참조되지 않은 태평양 굴에서 사실상 순차적 cDNA 라이브러리 생성을 위한 수렴 전략

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

우리는 참조되지 않은 태평양 굴 견본에서 RNA 견본을 사용하는 방법에 대한 전략을 기술하고, 사실상 연속된 cDNA 라이브러리를 생성하기 위하여 공개적으로 유효한 게놈 데이터와 비교하여 유전 물질을 평가합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

새로운 세포주 또는 게놈 시퀀싱 프로젝트의 개발과 같은 주요 실험에서 이전에 사용되었던 기준 종의 생물학적 물질에 대한 접근은 종종 추가 연구 또는 제3자에 대한 제공이 어렵습니다. 샘플의 소모적 특성. 현재 아시아, 오스트레일리아 및 북미의 태평양 연안에 널리 분포되어 있지만, 개별 태평양 굴 표본은 유전적으로 매우 다양하므로 유전자 라이브러리의 시작 물질로 직접 적합하지 않습니다. 이 기사에서는 지역 해산물 시장에서 얻은 참조되지 않은 태평양 굴 표본을 사용하여 cDNA 라이브러리를 생성하는 방법을 보여줍니다. 이들 라이브러리는 공론화된 굴 게놈과 비교하였고, 가장 가까운 관련 라이브러리는 미토콘드리아 기준 유전자 시토크롬 C 옥시다아제 소단위 I(COX1) 및 NADH 탈수소효소(ND)를 사용하여 선택하였다. 생성된 cDNA 라이브러리의 적합성은 UDP-글루쿠로닉 산 탈수소효소(UGD) 및 UDP-자일로스의 생합성을 담당하는 UDP-자일로오스 신타제(UXS)를 코딩하는 두 유전자의 복제 및 발현에 의해 입증된다. UDP-포도당.

Introduction

긴 납품 시간, 기업가 추론 또는 국가별 관세 규정으로 인해 살아있는 참조 생물학적 물질의 취득이 어려울 수 있습니다. 대안으로서, 요구되는 생물학적 물질은 또한 전형적으로 동일한 시편으로부터 수집될 수 있다. 그러나, 이 견본은 유전자형의 수준에 현저하게 변화할 수 있고, 그러므로 동일 종의 디지털로 저장된 기준 게놈과의 비교는 수시로 새로 공급된 물자의 비호환성 때문에 어렵거나 심지어 쓸모없는 렌더링됩니다 기존 DNA 증폭 방법. 개별 시료의 고도로 보존된 유전자를 시퀀싱하는 것은 cDNA라이브러리 2의 품질 평가를 위한 기준 유전자로 자주 사용되는 보존된 미토콘드리아 유전자와 같은 종 1을 식별하기 위한 널리 사용되고 강력한 도구입니다2 ,3,4,5,6. 본명 제시된 방법에 대한 근본적인 근거는 기준 게놈의 상응하는 서열에 비해 개별 익명 굴 샘플에서 미토콘드리아 유전자 서열의 높은 보존이 다른 유전자도 나타낼 수 있음을 나타낸다는 것이다. 낮은 수준의 차이는 핵 DNA 7에 비해 일반적으로 빠른 미토콘드리아DNA 진화 속도를 감안할 때, 단순히 공개적으로 사용하여 광범위한 과학적 및 산업적으로 관련된 유전자의 증폭 및 격리를 허용합니다. 사용 가능한 시퀀싱 데이터를 참조로 사용할 수 있습니다.

본 명세서의 전체적인 목적은 굴 유전자의 복제를 위한 템플릿 DNA로서 사용될 수 있는 사실상 서열된 굴 cDNA 라이브러리를 생성하기 위한 최적화된 워크플로우를 제시하는 것이다. 가상 시퀀싱에서, 드 노보 게놈 시퀀싱은 우회; 대신, 알려진 디지털 방식으로 저장된 참조 시퀀스는 결국 라이브러리를 구성할 cdNA 생산을 위한 프라이머를 활용하거나 설계하는 데 직접 사용됩니다(또는 기존 라이브러리에 추가됨). 목표는 생성된 cDNA 서열과 기준 서열 사이의 유사성이 낮은 발산에서 높은 발산까지 순위가 매겨질 수 있음을 의미하는 수렴 cDNA 라이브러리를 생성하는 것입니다. 시토크롬 C 옥시다아제 소단위 1(COX1) 및 NADH 탈수소효소(ND)를 기준 유전자로 사용하는 주요 장점은 이러한 미토콘드리아 유전자의 높은 보존으로 인해 지리적으로 매우 탈수한 굴 표본도 프로파일화될 수 있다는 것입니다. 이러한 잘 확립 된 마커로 접근법을 입증 한 후, 우리는 설탕 뉴클레오티드 생합성에 관여하고 산업 관련성 8,9, 2 효소 후보에게 적용을 입증합니다. 10. 태평양 굴의 생명 공학 적 잠재력은 아직 밝혀지지 않았습니다. 따라서, 우리는 사실상 서열화된 cDNA 라이브러리를 준비하기 위한 이 수렴 방법이 또한 이 관련 생물학 물자에서 cDNA를 생성하고 싶은 비전문가 연구원을 위해 적법할 것이라는 점을 믿습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

참고: 도식 개요는 그림 1에나와 있습니다.

1. 샘플 수집

  1. 굴 표본을 구하십시오. 수확 후 철기, 수송 및 실험실 사용 전에 얼음에 굴을 보관하고 구입 후 4-7 일 이내에 처리하십시오.
    참고: 이 프로토콜의 경우, 굴은 난징의 중카이 도매 시장(닝데, 푸젠, 중국, 랴오닝강, 장쑤성), 칭다오의 하이지 수산물 회사(중국 산둥성 칭다오에서 유래), 주청에서 구입했습니다. 연대(중국 산둥, 연타이)의 수산물 회사및 칭다오의 진시우 수산물 회사(중국 산둥 성 칭다오에서 유래).

2. 구니디늄 티오차네이트 페놀 추출에 의한 RNA 분리

  1. 굴 조직 샘플의 준비
    1. 멸균 된 메스로 각 굴 표본의 대략적인 기하학적 중심에서 약 100 mg의 균일 한 연조직을 잘라 내고 샘플을 액체 질소로 옮김을 옮김.
    2. 굴의 나머지 부분을 1시간 동안 -80°C에서 동결하여 안락사시키고 생물학적 폐기물로 버린다.
    3. 50 mL의 액체 질소로 채워진 박격포 (200 mL)에 미세 분말로 플래시 냉동 굴 조직을 갈아.
    4. 각 시편의 냉동 조직 75 mg을 멸균 1.5 mL 원심 분리기 튜브에 넣고 구니디늄 티오티나네이트 페놀 추출 시약 1 mL과 혼합합니다. 15 분 동안 4 °C에서 14,000 x g에서 샘플을 원심 분리.
  2. 상급체를 새로운 1.5 mL 원심분리기 튜브로 옮기고, 200 μL의 클로로포름을 추가하고 혼합물이 유백색으로 변할 때까지 10-15s동안 와르텍스 믹서를 사용하여 철저히 섞습니다.
  3. 4°C에서 14,000 x g에서 15분 동안 원심분리기를 하고, 200 μL 파이펫으로 상부 수성층을 새로운 1.5 mL 원심분리기 튜브로 방해하지 않고 조심스럽게 이송한다.
  4. 이소프로필 알코올 500 μL을 넣고 샘플을 반전하여 부드럽게 섞은 다음 샘플을 얼음에 20분 간 둡니다. 4°C에서 14,000 x g에서 원심분리기를 8분 동안 제거하고 상위를 제거한다.
  5. 75% EtOH의 1 mL에서 각 펠릿을 다시 중단하고, 원심분리기를 4°C에서 14,000 x g에서 5분 동안 제거합니다.
  6. 2.5단계를 한 번 반복합니다. 실온에서 펠릿을 6분 동안 말립니다. 더 이상 건조하지 마십시오; 그렇지 않으면, 다음 단계에서 RNA 펠릿을 용해시키기 어려울 수 있다.
  7. 건조 된 RNA 펠릿을 DEPC (디틸피로 카보네이트)의 25 μL에 용해시키고 튜브를 얼음 위에 유지하십시오. 24 시간 이내에 RNA 샘플을 사용하십시오.

3. 역전사에 의한 cDNA 라이브러리 생성

  1. 각 RNA 샘플에 대해, 10 μL 파이펫을 사용하여 상업적역 전사 시스템을 사용하여 반응 혼합물을 준비: MgCl2 용액 4 μL, 10x 반응 버퍼의 2 μL, dNTP 용액의 2 μL, RNase 억제제의 0.5 μL, 0.7 μL 의 AMV 역 전사효소, 0.5 μL의 올리고(dT) 프라이머 15, 추출된 RNA 샘플의 1 μL및 H2 O의 9.3 μL을 300 μL PCR 튜브내로 하였다.
  2. 42°C에서 60분 동안 PCR 써모사이클러에 혼합물을 인큐베이션한 다음 온도를 95°C로 5분 동안 증가시다.
  3. 생성된 cDNA 라이브러리를 -20°C에서 최대 12개월 동안 저장합니다.

4. 미토콘드리아 유전자 증폭 및 정제

  1. 10 μL 파이펫을 사용하여 PCR 혼합물을 준비합니다. 고충실도 DNA 폴리머라제 0.25μL(1.25U), dNTP 용액 2μL(각 dNTP의 2.5mM), COX1 또는 ND 포워드 프라이머의 0.5 μL(100μM), 해당 COX1 또는 ND 역방향 프라이머(100μM), cDNA 라이브러리의 0.5 μL, 1 μL을 추가 , 5 μL의 5 μL 의 완충액및 증류된 H2 O의 16 μL을 300 μL PCR 튜브내로 한다.
  2. 다음 파라미터를 사용하여 PCR 증폭 을 수행: 95 °C에서 초기 변성 단계 후 (지속 시간 5 분), 55 °C에서 어닐링 단계로 구성된 35 PCR 반응 주기 (30 s), 72 °C에서 신장 단계 (2 분), 95 °C (30 초)에서 변성 단계 , 72°C에서 5분 동안 1회 마무리 신장 단계를 수행한다.
  3. 아가로즈 겔 전기 동동에 의해 얻은 PCR 제품의 품질을 확인하기 위해 PCR 제품의 5 μL을 사용합니다. 증폭된 COX1 또는 ND 유전자를 각각 759 또는 748 염기 쌍에서 단일 밴드로 관찰한다.
  4. PCR 클린업 키트로 나머지 PCR 제품을 정화합니다.
    1. 100 μL의 용액 'PCR-A'(고농도의 샤오트로픽 염11를포함하는 DNA 결합 완충제)를 시료에 첨가한다. 소용돌이 내용물 혼합을 짧게.
    2. 정제 컬럼을 2mL 원심분리기 튜브에 넣습니다. 4.4.1의 반응 혼합물을 피펫. 열에 들어갑니다. 실온에서 1 분 동안 14,000 x g의 원심 분리기.
    3. 원심 분리관에서 여과액을 폐기하십시오. 2mL 원심분리기 튜브에 컬럼을 반환하고, 700 μL의 용액 'W2'를 컬럼에 넣고 1분 동안 14,000 x g에서 원심분리기를 추가합니다('W2'는 잔류 차오트로픽 제거를 위한 고농도에 대한 에탄올을 함유한 세척 용액입니다. 정제 열에서 소금).
    4. 여과액을 버리고 컬럼을 2 mL 원심분리기 튜브로 되돌려 보냅니다. 400 μL의 용액 'W2'를 기둥과 원심분리기를 실온에서 1분 동안 1분 동안 14,000 x g으로 추가합니다.
    5. 금속 블록 히터에서 탈이온수 1 mL을 65°C로 예열합니다. 기둥을 새로운 1.5 mL 원심분리기 튜브로 옮김. 65°C의 파이펫 25 μL을 백색 컬럼 멤브레인의 중심으로 가열된 탈이온수. 멤브레인을 실온에서 1 분 동안 담가 둡니다.
    6. 실온에서 1 분 동안 14,000 x g의 원심 분리기를 폐기하고 컬럼을 버립니다.
  5. 정제된 PCR 제품을 -20°C에서 최대 12개월 동안 보관하십시오.

5. 미토콘드리아 유전자 시퀀싱 및 비교

  1. 염기서열 분석기로서 관련 COX1 또는 ND 전방 프라이머를 사용하여 Sanger 시퀀싱을 위해 4.5단계에서 정제된 PCR 샘플을 보냅니다. 선택적으로 COX1 또는 ND 역방향 프라이머를 양방향 시퀀싱에도 사용할 수 있습니다.
  2. 시퀀싱 결과를 검색한 후, NCBI 뉴클레오티드 BLAST 온라인 툴(blast.ncbi.nlm.nih.gov)을 이용하여 태평양 굴 기준 균주(NCBI Taxonomy ID: 29159)의 게놈 서열과 서열을 비교한다(그림2도 3 ).

6. 유전자 MgUGD 및 MgUXS를 복제하기위한 cDNA 라이브러리적용

  1. 4.1단계 다음단계에 따라 MGUGD 및 MgUXS의 각각의 전진 및 역방향 프라이머를 사용하여 MgUGD 및 MgUXS 유전자를 증폭 및 정제한다. 4.4로 이동합니다.
  2. 소화 완충제 2 μL (10 x 농축) 및 탈이온수 6 μL을 1.5 mL 원심 분리튜브로 옮김. 정제된 MgUGD 또는 MgUXS PCR 제품의 10 μL을 제한 엔데 I 및 Xho I(각각 1 μL, 20 U)와 함께 첨가한다. 37°C에서 3시간 동안 배양한다.
  3. 소화된 pET-30a 벡터를 준비합니다: pET-30a 벡터의 500 ng를 새로운 1.5 mL 원심분리기 튜브로 옮기고 탈이온수를 사용하여 16μL까지 부피를 위로 올려 보냅니다. 2 μL의 소화 버퍼(10x 농축)를 Nde I 및 Xho I(각각 1 μL, 20 U)와 함께 첨가한다.
    1. 혼합물을 37°C에서 3시간 동안 인큐베이션한 후, 알칼리성 인산염(1 U)의 1 μL을 첨가하고 37°C에서 추가1시간 동안 배양한다. 예열된 금속 블록 히터에서 75°C에서 10분 동안 가열하여 알칼리성 인산염을 비활성화합니다.
  4. 소화된 MgUGD 또는 MgUXS DNA 제품의 4 μL을 신선한 1.5 mL 원심분리기 튜브로 옮기고 소화된 pET-30a 벡터의 4 μL을 첨가합니다. 1 μL의 리베이션 버퍼(10x), 1 μL의 T4 리가제(3 U)를 넣고 3시간 동안 22°C에서 반응 혼합물을 배양합니다.
  5. 결찰 제품을 사용하여 전기 증시에 의해 전기 유능한 대장균 Mach1 유능한 세포를 변환합니다. 50 μg/mL 카나마이신을 함유한 LB 한천 플레이트에 형질전환된 세포를 퍼뜨리다. 16 시간 동안 37 °C에서 세포를 배양하십시오.
  6. 플라스미드 특이적 T7 프로모터 및 터미네이터 프라이머를 사용하여 Sanger 시퀀싱에 의한 원하는 삽입에 대한 콜로니를 확인합니다. 검증된 세균 클론에서 플라스미드를 준비합니다.

7. MgUGD 및 MgUXS의 발현 및 활동 테스트

  1. 대장균 BL21 (DE3) MgUGD 및 MgUXS 유전자를 베어링 플라스미드와 유능한 세포를 변환하고 50 μg / mL 카나마이신을 포함하는 LB 한천 플레이트에 형질전환 된 세포를 확산. 16 시간 동안 37 °C에서 세포를 배양하십시오.
  2. 하룻밤 동안 50 μg/mL 카나마이신으로 5 mL LB 배지에서 단일 식민지를 재배합니다. 배양을 400 mL LB 배지로 옮기고 37°C의 온도에서 200 rpm에서 지속적으로 흔들어 600 nm(OD600)의파장에서 광학 밀도가 약 0.5의 흡수에 도달할 때까지.
    1. 인큐베이션 온도를 20°C로 낮추고 이소프로필 β-D-티오갈라코피라노사이드(농도 1M)의 400 μL을 추가합니다. 3 시간 동안 재조합 단백질의 발현을 유도한다.
  3. 4°C에서 15분 동안 4,500 x g에서 원심분리에 의해 세포를 수확한다. 용해 완충액의 10 mL에서 펠릿을 일시 중단 (100 mM NaCl, 50 mM 트리스 / HCl, 1 % 트리톤 X-100, 1 mMM 페닐 메틸 설포닐 - 불소 (PMSF), pH 8.0).
  4. 20 분 동안 초음파 처리로 세포를 중단하십시오 (4 °C에서 15 s에 대한 20 μm 진폭으로 40 온 / 오프 사이클). 4°C에서 14,000 x g에서 20분 동안 원심분리기를 수집하고 활동 시험을 위해 상급자를 수집합니다.
  5. UDP-포도당(10mM), NAD+4 μL (10mM), MgCl2 (10 mM), 트리스 /HCl 버퍼 2 μL (500 mM, pH 7.5) 및 6 μL 의 새로운 Oon2 로 용해 세포의 2 μL을 배양하여 MgUGD의 활성 분석 수행 mL 원심분리기 튜브를 37°C에서 30분 동안 배양한다.
  6. UDP-글루쿠로닉산(10 mM), 트리스/HCl 완충액 2 μL(500 mM, pH 7.5), 탈이온 H2 O 14 μL을 새로운 1.5 mL 원심분리기및 C큐베튜브 30°에서 2 μL로 배양하여 MgUXS의 활성 분석기를 수행한다.
  7. 각 혼합물에 20 μL의 메탄올 및 40 μL의 클로로포름을 첨가하여 7.5 및 7.6 단계에서 반응을 담금질한다. 시료 혼합물을 소용돌이후, 14,000 x g에서 4°C에서 6분 동안 원심분리기를 하고 각 튜브의 상부 수성층을 수집한다.
  8. 500-700m/z 범위의 음이온화 모드에서 MALDI-TOF 질량 분석법을 사용하여 반응 제품을 분석합니다. 시료 혼합물 1 μL을 2,5-디하이드록시벤조산 시료 매트릭스 1 μL(50% 수성 아세토니트릴에서 1% w/V)과 혼합합니다. UDP-글루쿠로닉 산과 UDP 자일로스의 예상 m/z 값을 각각 579 및535에서 관찰합니다(그림 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

도 1은 태평양 굴 개인으로부터 유래된 수렴 cDNA 라이브러리의 기재된 제조 방법의 개략적 개요를 나타낸다. 2는 기준 물질의 COX1 및 ND 유전자 서열로부터 높은 발산을 가진 먼 관련 굴 시편의 COX1 및 ND 유전자의 서열을 나타낸다. 3은 기준 물질의 COX1 및 ND 유전자 서열로부터 낮은 발산을 가진 밀접하게 관련된 굴 시편의 COX1 및 ND 유전자의 서열을 나타낸다. 4는 산업적으로 관련된 유전자MgUGD 및 MgUXS를 복제하기 위해 cDNA 라이브러리의 성공적인 적용을 나타낸다.

Figure 1
그림 1 : 설명된 분석 방법의 개략적인 개요 의 분자 식별 태평양 굴 표본 COX1 및 ND를 참조 유전자로 사용. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2 : 참조로부터COX1 및 ND 유전자 서열과 비교하여 고발산 시편의 COX1 및 ND 유전자 서열의 서열 정렬 태평양 굴 변형. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3 : 참조로부터 COX1 및 ND 유전자 서열과 비교하여 밀접하게 관련된 표본의 COX1 및 ND 유전자 서열의 서열 정렬 태평양 굴 변형. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
그림 4 : 개략적인 개요 MgUGD 및 MgUXS의 반응 제품의 분자 복제, 재조합 발현 및 검출. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

제시된 프로토콜은 COX1과 ND 유전자를 공개적으로 이용 가능한 굴 DNA 게놈 데이터베이스와 비교하여 지역 해산물 시장에서 유사한 표현형을 가진 참조되지 않은 굴 표본의 유전 적 식별을 허용합니다. 이 방법의 중요성은 가상 cDNA 라이브러리의 평가를 위해 단일 PCR 반응만 필요하기 때문에 단순성입니다. 보존된 2개의 미토콘드리아 COX1 및 ND 유전자는 각 굴에서 RNA 추출물의 역전사에 의해 생성된 cDNA 라이브러리로부터 증폭되었다. RNA 분리 방법(단계 2.1)은 액체 질소에서 굴 조직을 직접 분쇄함으로써 단순화되었다. 각 시편의 COX1 및 ND 유전자를 시퀀싱한 후, 서열 정렬은 일부 샘플이 기준 균주와 높은 유사성을 보이는 것으로 나타났다. 가장 가까운 상대는 COX1 및 ND 유전자 서열 둘 다의 완전한 동일성을 보였다.

이 절차의 가장 중요한 단계는 RNA 추출 단계입니다. RNA 분해를 최소화하기 위해서는 굴 조직 수확과 RNA 추출 사이의 시간을 줄이는 것이 필수적입니다.

성공적인 복제는 최근 굴 UGE 유전자12를 복제하고 본원에서 생성된 cDNA 라이브러리의 실용성을 검증한 MgUGD 및 MgUXS 유전자13을복제하여 예시되었으며, 관심 있는 임의의 유전자의 복제를 허용하였다. 퇴화 프라이머를 사용하여 성가신 복제 전략에 대한 필요없이. 사실상 서열화된 cDNA 라이브러리를 생성하는 COX1 및 ND 유전자의 증폭에 의한 분자 식별 방법은 참조된 게놈의 물리적 샘플이 없는 다른 생물학적 물질에 대한 향후 응용 분야에서도 사용될 수 있습니다. 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

이 작품은 중국 자연과학 재단(교부금 번호 31471703, A020130537 및 31671854, J.V. 및 L.L.에 31670435) 및 100 외국 인재 계획(JSB2014012)에 의해 부분적으로 지원되었습니다.

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics