 x 105 cellules/ml femelle Xistδ: Mecp2/Xist: Mecp2-GFP MEFs, Mecp2/Mecp2-GFP et Xist-Mecp2/Y MEFs obtenues à l’étape 3,12 dans un format 6 puits et dans des lames de chambre, en DMEM avec 10% FBS et 10 μg/ml PEN/STREP, à 37 ° c présence de 5% de CO2.
    Remarque: Les MEFs Mecp2/Mecp2-GFP et Xist-Mecp2/Y sont utilisés comme témoins positifs et négatifs dans les expériences.
  2. Ajouter le milieu frais aux cellules après 24 h. Pour Xistδ: Mecp2/Xist: Mecp2-GFP MEFs, ajouter le milieu complété par des inhibiteurs de xcifs (par exemple, 0,5 μm LDN193189 et 2,5 μm GSK650394), ou seul véhicule. Remplacer le milieu complété par un inhibiteur frais ou un véhicule seul tous les 2 jours. Pour les MEFs Mecp2/Mecp2-GFP et Xist-Mecp2/Y , ajouter le milieu frais tous les 2 jours.
  3. Après 1 semaine de traitement inhibiteur, récolter des MEFs pour l’isolement de l’ARN (plaque de 6 puits) ou fixer des cellules pour l’immunofluorescence (lames de chambre). Utiliser des MEFs isolés des embryons Mecp2/Mecp2-GFP comme des embryons positifs et Xist-Mecp2/Y comme témoins négatifs respectivement.
    1. Pour l’isolement de l’ARN, isolez l’ARN total par le réactif d’extraction d’ARN à base de guanidinium thiocyanate et transcrisez à l’inverse en utilisant la transcriptase inverse. Mesurer l’expression Mecp2-GFP par la transcriptase inverse quantitative (qRT-PCR) à l’aide de Mecp2-WT et Mecp2-GFP, et les amorces énumérées dans le tableau 1, comme décrit précédemment12.
    2. Pour l’immunofluorescence, taches MEFs avec un anticorps primaire anti-GFP (1:100), comme décrit précédemment12,16. Mesurer l’intensité du GFP par immunofluorescence quantitative dans le traitement Xistδ: Mecp2/Xist: Mecp2-GFP MEFs, tel que décrit précédemment18.

6. démontrer la réactivation pharmacologique XI dans le cerveau du modèle de souris Xistδ: Mecp2/Xist: Mecp2-GFP

  1. Préparez les drogues et contrôlez le véhicule.
    1. Préparer une solution fraîche et stérile de véhicule (0,9% de NaCl, 0,5% de méthylcellulose, 4,5% de diméthyl sulfoxyde [DMSO]) pour les injections cérébrales.
    2. Préparer les inhibiteurs chimiques, y compris 1,5 mM LDN193189 (inhibiteur de la petite molécule de ACVR1) et 1,6 mM GSK650394 (inhibiteur de la petite molécule de SGK1, un effecteur en aval de PDPK1) résuspendu dans le véhicule (0,9% NaCl, 0,5% méthylcellulose, 4,5% DMSO), ou véhicule rien que. Le volume total d’inhibiteurs chimiques ou de véhicules injectés est de 10 μL par dose par animal.
  2. Préparez l’animal pour les injections cérébrales.
    1. Préparez la zone chirurgicale en essuyant le banc et le coussin chauffant avec un désinfectant (solution d’hypochlorite de sodium à 10%).
    2. Anesthésier la souris âgée de 4 semaines avec une injection intrapéritonéale de mélange de kétamine/xylazine à une dose de 140 mg/kg et de 10 mg/kg, respectivement. Utilisez le réflexe de retrait de la pédale pour déterminer le niveau d’anesthésie.
    3. Appliquez l’Onguent ophtalmique aux yeux après l’induction de l’anesthésie pour prévenir le séchage de la cornée.
    4. Rasez la fourrure du cou vers le haut de la tête de la souris.
    5. Positionnez la souris dans la plate-forme stéréotactique en accrochant les dents incisives de la souris dans la barre de morsure du resformateur du museau et en serrant la pince de nez sur le museau tout en veillant à ce que la tête de la souris se trouve sur un plan de niveau.
    6. Ajustez la hauteur des barres d’oreille, si nécessaire, pour atteindre la portion caudale du conduit auditif, en les fixant de telle sorte que la tête de la souris est dans un plan de niveau et immobilisé sur le toucher du doigt.
    7. Désinfecter la tête de la souris avec des lingettes alternées d’un antiseptique topique, comme l’iode povidone et l’éthanol 70%.
  3. Administrer des médicaments.
    1. À l’aide d’un scalpel stérile, faire une incision horizontale de 0,75 cm dans le cuir chevelu moyen.
    2. À l’aide d’une bavure de 0,45 mm, percer deux trous symétriques au-dessus des hémisphères corticaux droite et gauche (2 mm de la suture sagittale et 2 mm de la suture lambdoïde, approximativement au milieu de l’os pariétal).
    3. Fixez fermement une seringue de 10 μL à la plate-forme stéréotactique.
    4. Mélanger la solution d’inhibiteurs chimiques et prélever 10 μL de solution dans la seringue. Évitez les bulles d’air dans la seringue.
    5. Faire avancer l’aiguille de la seringue dans le trou de bavure en maintenant l’aiguille perpendiculaire (90 °) au crâne. Lorsque l’aiguille traverse le crâne, zéro les coordonnées sur l’affichage numérique stéréotactique, puis avancer la pointe de l’aiguille jusqu’à ce qu’elle atteigne une profondeur de 2,5 mm.
    6. Retirer l’aiguille 0,5 mm à la profondeur pour 2 mm.
    7. Injecter lentement 10 μL de solution (~ 1 min). Après l’injection est terminée, laisser l’aiguille dans le cerveau pendant ~ 1 min, puis retirer l’aiguille.
    8. Répéter l’injection pour le deuxième hémisphère (contrôle du véhicule uniquement).
    9. À l’aide de sutures ou de «colle cutanée» fermez la peau de la souris (si la plaie est > 0.5 cm, les deux sutures et la «colle cutanée» doivent être utilisées).
    10. Desserrez les barres d’oreille et retirez la souris de l’appareil stéréotactique.
    11. Administrer des analgésiques (buprénorphine SR 0,5 mg/kg IP) et placer la souris sur un coussin chauffant réglé à 37 ° c jusqu’à ce que l’animal retrouve la conscience.
    12. Une fois que la souris est alerte et réactive, retransférez l’animal dans sa cage d’origine.
    13. Répétez la procédure tous les 2 jours pendant 20 jours. Le perçage répété de la zone n’est pas nécessaire pour les injections ultérieures.
  4. Isoler le cerveau de la souris.
    1. Une fois le schéma posologique terminé, euthanasier la souris dans une chambre CO2 .
    2. Immobilisez la souris sur une surface à l’aide d’aiguilles.
    3. Faire une incision latérale à travers le tégument et la paroi abdominale juste sous la cage thoracique à l’aide de ciseaux et forceps. Séparer soigneusement le foie du diaphragme.
    4. À l’aide de ciseaux, coupez le diaphragme et continuez à couper le long de la cage thoracique pour exposer la cavité pleurale.
    5. À l’aide de ciseaux, faire une incision à l’extrémité postérieure du ventricule gauche.
    6. Immédiatement, commencer à injecter la chambre de coeur droit avec ~ 15 mL de PBS plus de ~ 2 min. changement de couleur du foie du rouge au rose pâle est révélateur d’une bonne perfusion.
    7. Injecter la chambre droite du coeur de la souris avec ~ 10 mL de 4% paraformaldéhyde dans PBS plus de ~ 2 min.
    8. Décapiter la souris, et utiliser des ciseaux pour faire une incision de la ligne médiane du cuir chevelu pour exposer le crâne.
    9. Placez un bout des ciseaux dans le foramen Magnum, et coupez latéralement dans le crâne vers l’œil. Répétez pour l’autre côté. Essayez de garder la fin des ciseaux aussi superficiel que possible pour éviter les blessures du cerveau.
    10. Utilisez des ciseaux pour couper la région entre les yeux et au-dessus du nez de la souris.
    11. Utilisez des pinces pour peler doucement les os crâniens des hémisphères cérébraux.
    12. Soulevez le cerveau avec une spatule, et utilisez des ciseaux pour disséquer soigneusement les fibres nerveuses crâniennes qui le fixent au crâne.
    13. Placez le cerveau sur un plat en plastique, découpez le cervelet et les ampoules olfactives, et placez le cerveau dans un tube de 15 mL rempli de 4% PFA est PBS.
  5. Cryo-section le cerveau de la souris.
    1. Fixer le cerveau dans 4% paraformaldéhyde dans PBS à 4 ° c pendant la nuit.
    2. Rincer le cerveau avec du PBS à 4 ° c au moins 3x pendant 5 min chacun.
    3. Étiqueter les moules jetables pour CRYOPRESERVER les tissus.
    4. Découpez l’avant du cerveau à l’aide de ciseaux et de forceps (commencez à faire des sections de 5 mm des sites d’injection).
    5. Transférez le cerveau vers le cryomold avec l’avant du cerveau vers le bas pour obtenir des sections coronale. Submerger le moule contenant le cerveau dans le composé de température de coupe optimal (OCT).
    6. Versez de l’azote liquide dans une boîte de Petri en plastique de 10 mm et placez le cerveau dans le cryo-moule dans l’azote.
      Remarque: Il est important d’orienter le tissu comme décrit dans l’étape 6.5.5 pour guider la sectionnement du cerveau.
    7. Lorsque l’OPO est blanc fixe, placez le cerveau congelé dans un congélateur de-80 ° c pour le stockage.
    8. Equilibrer le cerveau à-20 ° c pendant au moins 30 min avant de sectionner avec cryostat et cryosection (épaisseur 5 − 6 μM) le cerveau, montage 2 − 3 sections par glissière. Les lames peuvent être stockées à-80 ° c pour une utilisation ultérieure.
  6. Déterminez la réactivation XI à l’aide d’une approche basée sur l’immunofluorescence.
    1. Avant de commencer la procédure de coloration, sécher les sections du cerveau pendant la nuit à 4 ° c.
    2. Immerger les lames dans la solution de récupération d’antigène (0,1 M d’acide citrique, 0,1 M Tris-base, pH = 6,0) sur un bloc chauffant 100 ° c pendant 5 min.
    3. Laver les lames 4x avec 1x PBS pendant 5 min chacune à température ambiante.
    4. Immerger les lames dans la solution de blocage (0,1 M NH4CL/PBS/0,2% gélatine/0,05% surfactant nonionique) pendant 20 min à température ambiante.
    5. Laver les lames 3x avec un tampon de lavage (PBS/0,2% de gélatine) à température ambiante pendant 5 min chacune.
    6. Colorer les sections cérébrales avec des anticorps anti-GFP-AlexaFluor647 (1:100) et anti-MAP2 (1:1000) dans le milieu d’incubation (PBS/0.2% gélatine/1% BSA) et incuber à 4 ° c pendant la nuit.
    7. Collecter des anticorps primaires (peut être réutilisé). Laver les lames 4x avec un tampon de lavage pour un total de 30 min à température ambiante.
    8. Incuber les sections cérébrales avec de l’anticorps secondaire marqué par l’isothiocyanate de fluorescéine (FITC) (1:1000) dans le milieu d’incubation et incuber 1 − 2 h à température ambiante dans l’obscurité.
    9. Laver les lames 4x avec un tampon de lavage pour un total de 30 min à température ambiante.
    10. Placer une goutte de milieu de montage avec le 4 ′, 6-diamidino-2-phénylindole (DAPI) sur une lamelle de 22 mm x 50 mm, puis inverser la lèvre sur une glissière, couvrant toutes les sections de tissu.
    11. Image sur un microscope et ajuster les images pour le contraste et la luminosité. Capturer des images et quantifier le nombre de cellules GFP-positives pour les deux traités médicamenteux et traités par le véhicule Xistδ: Mecp2/Xist: Mecp2-GFP souris cerveau hémisphères.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Pour démontrer la faisabilité du modèle de souris Xistδ: Mecp2/Xist: Mecp2-GFP pour les études de réactivation XI, la réactivation induite par l’inhibiteur de la xcif du Mecp2-GFP lié au XI a été testée dans des fibroblastes embryonnaires de souris (MEFs). Les MEFs femelles ont été isolées du jour 15,5 Xistδ: Mecp2/Xist: Mecp2-GFP embryons comme décrit dans la section 3 (figure 1a). Les génotypes de la femelle Xistδ: Mecp2/Xist: Mecp2-GFP MEFs ont été confirmés par génotypage-PCR, comme décrit précédemment19 (figure 1b), et le dosage FACS-based (figure 1c). Les MEFs ont été traités soit avec le DMSO, soit avec les deux médicaments LDN193189 et GSK650394 (0,5 μM et 2,5 μM, respectivement) pendant 7 jours. Après le traitement médicamenteux, l’expression du Mecp2-GFP a été contrôlée par la qRT-PCR. Comme le montre la figure 1d, le traitement médicamenteux, mais pas le DMSO, l’expression réactivée du XI-Mecp2-GFP. Ensuite, on a procédé à une immunofluorescence quantitative pour déterminer l’étendue de l’expression XI-Mecp2-GFP dans les MEF individuels, comme décrit à l’étape 5.3.2. Le signal des MEFs de contrôle négatif isolés des embryons mâles (Mecp2/Y) a été établi comme arrière-plan, et ~ 66% du contrôle positif Mecp2-GFP/Mecp2 MEFs avaient un signal GFP nucléaire. Comme prévu, Xistδ: Mecp2/Xist: les MEFs Mecp2-GFP traités avec le DMSO ont un très faible niveau de GFP nucléaire (~ 3%). En revanche, environ 31% des Xistδ traités par la drogue : Mecp2/Xist: Mecp2 MEFs étaient positifs pour le GFP nucléaire (figure 1e). Ensemble, ces résultats démontrent que les inhibiteurs de la XCIF réactivent le Mecp2 lié au XI dans les MEFs, mais l’étendue de la réactivation XI varie dans la population cellulaire.

Pour évaluer la faisabilité d’une approche pharmacologique fondée sur la réactivation de XI in vivo, si le traitement médicamenteux réactive le Mecp2 lié au XI dans le cerveau de Xistδ: Mecp2/Xist: Mecp2-GFP souris femelles a été étudiée. 10 μL de véhicule ou 10 μL d’inhibiteurs de la XCIF (1,5 mM LDN193189 et 1,6 mM GSK650394) ont été administrés dans des hémisphères cérébraux opposés de souris femelles XI-Mecp2-GFP de 4 semaines par injection intracérébroventriculaire à l’aide de procédures chirurgicales stéréotactiques ( Figure 2a , B). La procédure a été répétée tous les deux jours (Figure 2c), et trois semaines plus tard, les animaux ont été euthanasiés, et les cerveaux ont été isolés. Un sous-ensemble a été utilisé pour le qRT-PCR et un autre a été analysé par immunohistochimie. L’expression de type sauvage Mecp2 et XI-Mecp2-GFP dans les hémisphères infusés par le véhicule et la drogue a été déterminée par la qRT-PCR (séquences d’amorces énumérées dans le tableau 1). Comme le montre la figure 2D, le traitement médicamenteux a réactivé le XI-Mecp2-GFP dans environ 30% des cellules de l’hémisphère cérébral infusé par la drogue, alors que le XI- Mecp2-GFP n’a pas été détecté dans l’hémisphère infusé par le véhicule. Un grand nombre de MAP2, un marqueur neuronale, les neurones positifs ont également été positifs GFP (~ 45%) dans l’hémisphère traité par la drogue, indicative de l’expression XI-Mecp2-GFP . Environ 20% des cellules cérébrales négatives de MAP2 ont exprimé le GFP, confirmant la réactivation du XI-Mecp2-GFP dans les cellules non neuronales (Figure 2e).

Figure 1
Figure 1: génération et validation du modèle de souris XI-Mecp2 . (A) schéma de la stratégie de sélection pour la génération de souris Xistδ: Mecp2/Xist: Mecp2-GFP . (B) génotypage PCR de Xist: Mecp2-GFP/Y, xistδ: Mecp2/Xist: Mecp2 et Xistδ: Mecp2/Xist: Mecp2-GFP souris. Les souris ont été surveillées pour la présence de Mecp2-GFP, Mecp2 et la région de détermination du sexe Y (sry). (C) analyse de cytométrie de flux de noyaux isolés du cortex de la souris. Mecp2/Mecp2-GFP Mouse cortex show ~ 50% de noyaux GFP-positifs alors que Xistδ: Mecp2/Xist: Mecp2-GFP ne montre aucun noyau GFP-positif. (D) analyse qRT-PCR suivi de l’expression des transcriptions Mecp2-GFP et Wild-type Mecp2 chez les femelles Xistδ: Mecp2/Xist: Mecp2-GFP MEFs après traitement par le DMSO ou le médicament (LDN193189 et GSK650394). GAPDH a été surveillé comme un contrôle de chargement. Econtrôle quantitatif de l’immunofluorescence de l’intensité du GFP chez les femelles Xistδ: Mecp2/Xist: Mecp2-GFP MEFs après traitement par le DMSO ou les médicaments LDN193189 et GSK650394. Les MEFs isolés des souris Mecp2/Y ou Mecp2/Mecp2-GFP ont été utilisés comme témoins négatifs et positifs, respectivement. Chaque point représente un MEF, et la ligne pointillée indique le signal d’arrière-plan maximal obtenu en Mecp2/Y, qui a été défini sur 1. Le panneau inférieur montre des images représentatives de noyaux. Ce chiffre a été modifié de Przanowski et coll.16. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2: réactivation pharmacologique des Mecp2 liés aux X dans les neurones corticaux cérébraux des souris vivantes. (A) schéma d’un crâne de souris et (B) cerveau montrant le site d’injection pour le véhicule ou la drogue dans les hémisphères gauche ou droit du cerveau. (C) schéma du régime médicamenteux. Ddes images d’immunofluorescence représentatives montrant un signal endogène de GFP (vert) dans des sections cérébrales corononales provenant d’hémisphères traités par des véhicules ou des médicaments. La coloration DAPI est affichée en bleu. (E) des images représentatives d’immunofluorescence des sections cérébrales corononales qui surveillent l’expression du GFP (anti-GFP; rouge) et du map2 (vert) dans l’hémisphère traité par la drogue. La coloration DAPI est affichée en bleu. Ce chiffre a été modifié de Przanowski et coll.16. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Apprêt inversé (5 '-> 3 ') Longueur de produit de température/PCR d’anealing
Le chat de la GUAGUE 60 ° c/87 BP
GCTGAACTTGTGGCCGTTTA 62 ° c/137 BP
TGTCAGAGCCCTACCCATAAG 62 ° c/140 BP
GCACAACCCCGCAAATGCTA 62 ° c/364 BP
GCACAACCCCGCAAATGCTA 62 ° c/250 BP
De l’AATTGCCCTAACGAGCACAC 62 ° c/436 BP
Le GAACTTCAGGGTCAGCTTGC 62 ° c/217 BP
CTCCTCTGTGACACTTTAGCCCTCCGA 66 ° c/270 BP

Tableau 1: liste des amorces utilisées pour le génotypage et la RT-PCR quantitative en temps réel.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Auparavant, les XCIFs qui sont sélectivement requis pour le silençage des gènes liés au XI dans les cellules femelles de mammifères ont été identifiés12. Nous avons également optimisé les puissants inhibiteurs de petites molécules pour cibler les XCIFs, tels que les ACVR1 et les effecteurs en aval de PDPK1, qui réactivent efficacement les Mecp2 liées aux XI dans les lignées cellulaires de fibroblastes de souris, les neurones corticaux de souris et une cellule de fibroblastes humaines ligne dérivée d’un patient RTT. Ces résultats suggèrent que la réactivation de XI est une approche thérapeutique plausible pour sauver les déficiences génétiques chez les patients atteints de maladie liée au X; Toutefois, la faisabilité in vivo reste à déterminer. Récemment, des inhibiteurs de la XCIF ont été montrés pour réactiver Mecp2 in vivo lié au XI, pour lequel un modèle de souris Xistδ: Mecp2/Xist: Mecp2-GFP non aléatoire a été généré.

Une caractéristique intéressante du modèle Xistδ: Mecp2/Xist: Mecp2-GFP est qu’il permet une quantification précise de la réactivation de Mecp2 liée par XI pour plusieurs raisons. Premièrement, en raison de la suppression de Xist sur le chromosome X maternel, la souris Xistδ: Mecp2/Xist: Mecp2-GFP a des XCI non aléatoires. En conséquence, le Mecp2 génétiquement étiqueté est silencieux dans 100% des cellules (figure 1c), contrairement à une expression attendue de 50:50 de gènes liés à X dans des modèles de souris XCI aléatoires, tels que Xist: Mecp2/Xist: Mecp2-GFP. Par conséquent, les résultats ne sont pas exclus par l’expression mosaïque de GFP, et 100% de cellules transportent Mecp2-GFP sur XI dans le modèle Xistδ: Mecp2/Xist: Mecp2-GFP . Deuxièmement, l’étiquetage génétique de Mecp2 permet la visualisation directe de neurones individuels avec le GFP réactivé, minimisant ainsi les manipulations expérimentales dans l’analyse neuronale.

Une étude récente a révélé que l’injection intracérébroventriculaire des inhibiteurs de la XCIF dans l’hémisphère cérébral de la souris réactive la Mecp2 liée au XI en utilisant l’analyse de l’immunofluorescence du cerveau de la souris16. Il est important de noter que le traitement médicamenteux n’a pas eu d’effet néfaste sur la santé générale, comme le poids, le toilettage ou la mobilité16. En outre, il n’y a aucune toxicité détectée par le traitement médicamenteux dans le foie ou la rate. Ensemble, cette étude fournit une preuve de principe essentielle pour démontrer qu’interférer avec la fonction de XCIFs conduit à la dérépression de XI in vivo.

En résumé, un modèle de souris sensible peut être utilisé pour évaluer la réactivation de XI. Cette conception de modèle animal peut également être adaptée pour générer un modèle de souris RTT amélioré qui héberge des mutations Mecp2 (probablement moins symptomatiques) sur le chromosome X actif et le type sauvage Mecp2 sur le XI dans toutes les cellules. En raison de la XCI non aléatoire, alors que les symptômes phénotypiques peuvent être plus prononcés, il est prévu que ce modèle permettra également une meilleure évaluation et une évaluation précise de l’inversion des symptômes en raison de la réactivation XI. En outre, Xistδ: Mecp2/Xist: Mecp2-GFP peut également être modifié pour étudier XI réactivation dans d’autres modèles de maladies liées à X, tels que le syndrome de DDX3X.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Les auteurs remercient Antonio Bedalov d’avoir fourni des réactifs; Université de Virginia tissue Histology Core pour la cryosectionnement; Université de Virginie flux cytométrie de base pour l’analyse de cytométrie en flux; Christian Blue et Saloni Singh pour l’assistance technique au génotypage. Ce travail a été appuyé par une subvention de recherche double Hoo à Z.Z., et un prix du programme pilote de projet du prix de l’Université de Virginia-Virginia Tech Seed Fund et le prix de recherche biomédicale individuelle de la Fondation Hartwell à

Materials

Name Company Catalog Number Comments
MICE
Mecp2tm3.1Bird The Jackson Laboratory #014610
B6;129-Xist (tm5Sado) provided by Antonio Bedalov, Fred Hutchinson Cancer Center, Seattle
REAGENTS
22x22 mm coverslip FISHERfinest (Fisher Scientific) 125488
32% Paraformaldehyde Electron Microscopy Sciences 15714-S
50 ml syringe Medline Industries NPMJD50LZ
60mm culture dish CellStar 628160
7-AAD BioLegend 420403
ammonium chloride (NH4Cl) Fisher Chemical A661-3
anti-GFP-AlexaFluor647 Invitrogen A-31852
anti-MAP2 Aves Labs MAP
BSA Promega R396D
Buprenorphine SR Zoopharm
citric acid Sigma C-1857
DMSO Fisher Bioreagents BP231-100
Dulbecco's Modified Eagle Medium (DMEM) Corning Cellgro 10-013-CV
Ethanol Decon Labs 2701
fetal bovine serum (FBS) VWR Life Science 89510-198
gelatin Sigma-Aldrich G9391
glass slides Fisherbrand 22-034-486
goat anti-chicken FITC-labeled secondary antibody Aves Labs F-1005
GSK650394 ApexBio B1051
hamilton 10μl syringe Hamilton Sigma-Aldrich 28615-U
Hank's Balanced Salt Solution (HBSS) Gibco 14025-092
Ketamine Ketaset NDC 0856-2013-01
Large blunt/blunt curved scissors Fine Science Tools 14519-14
LDN193189 Cayman Chemicals 11802
lodixanol Sigma 1343517
magnesium chloride (MgCl2) Fisher Chemical M35-212
Methylcelulose Sigma M0262-100G
mounting medium with DAPI Vectashield H-1200
Needle tip, 26 GA x 1.25" PrecisionGlide 305111
ophthalmic ointment Refresh Lacri-Lube 93468
optimal cutting temperature (O.C.T.) ThermoFisher
PCR mix
Penicillin/Streptomycin (Pen/Strep) Corning 30-002-Cl
Phosphate buffered saline pH 7.4 (PBS) Corning Cellgro 46-103-CM
Potassium chloride (KCl) Fisher Scientific P330-500
scalpel blades
Shallow glass or plastic tray
skin glue/tissue adhesive 3M Vetbond 1469SB
sodium azide Fisher Scientific CAS 26628-22-8
Sodium chloride (NaCl) Fisher Chemical S642-212
standard hemostat forceps Fine Science Tools 13013-14
Standard tweezers Fine Science Tools 11027-12
Straight iris scissors Fine Science Tools 14058-11
sucrose Fisher Scientific BP220-1
Tris-base Fisher Bioreagents BP152-5
Triton X-100 Fisher Bioreagents BP151-500
Trypsin-EDTA Gibco 15400-054
Xylazine Akorn NDC: 59399-111-50
EQUIPMENT
Zeiss AxioObserver Live-Cell microscope Zeiss Zeiss AxioObserver
0.45mm burr IDEAL MicroDrill 67-1000
BD FACScalibur
centrifuge
glass homogenizer
cell culture incubator Thermo Scientific HERACELL VIOS 160i 13-998-213
Leica 3050S research cryostat
stereotactic platform
thermocycler
Timer
ultracentrifuge Beckman Coulter Optima L-100 XP
Water bath (37 ºC) Fisher Scientific Isotemp 2239

DOWNLOAD MATERIALS LIST

References

  1. Lyon, M. F. X-chromosome inactivation as a system of gene dosage compensation to regulate gene expression. Progress in Nucleic Acid Research and Molecular Biology. 36, 119-130 (1989).
  2. Heard, E. Delving into the diversity of facultative heterochromatin: the epigenetics of the inactive X chromosome. Current Opinion in Genetics Development. 15, (5), 482-489 (2005).
  3. Augui, S., Nora, E. P., Heard, E. Regulation of X-chromosome inactivation by the X-inactivation centre. Nature Review Genetics. 12, (6), 429-442 (2011).
  4. Pontier, D. B., Gribnau, J. Xist regulation and function explored. Human Genetics. 130, (2), 223-236 (2011).
  5. Barnes, C., Kanhere, A. Identification of RNA-Protein Interactions Through In Vitro RNA Pull-Down Assays. Methods in Molecular Biology. 1480, 99-113 (2016).
  6. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  7. Minajigi, A., et al. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. Science. 349, (6245), (2015).
  8. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Current Biology. 26, (8), R338-R342 (2016).
  9. Mira-Bontenbal, H., Gribnau, J. New Xist-Interacting Proteins in X-Chromosome Inactivation. Curren Biology. 26, (10), 1383 (2016).
  10. Ridings-Figueroa, R., et al. The nuclear matrix protein CIZ1 facilitates localization of Xist RNA to the inactive X-chromosome territory. Genes and Development. 31, (9), 876-888 (2017).
  11. Sunwoo, H., Colognori, D., Froberg, J. E., Jeon, Y., Lee, J. T. Repeat E anchors Xist RNA to the inactive X chromosomal compartment through CDKN1A-interacting protein (CIZ1). Proceedings of National Academy of Sciences of the United States of America. (2017).
  12. Bhatnagar, S., et al. Genetic and pharmacological reactivation of the mammalian inactive X chromosome. Proceedings of National Academy of Sciences of the United States of America. 111, (35), 12591-12598 (2014).
  13. Zoghbi, H. Y., Percy, A. K., Schultz, R. J., Fill, C. Patterns of X chromosome inactivation in the Rett syndrome. Brain Development. 12, (1), 131-135 (1990).
  14. Anvret, M., Wahlstrom, J. Rett syndrome: random X chromosome inactivation. Clinical Genetics. 45, (5), 274-275 (1994).
  15. Amir, R. E., et al. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nature Genetics. 23, (2), 185-188 (1999).
  16. Przanowski, P., et al. Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice. Proceedings of Natlional Academy of Sciences of the United States of America. 115, (31), 7991-7996 (2018).
  17. Borensztein, M., et al. Xist-dependent imprinted X inactivation and the early developmental consequences of its failure. Nature Structural and Molecular Biology. 24, (3), 226-233 (2017).
  18. Jensen, E. C. Quantitative analysis of histological staining and fluorescence using ImageJ. Anatomical Record (Hoboken). 296, (3), 378-381 (2013).
  19. Cseke, L. J., Talley, S. M. A PCR-based genotyping method to distinguish between wild-type and ornamental varieties of Imperata cylindrica. Journal of Visualized Experiments. (60), (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics